ID: 969345216

View in Genome Browser
Species Human (GRCh38)
Location 4:6565539-6565561
Sequence GTGAACAAAACGAAGTCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969345214_969345216 -4 Left 969345214 4:6565520-6565542 CCAGGTGCCAAATCTGGTAGTGA No data
Right 969345216 4:6565539-6565561 GTGAACAAAACGAAGTCTCACGG No data
969345211_969345216 4 Left 969345211 4:6565512-6565534 CCTTTCTCCCAGGTGCCAAATCT No data
Right 969345216 4:6565539-6565561 GTGAACAAAACGAAGTCTCACGG No data
969345208_969345216 9 Left 969345208 4:6565507-6565529 CCCCTCCTTTCTCCCAGGTGCCA 0: 1
1: 0
2: 3
3: 60
4: 543
Right 969345216 4:6565539-6565561 GTGAACAAAACGAAGTCTCACGG No data
969345210_969345216 7 Left 969345210 4:6565509-6565531 CCTCCTTTCTCCCAGGTGCCAAA No data
Right 969345216 4:6565539-6565561 GTGAACAAAACGAAGTCTCACGG No data
969345209_969345216 8 Left 969345209 4:6565508-6565530 CCCTCCTTTCTCCCAGGTGCCAA No data
Right 969345216 4:6565539-6565561 GTGAACAAAACGAAGTCTCACGG No data
969345213_969345216 -3 Left 969345213 4:6565519-6565541 CCCAGGTGCCAAATCTGGTAGTG No data
Right 969345216 4:6565539-6565561 GTGAACAAAACGAAGTCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969345216 Original CRISPR GTGAACAAAACGAAGTCTCA CGG Intergenic
No off target data available for this crispr