ID: 969339271

View in Genome Browser
Species Human (GRCh38)
Location 4:6530145-6530167
Sequence ATATTCCATGGGCGGTGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 55}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969339271_969339282 8 Left 969339271 4:6530145-6530167 CCTTAGCACCGCCCATGGAATAT 0: 1
1: 0
2: 1
3: 6
4: 55
Right 969339282 4:6530176-6530198 AAGCCGGGGTCCCGGGTTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 123
969339271_969339278 0 Left 969339271 4:6530145-6530167 CCTTAGCACCGCCCATGGAATAT 0: 1
1: 0
2: 1
3: 6
4: 55
Right 969339278 4:6530168-6530190 GACGTCTTAAGCCGGGGTCCCGG 0: 1
1: 0
2: 0
3: 0
4: 26
969339271_969339280 6 Left 969339271 4:6530145-6530167 CCTTAGCACCGCCCATGGAATAT 0: 1
1: 0
2: 1
3: 6
4: 55
Right 969339280 4:6530174-6530196 TTAAGCCGGGGTCCCGGGTTTGG 0: 1
1: 0
2: 0
3: 4
4: 38
969339271_969339275 -8 Left 969339271 4:6530145-6530167 CCTTAGCACCGCCCATGGAATAT 0: 1
1: 0
2: 1
3: 6
4: 55
Right 969339275 4:6530160-6530182 TGGAATATGACGTCTTAAGCCGG 0: 1
1: 0
2: 0
3: 2
4: 68
969339271_969339276 -7 Left 969339271 4:6530145-6530167 CCTTAGCACCGCCCATGGAATAT 0: 1
1: 0
2: 1
3: 6
4: 55
Right 969339276 4:6530161-6530183 GGAATATGACGTCTTAAGCCGGG No data
969339271_969339277 -6 Left 969339271 4:6530145-6530167 CCTTAGCACCGCCCATGGAATAT 0: 1
1: 0
2: 1
3: 6
4: 55
Right 969339277 4:6530162-6530184 GAATATGACGTCTTAAGCCGGGG No data
969339271_969339281 7 Left 969339271 4:6530145-6530167 CCTTAGCACCGCCCATGGAATAT 0: 1
1: 0
2: 1
3: 6
4: 55
Right 969339281 4:6530175-6530197 TAAGCCGGGGTCCCGGGTTTGGG 0: 1
1: 0
2: 0
3: 2
4: 40
969339271_969339279 1 Left 969339271 4:6530145-6530167 CCTTAGCACCGCCCATGGAATAT 0: 1
1: 0
2: 1
3: 6
4: 55
Right 969339279 4:6530169-6530191 ACGTCTTAAGCCGGGGTCCCGGG 0: 1
1: 0
2: 0
3: 2
4: 37
969339271_969339284 16 Left 969339271 4:6530145-6530167 CCTTAGCACCGCCCATGGAATAT 0: 1
1: 0
2: 1
3: 6
4: 55
Right 969339284 4:6530184-6530206 GTCCCGGGTTTGGGGTTTTGAGG 0: 1
1: 0
2: 3
3: 7
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969339271 Original CRISPR ATATTCCATGGGCGGTGCTA AGG (reversed) Intronic
903916222 1:26766329-26766351 ATATTCCATGGGTGGAACCATGG + Exonic
910495091 1:87817751-87817773 ATATTCCCTTGAAGGTGCTAGGG + Intergenic
917004839 1:170402726-170402748 ATGTTCCGTGGGCGGTGTTCTGG - Intergenic
917758333 1:178126720-178126742 ATATTCCATGGGAGATGATGGGG + Intronic
918810940 1:189119657-189119679 ACATTCCTTGGGCTGTGCAAGGG + Intergenic
921816004 1:219564138-219564160 ATCTTCCAGGGTCGGTGCTAGGG + Intergenic
922740921 1:228013849-228013871 CCACTCCATGGGCGGTGATAAGG - Intronic
1067977631 10:51043725-51043747 ACATTCCATGTACTGTGCTATGG - Intronic
1070427349 10:76302355-76302377 ATCTTCCCTGGGGGGTGGTAAGG + Intronic
1071930321 10:90462380-90462402 GTATTCCAGGTGCTGTGCTAAGG + Intergenic
1072362532 10:94673876-94673898 ATAATCCATGGGTGTTGCTGGGG - Intergenic
1077014262 11:392938-392960 ATCTTCCAGGGACGGAGCTAGGG + Intronic
1097795215 12:63854140-63854162 ACATTCCATGGGGGTTTCTAAGG - Intronic
1097900435 12:64867625-64867647 ATATGCCAGGGTCTGTGCTAAGG - Intronic
1100125139 12:91415708-91415730 ATGTTCCATGTGCTATGCTAAGG - Intergenic
1137395495 16:48113960-48113982 ATATTCCAGGTGCAGAGCTAGGG + Intronic
1138676764 16:58656953-58656975 AGATTTCATGGGCTGTGCTTTGG - Intergenic
1143060496 17:4196593-4196615 ATATGCAAAGGGCCGTGCTATGG + Intronic
1152427187 17:80224819-80224841 AGAGTCCCTGGGCGGGGCTAGGG - Intronic
1158415048 18:57242847-57242869 ATCTTCCATGGGAGGGGCTCAGG + Intergenic
1158885112 18:61819671-61819693 ATATTCCACTGGAGGTGCTGGGG + Intronic
1159843633 18:73431147-73431169 ATATTGCATGGGAGGTGTTAAGG - Intergenic
925159403 2:1673455-1673477 ATGATCCATGAGCGGTGCTGTGG - Intronic
925898758 2:8493905-8493927 ATATTCCAGAGGAGGTGCTCAGG - Intergenic
932977359 2:76619628-76619650 ATATTCCATAAGTGGTGCTGAGG - Intergenic
933225904 2:79749152-79749174 ATGTTCCATGGGCTGGGCTGGGG + Intronic
935160809 2:100527932-100527954 ATATACCATGGGTGGTGCTTTGG + Intergenic
935452793 2:103229652-103229674 ATATTCAATGGGCTGTGCAAAGG - Intergenic
1170756746 20:19212306-19212328 CTATTCCATGGTCGGCGCGATGG - Intergenic
1175864857 20:62169978-62170000 ATCTTCCCTGGGCAGTGCTGGGG + Intronic
952101788 3:30021927-30021949 TTATTCCATGGGTGGAGGTACGG + Intergenic
956938224 3:74128228-74128250 GTATTCCATGGGGGCTGCTTGGG - Intergenic
959880476 3:111439575-111439597 CTATTCCATGGGCTGTGCTATGG + Intronic
963141914 3:141953308-141953330 GTATCCCATGGGCTGTGCTCTGG - Intronic
968975923 4:3822008-3822030 AGAGACCATGGGCTGTGCTAGGG - Intergenic
969319771 4:6404681-6404703 AGATTCCAAGGGGGGTTCTAAGG + Intronic
969339271 4:6530145-6530167 ATATTCCATGGGCGGTGCTAAGG - Intronic
970466782 4:16331944-16331966 ATATTCCTTTAGAGGTGCTAGGG - Intergenic
970899259 4:21139652-21139674 CAATTCCAGGGGCAGTGCTAAGG - Intronic
974721192 4:65740892-65740914 ATATTCCATGGGAGTTCCAATGG - Intergenic
977635568 4:99293903-99293925 ATAATCTATTGGGGGTGCTATGG + Intergenic
979316706 4:119273519-119273541 ATATGCCATGTGCTGTTCTAGGG - Intronic
983273342 4:165588967-165588989 ATATTCCATGGGGAGTGATCAGG + Intergenic
986183434 5:5415564-5415586 ATATTCCATGGTTTGTGATATGG + Intergenic
995117987 5:108503093-108503115 ATATTCCATGTACTGAGCTAAGG - Intergenic
1004078964 6:12372006-12372028 ATTTTCCATGGTCGGTGCAGAGG + Intergenic
1014782466 6:125580404-125580426 ATGTTCCATGTGCTATGCTAGGG - Intergenic
1016566708 6:145463402-145463424 ATATTGCATGGGAGGTGATCTGG - Intergenic
1020333125 7:7040424-7040446 ATATCCAATGGACAGTGCTATGG - Intergenic
1024835653 7:53514914-53514936 AATTTCCATAGGCGGTGCAAGGG - Intergenic
1029588223 7:101489064-101489086 AGATGCCATGGGCGGTTCAAAGG - Intronic
1031718940 7:125144415-125144437 ATATTCCATGGGCAGAGGCATGG - Intergenic
1033183475 7:139203459-139203481 ATATTGCATGTTAGGTGCTAGGG - Intergenic
1037074648 8:14699376-14699398 ATATTCAATAAGTGGTGCTAGGG + Intronic
1042131163 8:65587901-65587923 ATATTCAATGGGGCCTGCTATGG - Intergenic
1043388740 8:79770925-79770947 ATGTGCCATGTGCTGTGCTAGGG + Intergenic
1044049065 8:87476873-87476895 AGAGTCCATGGGTGGGGCTAGGG + Intronic
1047842841 8:128772742-128772764 ATATACCATGCACTGTGCTAAGG - Intergenic
1050832477 9:10030745-10030767 ATAATCCATGGGCAGTGTTCAGG - Intronic
1050840831 9:10147001-10147023 ATATTCCATCGGCTGTGCCCAGG - Intronic
1053445682 9:38151193-38151215 ACCTTCCAGGGGCGGTGCTAAGG - Intergenic
1189160063 X:38802222-38802244 TTGTTCCATGGGCCGTGCCAAGG - Intronic
1198265005 X:135000858-135000880 ATATTTCATTGGGGGTGCTAAGG - Intergenic