ID: 969347879

View in Genome Browser
Species Human (GRCh38)
Location 4:6580581-6580603
Sequence CAGCTGCATCTTGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 1, 2: 5, 3: 38, 4: 402}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969347879_969347883 -5 Left 969347879 4:6580581-6580603 CCCTCCTCCTCAAGATGCAGCTG 0: 1
1: 1
2: 5
3: 38
4: 402
Right 969347883 4:6580599-6580621 AGCTGAGAAGCCCCTCCCGCAGG 0: 1
1: 0
2: 1
3: 9
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969347879 Original CRISPR CAGCTGCATCTTGAGGAGGA GGG (reversed) Intronic
901236090 1:7668359-7668381 CAGCTGCAGCTGGAGGTGAAGGG - Intronic
901629972 1:10643229-10643251 CATCTGGTGCTTGAGGAGGAAGG + Exonic
901972341 1:12918033-12918055 CAGCTGTTTCAGGAGGAGGAGGG + Intronic
902012838 1:13283729-13283751 CAGCTGTTTCAGGAGGAGGAGGG - Intronic
903080418 1:20806875-20806897 GAGGTGCATCTTGAAGGGGAGGG + Exonic
903384577 1:22918046-22918068 CAGCAGGTTCTTGAGCAGGAGGG + Intergenic
903391991 1:22971221-22971243 CAGCTGCATTTTGAGGAGGAGGG - Intergenic
904211402 1:28888459-28888481 CTTCTGCATGTTGGGGAGGAGGG + Intronic
905467871 1:38169247-38169269 CTGCTCCATCTGGAAGAGGAGGG - Intergenic
905591211 1:39165657-39165679 CAGCAGCATAGTGAGGATGAAGG - Intronic
905765010 1:40593064-40593086 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
906388629 1:45394122-45394144 CAGATTCATGTTGAGAAGGAGGG + Intronic
906531048 1:46524250-46524272 CAGAGGCATCAAGAGGAGGAGGG - Intergenic
906669363 1:47643477-47643499 CACCAGCATCCTGAGGTGGAAGG - Intergenic
906846399 1:49197613-49197635 CCACTGCATCTTGAGAGGGAAGG - Intronic
907251520 1:53142638-53142660 CAGCTGCATCATTAGGAGCTGGG + Intergenic
907267253 1:53270354-53270376 TAGCTGCATGTTGAGGAGGAGGG + Intronic
907309493 1:53531149-53531171 CAGGTGACCCTTGAGGAGGAAGG + Intronic
907928703 1:58979032-58979054 CAGCTGCCTCATGAGGGTGAGGG - Intergenic
908415759 1:63911851-63911873 CACCTACAGCTTGAGAAGGAAGG - Intronic
909215263 1:72878540-72878562 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
909951306 1:81723206-81723228 CAGCTGCATTTGGGGGAGAAGGG - Intronic
910230248 1:84978893-84978915 CATCTGCAGGTTGAGGAGCAAGG + Intronic
911642940 1:100308202-100308224 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
912050366 1:105522224-105522246 CATCTGCATGCTGAGGAGTAAGG + Intergenic
912688964 1:111789339-111789361 GAGCTGCATCTTGGAGAGGCTGG + Intronic
912714692 1:111974661-111974683 CATTTCCATCTTCAGGAGGAGGG - Intronic
913055715 1:115157402-115157424 CATTTGCATCTTGAAGAAGAAGG + Intergenic
913242742 1:116843726-116843748 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
913465712 1:119140636-119140658 CAGCGCCATCTTGAGAAGGGCGG + Exonic
913595808 1:120375309-120375331 CATCTGCACGTTGAGGAGCAAGG - Intergenic
914091467 1:144503667-144503689 CATCTGCACGTTGAGGAGCAAGG + Intergenic
914503443 1:148266967-148266989 TGGCTGCATCATGTGGAGGAGGG + Intergenic
914510320 1:148326960-148326982 TGGCTGCATCATGTGGAGGAGGG - Intergenic
916394853 1:164374723-164374745 TAGCCACATCTGGAGGAGGAAGG - Intergenic
917542322 1:175926407-175926429 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
917729970 1:177865210-177865232 GGCCTGGATCTTGAGGAGGAAGG - Intergenic
917758915 1:178133919-178133941 CATCAGAATCTTGAGGAGCAAGG - Intronic
918714860 1:187773040-187773062 CATCTGCAATTTGAGGAGCAAGG + Intergenic
918924066 1:190757006-190757028 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
919876222 1:201870812-201870834 CTGCTGCATCTTACTGAGGATGG - Exonic
922215308 1:223515496-223515518 CAGCTACATCTTGAGGAAAAGGG - Intergenic
922695940 1:227731087-227731109 CAGCTCCATCTGTAGGAGGCCGG + Intronic
924632389 1:245753042-245753064 CAGCAGCATCTTGACAAGGAAGG - Intronic
924658788 1:245997425-245997447 CAGAAGCATGTTGAGGAGGAAGG - Intronic
924926811 1:248691818-248691840 CAGCTGCGTCCTGAGGTGGGCGG - Intergenic
1064723214 10:18250946-18250968 CAGCTGCAAGCTGAGGTGGATGG + Intronic
1064854884 10:19754851-19754873 CATCTGCAAGTTGAGGAGCAAGG - Intronic
1065140381 10:22714102-22714124 CAGCTGCAGCCGGAGGAGGAGGG + Intronic
1066045781 10:31594601-31594623 CAGCTGCAGCTTGGGGAGTGGGG - Intergenic
1066276935 10:33878324-33878346 CAGCTGCATCTTTGGGAGTGAGG - Intergenic
1067104024 10:43353139-43353161 CACCTGCCCCTAGAGGAGGAGGG - Intergenic
1068687710 10:59886258-59886280 CAGCAGCTTCTGGAGGAAGAAGG + Intronic
1068837705 10:61572210-61572232 CATCTGCAGACTGAGGAGGAAGG - Intergenic
1070393929 10:75995276-75995298 CAGCTGCATTCTGAGGAAGGTGG + Intronic
1070742743 10:78913434-78913456 CACCTGCCTCTCGAGGAGGTGGG - Intergenic
1070887354 10:79915358-79915380 CAGATTCAGCTTGAGGAGGGTGG + Intergenic
1073855112 10:107664449-107664471 CATCTGCAAGCTGAGGAGGAAGG - Intergenic
1074244510 10:111675471-111675493 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
1075913963 10:126149847-126149869 CATCTGCAAGTTGAGGAGCAAGG - Intronic
1076555161 10:131316644-131316666 CAGCAGCATCATGAGCAGGCAGG - Intergenic
1076692482 10:132230844-132230866 GAGCTGCATCGTGAGCAGGAGGG - Intronic
1076931504 10:133534690-133534712 TAGCAGCAGCTTCAGGAGGAGGG - Intronic
1077496134 11:2887194-2887216 CAGCTGCAGCTGGGGGAGCAGGG + Intergenic
1079435034 11:20438892-20438914 CAGCTCCAGCTTGAGGGGGTGGG + Intronic
1081952465 11:47056280-47056302 CAGCTGCATGTTGAAGAATATGG + Intronic
1082041629 11:47690356-47690378 CAGCTGCCTCTTGAGGGGTCTGG + Exonic
1083660644 11:64250491-64250513 CAGCTGGCTCTGGGGGAGGAGGG - Intergenic
1083724339 11:64620431-64620453 CAGCTGCCACTTGAGGTGCACGG + Intronic
1084480585 11:69417657-69417679 CAGCTGCCACTTGGGCAGGAAGG + Intergenic
1084548431 11:69826071-69826093 CAGACGCCTCTTGATGAGGAAGG - Intergenic
1086151508 11:83615736-83615758 CAGCAGCCTCTAGAAGAGGATGG + Intronic
1087912631 11:103771243-103771265 CTGCAGCATCTTGAGAAGGTGGG + Intergenic
1091147393 11:133291519-133291541 CAGCTGCCTTTCTAGGAGGACGG - Intronic
1092241068 12:6836972-6836994 CAGCTGCATCCTAAATAGGAAGG - Exonic
1094492459 12:30969584-30969606 CCGCTGCATCCCGAGAAGGATGG - Intronic
1096530176 12:52237434-52237456 CAGCTGCATATGGCGGAGGGGGG + Intronic
1096683091 12:53269840-53269862 CTGCTGCAGGTTGGGGAGGAAGG + Exonic
1098012632 12:66071140-66071162 CAGCAGCATCCTGAGGTGGAGGG - Intergenic
1099104023 12:78478382-78478404 CAGCTGCTTCCTGAGGGGAAGGG - Intergenic
1099480612 12:83161018-83161040 CAGCTTCAACTTGAGGCTGAAGG + Intergenic
1099509221 12:83512685-83512707 CATCTGCAAGCTGAGGAGGAAGG - Intergenic
1099578380 12:84408063-84408085 CAACTGCAACCTGAGGAGCAAGG - Intergenic
1099821733 12:87719857-87719879 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
1100962494 12:99978407-99978429 CAGCTGCATGATGGGGAGTAAGG - Intronic
1101319733 12:103663128-103663150 CACCTGCATCTTCATGAAGACGG - Intronic
1101695700 12:107123927-107123949 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
1102766943 12:115441581-115441603 CATCTGCAATCTGAGGAGGAAGG - Intergenic
1103649503 12:122422229-122422251 AAGCTCCATCTTGAGGCGGGCGG + Intronic
1104783846 12:131437456-131437478 CTGCTCCATCAGGAGGAGGAGGG - Intergenic
1105241181 13:18610544-18610566 CACAGGCAGCTTGAGGAGGATGG + Intergenic
1105472205 13:20704159-20704181 CAGCTGCAGCGTGTGGTGGAAGG - Exonic
1105514295 13:21076380-21076402 CACTTACATCTTCAGGAGGAAGG + Intergenic
1105891481 13:24685462-24685484 TAGCGGCACCTTTAGGAGGAGGG + Intronic
1107168574 13:37313142-37313164 CAGCTGTATCTTGAGGGGAGAGG + Intergenic
1107474057 13:40717814-40717836 CTGTTGCATCTTGAGGAGTGGGG - Intergenic
1107979929 13:45725237-45725259 CATAGGCATCTTGAGTAGGAAGG + Intergenic
1109267168 13:60215239-60215261 CAGCAGAATCTGTAGGAGGATGG - Intergenic
1109536140 13:63722206-63722228 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
1109539960 13:63764080-63764102 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
1109620341 13:64896203-64896225 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
1109777566 13:67061999-67062021 CTCCTGAATTTTGAGGAGGAAGG + Intronic
1111342255 13:86902004-86902026 GAGCTGCATCTTAAGGAAGTTGG - Intergenic
1111385888 13:87526947-87526969 CAGCTGCTTCTTGAAGAGGAGGG - Intergenic
1112105575 13:96235925-96235947 CATCTGCAAGCTGAGGAGGAAGG + Intronic
1112142528 13:96661154-96661176 CATCTGCAAGTTGAGGAGCAAGG - Intronic
1112504908 13:99969780-99969802 CAGCAGCAGCTGGAGCAGGAAGG - Intronic
1113412147 13:110100059-110100081 GAGGTGCATCTTGTGGAGGACGG - Intergenic
1115391685 14:32861209-32861231 CATCTGCAACCTGAGGAGCAAGG - Intergenic
1115716854 14:36115191-36115213 CATCTGCATAGTGAGGAGGAAGG - Intergenic
1116106897 14:40519964-40519986 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
1116248737 14:42454824-42454846 CATCTGCAAGTTGAGGAGAAAGG - Intergenic
1116291846 14:43053380-43053402 CATCTGCAGGTTGAGGAGCAAGG + Intergenic
1116333743 14:43630381-43630403 CACCTGCAAGTTGAGGAGCAAGG + Intergenic
1118466395 14:66034940-66034962 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
1120523408 14:85550140-85550162 CAACTGCATGTAGAGGAGGCTGG + Intronic
1120873710 14:89360235-89360257 CAGCTGCCCCTAAAGGAGGAAGG + Intronic
1121504866 14:94469415-94469437 CAGCTCCTTCTTGACGAAGAGGG + Exonic
1121517662 14:94563543-94563565 CAGCTGCACGTTGAGCATGATGG + Exonic
1121755969 14:96402355-96402377 CAGCCGCATTTTCAGGAGAATGG - Intronic
1122408980 14:101516572-101516594 CGGCTGCTTCTTGAGGGGCAGGG + Intergenic
1123490174 15:20774603-20774625 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1123546675 15:21343690-21343712 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1123917199 15:25043580-25043602 CCTCTGCATCTTGAGTAGGTGGG + Intergenic
1124360430 15:29032931-29032953 CAGCTGCAGCATGGGGAGCATGG + Intronic
1126348367 15:47718852-47718874 CAGGGGCATGGTGAGGAGGAAGG + Exonic
1126795798 15:52259847-52259869 CTGCTGCCTCCTGGGGAGGAGGG - Intronic
1126804398 15:52331742-52331764 CTGCTGCAGCATGAGGTGGACGG - Intronic
1127368162 15:58310520-58310542 CAGCAGCATCTTGAGGGGTGAGG + Intronic
1128412561 15:67414134-67414156 CAGCTGCTTCCTGAGCAGCAAGG + Intronic
1128605876 15:69036426-69036448 TTTCTGCATCTTGAGGAGGCTGG - Intronic
1130804937 15:87310061-87310083 GAGCTGCATCTTGAAGAGCTGGG + Intergenic
1202955006 15_KI270727v1_random:70905-70927 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1132558278 16:582290-582312 CACCTGCATCAGGAGGCGGAGGG - Intronic
1134824627 16:17274688-17274710 CAGCCTCATCTTGAGAAGAAAGG + Intronic
1136363547 16:29797406-29797428 CAGCTGCAGCTTGGGTAGGCTGG - Intronic
1138342548 16:56299772-56299794 AAGCATCATCTTCAGGAGGATGG + Intronic
1138374006 16:56550067-56550089 CAGCTGCAACTTGTGGAGGAAGG - Intergenic
1139205686 16:65026263-65026285 CTGCAGCATCTTGATGAGGTGGG + Intronic
1139651604 16:68365084-68365106 CACCTGCACCTGGGGGAGGAGGG + Exonic
1140489168 16:75319680-75319702 AAGCTGCCTCTGGAGGAAGAGGG - Intronic
1140981473 16:80113609-80113631 CATCTGCTTCGTGGGGAGGATGG + Intergenic
1142646129 17:1315072-1315094 CTGATGCATCTTAAGGAGGCAGG - Intergenic
1144394826 17:14833971-14833993 GAACTGTATTTTGAGGAGGAAGG - Intergenic
1144838955 17:18173904-18173926 CAGCTGCAGCTGGAGCAGGTGGG + Exonic
1145098598 17:20053979-20054001 CAGTTGTATCTTGGAGAGGAAGG - Intronic
1145265887 17:21379437-21379459 CAGCTGCACCTGTTGGAGGAAGG - Intronic
1146515762 17:33487968-33487990 CATCTGCAAGTTGAGGAGCAAGG - Intronic
1146520097 17:33519620-33519642 CTGCTGCATTTTGAGCAGGTAGG + Intronic
1146886776 17:36476108-36476130 CAGCTGCATGTTGGGGACTATGG - Intergenic
1146947089 17:36880942-36880964 CAACTGGATCTTTAAGAGGAAGG - Intergenic
1148346354 17:46906008-46906030 GAGCTTCCTCTTCAGGAGGAAGG - Intergenic
1148460767 17:47837953-47837975 CAGCAGGATCTGGAGCAGGAAGG - Exonic
1149022257 17:51982254-51982276 CAGCTAAATCCTGAGGGGGAAGG - Intronic
1149920043 17:60649342-60649364 AAGCTGTATTTTGAGGTGGAAGG + Intronic
1151184323 17:72352130-72352152 CAGCCGCACCATCAGGAGGAAGG + Intergenic
1151290671 17:73147728-73147750 TGGCAGCATGTTGAGGAGGAAGG - Intergenic
1151750930 17:76037156-76037178 CTGCAGCATCGTGAGGGGGACGG - Intergenic
1152497486 17:80683950-80683972 GAGCGGCATGTTGAGGATGAGGG - Intronic
1153290152 18:3493034-3493056 CAGGAGCATGTTGAGGAGGAGGG + Intergenic
1153871177 18:9321688-9321710 CAGCTGCCCCATGAGGAGGTAGG + Intergenic
1153919045 18:9772278-9772300 CACCTGCAGCCTAAGGAGGAAGG + Intronic
1154447777 18:14449357-14449379 CACAGGCAGCTTGAGGAGGATGG - Intergenic
1156890443 18:42184561-42184583 CATCTGCAACCTGAGGAGCAAGG + Intergenic
1156990719 18:43404248-43404270 CATCTGCAAGTTGAGGAGAAAGG + Intergenic
1157145366 18:45157236-45157258 CAGCTTCATTTTGAGAAGAAGGG - Intergenic
1158037370 18:53049902-53049924 CATCTGCAAATTGAGGAGCAAGG + Intronic
1158723847 18:59950202-59950224 CATCTGCAAGTTGAGGAGCAGGG - Intergenic
1159706188 18:71691693-71691715 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
1160208672 18:76858725-76858747 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208699 18:76858813-76858835 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160208769 18:76859033-76859055 CAGGTGCAGGTGGAGGAGGAAGG + Intronic
1160526189 18:79539532-79539554 CAGCTGCAGCTGCTGGAGGAGGG - Intergenic
1160755440 19:754801-754823 GAGCTGCAGGTAGAGGAGGAGGG + Intronic
1161025319 19:2034045-2034067 CAGCTGGGCCTAGAGGAGGAAGG - Intronic
1161888926 19:7019595-7019617 CAGCTGCATCTTCCGGAGGCCGG - Intergenic
1161890442 19:7032426-7032448 CAGCTGCATCTTCCGGAGGCCGG + Exonic
1161891006 19:7038307-7038329 CAGCTGCATCTTCCGGAGGCCGG - Exonic
1161892528 19:7051154-7051176 CAGCTGCATCTTCCGGAGGCCGG + Exonic
1161893091 19:7056768-7056790 CAGCTGCATCTTCCGGAGGCCGG - Exonic
1164774001 19:30836696-30836718 CAGCTGCATCATGAGAATGATGG - Intergenic
1164817884 19:31220217-31220239 CGGCTGCAACTTTAAGAGGAAGG + Intergenic
1165419773 19:35717162-35717184 CGGCTGCCTCCTGGGGAGGACGG - Intergenic
1166042995 19:40214321-40214343 CTCCTGCTTCTTGTGGAGGAGGG + Intronic
1167192643 19:48002320-48002342 CATTTGAATCTTGAGGAGAAGGG + Intronic
1167517621 19:49932548-49932570 CAGCTCCTTCTTGAGGAGGGAGG - Exonic
1168022871 19:53622587-53622609 CTGCTGCATATTGGGCAGGAAGG - Intergenic
1168257894 19:55176833-55176855 CAGCTCCTTATTGAGAAGGAAGG + Intronic
1168306604 19:55439299-55439321 GAGCTGGATCTTGAGGCAGATGG - Intronic
925038958 2:715368-715390 CAGCTGCATCTGGAAGGTGAGGG - Intergenic
925038971 2:715437-715459 CAGCTGCATCTGGAAGGCGAGGG - Intergenic
925089995 2:1147534-1147556 CATCTGCATGCTGAGGAGCAAGG - Intronic
925507869 2:4588963-4588985 CAACTGGATTTTGAGGAAGAAGG - Intergenic
925604496 2:5644661-5644683 CATCTGCACGTTGAGGAGCAAGG - Intergenic
926285915 2:11488011-11488033 CATCTGCTCCTTGAGGAGGTTGG + Intergenic
926427337 2:12751059-12751081 CAGCTGGATCCTCAGGAGAAAGG - Intergenic
926554119 2:14336591-14336613 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
927349995 2:22099944-22099966 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
928859987 2:35846119-35846141 CAGCTGCATCTAGCGGTGGGGGG + Intergenic
929024352 2:37585425-37585447 CAGCTGCTGCTTAAGGGGGAAGG + Intergenic
930937340 2:56970087-56970109 CGGCTGCTTCTTGGGGAGGGAGG - Intergenic
931203529 2:60124428-60124450 CATCTGCAAAGTGAGGAGGATGG + Intergenic
931469659 2:62525875-62525897 CAGCCATATCTTGAGGATGAGGG - Intergenic
931494787 2:62792345-62792367 TAGCTGCTTCTTGTGGAGCAGGG + Intronic
931791272 2:65666288-65666310 GAGCAGCATGTTGAGGAGGTTGG + Intergenic
932264507 2:70355735-70355757 GAGATGCATCTTGAAGAGCAAGG + Intergenic
933041935 2:77480029-77480051 CACCACCATCTAGAGGAGGAAGG + Intronic
933703740 2:85274405-85274427 CAGCTGCATGCTCTGGAGGAGGG - Intronic
935097799 2:99962187-99962209 CAGCTGCTTGAGGAGGAGGAAGG - Intronic
935854630 2:107260633-107260655 CATCTGCAAGTTGAGGAGAAAGG + Intergenic
936378966 2:111967549-111967571 CAGCTGCATCTGCTGGGGGAGGG - Intronic
936974741 2:118207783-118207805 CAGCTGCATTTTGAATAGCAAGG + Intergenic
937983263 2:127627187-127627209 CAGCTGCGTCTTGGGCAGGCGGG - Exonic
938070494 2:128305789-128305811 CAGCTGGACCTTGAGGAGGGTGG + Intronic
938260397 2:129891752-129891774 CAGCAGCAGCAGGAGGAGGATGG - Intergenic
940472550 2:154116961-154116983 CAGCTGCAAGCTGAGGAGCAAGG + Intronic
941081117 2:161061625-161061647 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
941520572 2:166537103-166537125 CATCTGCAACTTGAGGAGGTAGG + Intergenic
941822946 2:169860825-169860847 CATCTGCAAGTTGAGGAGCAAGG + Intronic
941852115 2:170194750-170194772 CATCTGCAAGTTGAGGAGCAAGG + Intronic
942088069 2:172462061-172462083 CAGCTTTACCTTGAGGATGAAGG + Intronic
942116201 2:172731441-172731463 CAGCTGTAGGTTGGGGAGGAGGG + Intergenic
944657603 2:201891566-201891588 CAGGGTAATCTTGAGGAGGAAGG + Intronic
945514059 2:210740249-210740271 CAGCTGCAGGTTCAGTAGGACGG + Intergenic
945738435 2:213630798-213630820 CAGCTGAATTTTGAGGAGTATGG - Intronic
947067236 2:226241372-226241394 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
948270605 2:236670555-236670577 CAGCTGCCTCTCCAGGATGAGGG - Intergenic
948789513 2:240370083-240370105 CAGCTGTGTCTGGGGGAGGAGGG + Intergenic
1168734247 20:116193-116215 CTGCTGCTTTTTGAGAAGGAAGG - Intergenic
1168810502 20:701607-701629 CAGCTGTAGGGTGAGGAGGATGG - Intergenic
1169366717 20:4998513-4998535 CAGCTTAACCTGGAGGAGGATGG + Intronic
1169405906 20:5321067-5321089 CATCTGCCTCTAGGGGAGGAAGG + Intergenic
1171252471 20:23659529-23659551 CATCTGCAAGTTGAGGAGTAAGG + Intergenic
1173101370 20:40091814-40091836 CAGCTGGAGCTGGAGGAGCAGGG + Intergenic
1173189495 20:40865260-40865282 GAGCTGCAGCTGGAGGACGAAGG - Intergenic
1173750091 20:45469816-45469838 CAGCAGCAGGCTGAGGAGGAGGG - Exonic
1173809865 20:45949142-45949164 GAGCTGGATCCTGAGGAGCATGG - Intronic
1175599577 20:60262330-60262352 CCTCTGCATCTTGAAGAGCATGG - Intergenic
1176102746 20:63372019-63372041 CAGCAGCATCTCGTGGAGGGAGG + Intronic
1176210535 20:63919188-63919210 CTGCTGCATTCTGAGGAGCAGGG + Intronic
1177757110 21:25361278-25361300 CACCTGCAGAATGAGGAGGAAGG + Intergenic
1177884407 21:26731636-26731658 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
1177909488 21:27013009-27013031 CTGCTGAATCTTGAGTAAGAAGG + Intergenic
1177998896 21:28135656-28135678 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
1178106312 21:29323281-29323303 CACCTGCAAGCTGAGGAGGAAGG + Intronic
1178465988 21:32848034-32848056 TAGCTGCATCATTAGCAGGAAGG - Intergenic
1179379619 21:40886423-40886445 CAGCTGTACCTTGGGGAGAATGG + Intergenic
1179592108 21:42415666-42415688 CAGCAGCATCTGCTGGAGGACGG - Intronic
1180240512 21:46500878-46500900 CAGCTGCATCTGCAGGAGTCAGG - Intronic
1182041024 22:27239234-27239256 CAGCTGCAGCTGGAGGAGGAAGG + Intergenic
1182796671 22:32995992-32996014 CAGCTGCACCAGAAGGAGGAGGG + Intronic
1183372634 22:37442845-37442867 CACCTGCAGGTTGAGGAAGATGG + Intergenic
1183743551 22:39680916-39680938 CAGCTGCACCTGCAGGAAGAGGG - Exonic
1184459104 22:44627127-44627149 CAGCTGCACCTTGAAGAGGTGGG - Intergenic
1185056948 22:48586106-48586128 CAGAGGCTTCCTGAGGAGGAAGG + Intronic
950312387 3:11969971-11969993 CTGCTGCATTCTGAGGAGCAGGG + Intergenic
950971749 3:17196203-17196225 CAGCAGCATCTTGAGATGGAGGG - Intronic
951423707 3:22517803-22517825 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
953021232 3:39114673-39114695 CAGCTGCATCTTCAGGACGAGGG - Exonic
953372030 3:42397214-42397236 CAGTTGCATCTTGTGAATGAAGG - Exonic
953454191 3:43029124-43029146 CAGCAGCAGCTTCAGGTGGATGG + Intronic
954296666 3:49678097-49678119 CAGCTGGGTCTTCAGGAGGGTGG + Intronic
954368461 3:50158084-50158106 CAGGTGCACCTTGAGGGTGACGG + Intronic
954425581 3:50441192-50441214 AAGTTGCCTCTTGAGGACGAGGG - Intronic
955384933 3:58471810-58471832 CAGGTCCATCATCAGGAGGAGGG - Intergenic
955487982 3:59454070-59454092 CAGTTAAATCTTGAAGAGGAAGG + Intergenic
956701610 3:71964174-71964196 CTAAGGCATCTTGAGGAGGAAGG + Intergenic
957254565 3:77820169-77820191 CATCTGCAAGTTGAGGAGAAAGG - Intergenic
958586932 3:96099091-96099113 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
958689716 3:97448230-97448252 CAGCTGCATCTTGAGCAAAATGG - Intronic
958715519 3:97775321-97775343 CATCTGCATGCTGAGGAGCAAGG + Intronic
958933968 3:100238020-100238042 CATCTGCAAGCTGAGGAGGAAGG - Intergenic
959109519 3:102105306-102105328 CAGCTGCATATTGAGGTGTGAGG - Intronic
959425109 3:106177873-106177895 CATCTGCATGTTGAGGAGCAAGG + Intergenic
962046776 3:131768607-131768629 CAGCTTCATCTCAAGCAGGATGG + Intronic
962075823 3:132080797-132080819 CATCTGCAAGTTAAGGAGGAAGG - Intronic
962829526 3:139127928-139127950 TAGCAGCATCTTTAGAAGGAAGG + Intronic
963660965 3:148128773-148128795 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
964612617 3:158630377-158630399 CATCTGCATGCTGAGGAGCAAGG + Intergenic
965071346 3:163918449-163918471 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
965269781 3:166600493-166600515 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
965446678 3:168781773-168781795 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
965951003 3:174308240-174308262 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
966819390 3:183913229-183913251 CAGCAGTATTTTGAGGAGGGAGG - Intergenic
966822785 3:183938262-183938284 CAGCTTCAGCCTGAGAAGGAAGG + Intronic
967813349 3:193779195-193779217 CTGCTGGATCTTTGGGAGGAAGG + Intergenic
967930799 3:194688448-194688470 CAGCTGGGGCCTGAGGAGGAGGG + Exonic
968813376 4:2809906-2809928 CAGCTGCAACTTGGGAAGGATGG + Intronic
969347879 4:6580581-6580603 CAGCTGCATCTTGAGGAGGAGGG - Intronic
969389121 4:6877546-6877568 CATCTGCAAGCTGAGGAGGAAGG + Intronic
969529024 4:7719625-7719647 CAGCAGCATCTTGGGGCGGCAGG + Intronic
969991700 4:11271166-11271188 CATCTGCAAATTGAGGAGGAAGG + Intergenic
970785780 4:19794304-19794326 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
971824489 4:31603866-31603888 CATCTGCATGTTGAGGAGCAAGG + Intergenic
972312370 4:37892858-37892880 CAGCTGGATAATGAGGAAGAAGG - Intronic
973035712 4:45403593-45403615 CATCTGCAAGTTGAGGAGAAAGG + Intergenic
974237284 4:59198520-59198542 CAGCTAGATCTTCTGGAGGAGGG - Intergenic
975684153 4:76903196-76903218 GAGCTGCATGTCCAGGAGGAAGG + Intergenic
976030643 4:80749504-80749526 CATCTGCAAGTTGAGGAGCAAGG + Intronic
976397593 4:84572817-84572839 CAGCTGCATGTGGAAAAGGAAGG - Intergenic
977196828 4:94073087-94073109 CACATGCCTCTTGGGGAGGAGGG + Intergenic
979507244 4:121512643-121512665 CATCTGCAGGCTGAGGAGGAAGG + Intergenic
979774537 4:124572841-124572863 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
980385470 4:132084302-132084324 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
981229550 4:142336650-142336672 CACCAGCATCTGGACGAGGAGGG - Intronic
982284841 4:153724261-153724283 CAGCTTCATGTCTAGGAGGATGG + Intronic
985026414 4:185743709-185743731 CATCTGAATCAGGAGGAGGAGGG - Intronic
985798194 5:1980551-1980573 CATCTGCAAGTTGAGGAGCAGGG - Intergenic
985961651 5:3307263-3307285 CATCTGCAGGTGGAGGAGGAGGG + Intergenic
986104891 5:4650302-4650324 CAGCTGCATCTTCAGCACCAAGG - Intergenic
986571389 5:9169722-9169744 CAGCTGCTTCATGACAAGGAAGG + Intronic
988100472 5:26669864-26669886 CTGCTGCCGCATGAGGAGGAAGG + Intergenic
988314176 5:29602654-29602676 CATCTGCAGGCTGAGGAGGAAGG + Intergenic
988655776 5:33210078-33210100 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
990221138 5:53589914-53589936 CATCTGCAAGTTGAGGAGCAAGG - Intronic
990620669 5:57555461-57555483 GAGATGCATCTTGAAGATGAAGG - Intergenic
990693810 5:58392696-58392718 CTGCTGCATTTTGAGGTGAAGGG - Intergenic
991021904 5:61988081-61988103 CAGATGCACCTTATGGAGGAGGG - Intergenic
992486480 5:77201926-77201948 CACCTGCAAGTTGAGGAGGGAGG - Intergenic
992603665 5:78433398-78433420 CAGCTGTGCCCTGAGGAGGATGG - Intronic
993036441 5:82762603-82762625 CATCTGCAGGTTGAGGAGCAAGG - Intergenic
994786675 5:104173570-104173592 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
995187131 5:109283302-109283324 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
996164585 5:120209628-120209650 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
996586228 5:125090654-125090676 AAGCTGCATCCTTTGGAGGAGGG + Intergenic
997170950 5:131720017-131720039 CTGCTGCTTCTTGAAGAAGAAGG - Intronic
997747321 5:136310558-136310580 GAGCTGGCTCTTGAGGAGGGTGG + Intronic
998502407 5:142645013-142645035 CAGCAGCATCCTGAGTGGGAGGG + Intronic
998510474 5:142709564-142709586 CATCTGCAACCTGAGGAGCAAGG - Intergenic
998968749 5:147568770-147568792 AAGCAGGATGTTGAGGAGGAGGG + Intergenic
999380357 5:151117161-151117183 CAGGGGCATCGTGAGGAGGGAGG - Exonic
999685156 5:154096165-154096187 AAGCAACATCTTCAGGAGGAAGG + Intronic
999818330 5:155199808-155199830 CTGCTGCATATGCAGGAGGAAGG + Intergenic
1000397788 5:160794244-160794266 TTGCTGCATTTTGAGCAGGATGG + Intronic
1001539786 5:172529767-172529789 TAGCTGCATCTGCAGGAGTATGG - Intergenic
1001651439 5:173318859-173318881 CCTCTGCATCTGGAGGAGTATGG + Intronic
1006007224 6:31012245-31012267 CAGATGCATACTGAGGAAGAAGG - Intronic
1006162492 6:32046637-32046659 CAGCAGCCTCCAGAGGAGGAGGG - Intronic
1006735474 6:36269963-36269985 CAGCAGCATGTTGGGGAGGGAGG + Intronic
1006909039 6:37552054-37552076 CCTCTGCCTCTTGAGGAAGAAGG + Intergenic
1007476438 6:42122766-42122788 CAGCTGCCTCTTCAGCAGCAAGG + Intronic
1007777106 6:44229972-44229994 CAGCTGCACCTTCACCAGGATGG - Exonic
1007782874 6:44264298-44264320 CATCTGGGTCTGGAGGAGGAAGG + Intronic
1007825168 6:44594777-44594799 CAGCTGCAGCCCTAGGAGGAGGG + Intergenic
1008052698 6:46916009-46916031 CAGCTGCAGGATGATGAGGATGG - Intronic
1008399853 6:51052098-51052120 CATCTGCAAGCTGAGGAGGAAGG - Intergenic
1009711708 6:67330475-67330497 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
1010060195 6:71613956-71613978 CTGCTGCATCTTGTTTAGGAAGG + Intergenic
1010442600 6:75914836-75914858 GAGCTGAATCTTGAGGAGACTGG + Exonic
1010448978 6:75980755-75980777 CATCTGCAAGTTGAGGAGCAAGG - Intronic
1012954946 6:105559765-105559787 CACCTCCATTTGGAGGAGGAAGG - Intergenic
1013722578 6:113048654-113048676 CAAGTGAATCATGAGGAGGAGGG - Intergenic
1014498946 6:122162918-122162940 CATCTGCAATTTGAGGAGCAAGG + Intergenic
1014885648 6:126777688-126777710 CATCTCCATTTTAAGGAGGAAGG - Intergenic
1015402915 6:132806971-132806993 CATCTGCAGGTTGAGGAGCAAGG - Intergenic
1016120507 6:140337437-140337459 CAGGTGATTCTGGAGGAGGAAGG - Intergenic
1017173023 6:151475721-151475743 TTGCTGCATCTTCTGGAGGAGGG + Intergenic
1017677272 6:156827161-156827183 GAGCTGCAGCTTGGGGAGTAAGG - Intronic
1017831061 6:158129151-158129173 TAGCTGCATCTTCAGTAGAAAGG - Intronic
1018129761 6:160717915-160717937 CAGATGGATGTTAAGGAGGATGG - Intronic
1018654042 6:166015422-166015444 CATCTGCAAGTTGAGGAGTAAGG - Intergenic
1018723980 6:166596666-166596688 CATCTGCAAGTTGAGGAGCAAGG - Intronic
1019181329 6:170188815-170188837 CAGCTGCAGCTTGAGTGGGAAGG + Intergenic
1019961189 7:4461328-4461350 CAGCTTTCTCTGGAGGAGGAGGG - Intergenic
1020286289 7:6683666-6683688 CAGCTGAGACTTGAGGAAGAGGG + Intergenic
1021087526 7:16440421-16440443 CAGCTGTATAATGAGGAGGAAGG - Intergenic
1023301736 7:38780378-38780400 CACCTCCATCAGGAGGAGGAAGG - Intronic
1023389135 7:39691004-39691026 CATCTATATTTTGAGGAGGATGG - Intronic
1023968527 7:44975943-44975965 CAGCTGCAGCCTGGGGAGGAGGG + Intronic
1024260155 7:47568280-47568302 CAGCTGCATCTCGAAGGTGAAGG - Intronic
1026519409 7:71103437-71103459 CAGCTGCAGCTTGAAGCAGATGG + Intergenic
1027347046 7:77271397-77271419 CATCTGCAAGCTGAGGAGGAAGG - Intronic
1027692788 7:81369226-81369248 CATCTGCAAATTGAGGAGCAAGG - Intergenic
1027807892 7:82852631-82852653 CATCTGCAAGTTGAGGAGCAAGG - Intronic
1030450271 7:109700335-109700357 CATCTGCAAATTGAGGAGCAAGG - Intergenic
1032527482 7:132590433-132590455 CATCTGCAAGTTGAGGAGCAAGG + Intronic
1032788337 7:135219875-135219897 CAGCTGCATCTTGGTAAGAATGG + Intergenic
1032923831 7:136579162-136579184 CATCTGCAGGTTGAGGAGCAAGG + Intergenic
1033040883 7:137917121-137917143 CAGCTGCATCTTGGTGAGTCTGG + Intronic
1033968809 7:147011844-147011866 CAGCACCATATTCAGGAGGAAGG + Intronic
1034434008 7:151054503-151054525 CAGCTGCATCTTCAGGGGCAGGG + Intronic
1034824751 7:154251549-154251571 CATCTGCAAGTTGAGGAGCAAGG + Intronic
1035693764 8:1577836-1577858 CAGGGGCAGGTTGAGGAGGAAGG - Intronic
1036436916 8:8743122-8743144 CAGATGCAACCAGAGGAGGAAGG + Intergenic
1037675380 8:21046430-21046452 CATCTGCATGCTGAGGAGCAAGG + Intergenic
1040793795 8:51267626-51267648 CATCTGCAACCTGAGGAGCAAGG + Intergenic
1042597595 8:70466244-70466266 CAGCTGCAGGCTGAGGAGCAAGG + Intergenic
1043603528 8:81971113-81971135 CAGCTGCACCTTAAGGAGAATGG - Intergenic
1044547543 8:93476407-93476429 CAGCTGCAGGCTGAGGAGCAAGG - Intergenic
1044564245 8:93646379-93646401 CACCTGCTTGTTGAGGTGGAGGG - Intergenic
1044730828 8:95227276-95227298 CAGATGGATGTTGAGGAGTAAGG + Intergenic
1044993017 8:97813139-97813161 CATCTGCAAGTTGAGGAGCAAGG + Intronic
1045251620 8:100487477-100487499 AACCTGGATCATGAGGAGGAGGG + Intergenic
1046220555 8:111208361-111208383 CATCTGCAGCCTGAGGAGCAAGG + Intergenic
1047283290 8:123464461-123464483 CAGCGGCATGAGGAGGAGGAAGG + Intronic
1048141999 8:131803769-131803791 TAGCTGAATATGGAGGAGGAGGG + Intergenic
1048346995 8:133583489-133583511 CAGCTGCATTTTCAGGAGCTGGG + Intergenic
1048439242 8:134447800-134447822 CAGGTGCCTCTTCAGGAGGCTGG - Intergenic
1049389169 8:142359267-142359289 CATCTGCATCTTATGGAGCATGG - Intronic
1049470091 8:142771410-142771432 CATTTGCATCTTGAGGAGTAAGG - Intronic
1049483414 8:142838918-142838940 CAGCTGGATCTTGGGGTGGATGG - Intronic
1049687505 8:143944795-143944817 CAGCAGCAGCTTGTGGGGGAGGG + Intronic
1049871722 8:144984326-144984348 CAGCAGCATTTGGAGGGGGAGGG - Intergenic
1050447484 9:5740537-5740559 CATCTGCAGGCTGAGGAGGAAGG + Intronic
1050527405 9:6558025-6558047 CAGCTGCATCTTAAGCGGGAAGG - Intronic
1050592056 9:7171140-7171162 CAGCTGCATCCTTCAGAGGAAGG + Intergenic
1051551705 9:18337356-18337378 CATCTGCAAGTTGAGGAGTAAGG - Intergenic
1052785373 9:32823184-32823206 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
1053020299 9:34689831-34689853 GCGCTTCATCTAGAGGAGGAAGG + Exonic
1053149784 9:35736120-35736142 CACCTGCATCTTGGTGAGGATGG + Exonic
1053155078 9:35772320-35772342 CAGCTGGATATTGAGATGGAAGG + Intergenic
1053374896 9:37597369-37597391 CAGATGCCTCTTTAGGAAGAGGG + Intronic
1055947882 9:81707815-81707837 CAGCTAAATCTTGATGAGTAAGG - Intergenic
1056456533 9:86766163-86766185 CAGCAGCAGCTGCAGGAGGAGGG + Intergenic
1058567718 9:106304337-106304359 CAGATGCAGCATAAGGAGGAAGG + Intergenic
1058606296 9:106727169-106727191 CAGCTGCAGGCTGAGGAGCAAGG + Intergenic
1058741310 9:107945291-107945313 CAGCTGCATCCTGAGCAGTAAGG - Intergenic
1059422148 9:114198880-114198902 CAGCTGCCTCATGAGGTGGTTGG + Intronic
1060260898 9:122072743-122072765 GAGCTGGATCTGGAGGATGAGGG - Intronic
1060549779 9:124479431-124479453 CAGGTGCTTCTTGCTGAGGATGG + Intergenic
1060819100 9:126651367-126651389 CAGCTGCCTGCTGAGGAGGATGG - Intronic
1061816339 9:133199690-133199712 CAGCTGCAGCTGGGAGAGGAAGG - Intergenic
1062135931 9:134928437-134928459 CATCTGCAAGTTGAGGAGCAAGG - Intergenic
1062304142 9:135893052-135893074 CTGCAGCTTCTTGAGGAGCAGGG - Intronic
1203791538 EBV:154255-154277 CAGCTGCTGCTTGTCGAGGATGG + Intergenic
1186116536 X:6310025-6310047 CAGCTGCAAGCTGAGGAGCAAGG - Intergenic
1186136531 X:6527674-6527696 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
1186778943 X:12893695-12893717 CAGCTCCATCTTAAAGATGATGG + Intergenic
1187192017 X:17044251-17044273 CAGCAGCTTCATGAGCAGGAGGG + Intronic
1187932300 X:24304526-24304548 CATCTGCATGCTGAGGAGCAAGG - Intergenic
1190126210 X:47707835-47707857 GGGCTGGATCTTGAGGAGGGGGG + Intergenic
1190296483 X:49030477-49030499 CAGCTGGACATTGAGGAGGAGGG - Exonic
1190650514 X:52564135-52564157 AGGCAGCAGCTTGAGGAGGATGG - Intergenic
1191226166 X:58045330-58045352 CATCTGCAAGATGAGGAGGAAGG - Intergenic
1192602361 X:72478465-72478487 CAGCTCCGTGTTGAGGGGGATGG - Intronic
1193792886 X:85837945-85837967 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
1193914472 X:87349188-87349210 CATCTGCAAGCTGAGGAGGAAGG + Intergenic
1194491554 X:94556090-94556112 CATCTGCAAGCTGAGGAGGAAGG - Intergenic
1194910558 X:99637561-99637583 CATCTGCAAGTTGAGGAAGAAGG - Intergenic
1195123940 X:101786437-101786459 CATCTGCAAGTTGAGGAGCAAGG + Intergenic
1196275384 X:113760706-113760728 CATCTGCAAGTTGAGGAGTAAGG - Intergenic
1196434199 X:115660060-115660082 CAGCTTGATGTGGAGGAGGAAGG - Intergenic
1197773597 X:130106202-130106224 CAGCAGCAGCTGGAGGAGGGAGG - Intronic
1198593313 X:138208967-138208989 CTGCTGCAAGTTGAGGAGCAAGG + Intergenic
1198783467 X:140261290-140261312 CACCTGCAAGCTGAGGAGGAAGG + Intergenic
1199543580 X:148984209-148984231 CAGCTGCCTCTGAAGCAGGAGGG + Intronic
1200812283 Y:7498688-7498710 AAGCTGCATCTTGAATTGGAAGG + Intergenic