ID: 969352181

View in Genome Browser
Species Human (GRCh38)
Location 4:6604239-6604261
Sequence AGACTCTTGTCTGCTGCAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 137
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 130}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969352181_969352185 11 Left 969352181 4:6604239-6604261 CCAGTTGCAGCAGACAAGAGTCT 0: 1
1: 0
2: 0
3: 6
4: 130
Right 969352185 4:6604273-6604295 CTTTGGTTGCTGCAGTGGATGGG 0: 1
1: 0
2: 1
3: 20
4: 215
969352181_969352186 15 Left 969352181 4:6604239-6604261 CCAGTTGCAGCAGACAAGAGTCT 0: 1
1: 0
2: 0
3: 6
4: 130
Right 969352186 4:6604277-6604299 GGTTGCTGCAGTGGATGGGTTGG 0: 1
1: 0
2: 1
3: 26
4: 257
969352181_969352189 30 Left 969352181 4:6604239-6604261 CCAGTTGCAGCAGACAAGAGTCT 0: 1
1: 0
2: 0
3: 6
4: 130
Right 969352189 4:6604292-6604314 TGGGTTGGTAGGCACAGGAGTGG 0: 1
1: 0
2: 5
3: 26
4: 389
969352181_969352187 19 Left 969352181 4:6604239-6604261 CCAGTTGCAGCAGACAAGAGTCT 0: 1
1: 0
2: 0
3: 6
4: 130
Right 969352187 4:6604281-6604303 GCTGCAGTGGATGGGTTGGTAGG 0: 1
1: 0
2: 2
3: 28
4: 333
969352181_969352184 10 Left 969352181 4:6604239-6604261 CCAGTTGCAGCAGACAAGAGTCT 0: 1
1: 0
2: 0
3: 6
4: 130
Right 969352184 4:6604272-6604294 GCTTTGGTTGCTGCAGTGGATGG 0: 1
1: 0
2: 3
3: 33
4: 273
969352181_969352183 6 Left 969352181 4:6604239-6604261 CCAGTTGCAGCAGACAAGAGTCT 0: 1
1: 0
2: 0
3: 6
4: 130
Right 969352183 4:6604268-6604290 GCTTGCTTTGGTTGCTGCAGTGG 0: 1
1: 0
2: 4
3: 17
4: 311
969352181_969352188 25 Left 969352181 4:6604239-6604261 CCAGTTGCAGCAGACAAGAGTCT 0: 1
1: 0
2: 0
3: 6
4: 130
Right 969352188 4:6604287-6604309 GTGGATGGGTTGGTAGGCACAGG 0: 1
1: 0
2: 0
3: 24
4: 234
969352181_969352182 -6 Left 969352181 4:6604239-6604261 CCAGTTGCAGCAGACAAGAGTCT 0: 1
1: 0
2: 0
3: 6
4: 130
Right 969352182 4:6604256-6604278 GAGTCTCGAAAAGCTTGCTTTGG 0: 1
1: 0
2: 0
3: 2
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969352181 Original CRISPR AGACTCTTGTCTGCTGCAAC TGG (reversed) Intronic
901290114 1:8117573-8117595 AGACTGTTGCCTGATGCAGCAGG + Intergenic
902664756 1:17929746-17929768 TGACTCTTTCCTGCTGCAAAAGG + Intergenic
904157474 1:28496709-28496731 AGAGTCTTATGTGCTGCACCGGG + Exonic
909779480 1:79524868-79524890 AGAATCTTGTCTGGTTCAAGGGG + Intergenic
913602142 1:120431886-120431908 AGAGTTTTGACTTCTGCAACTGG + Intergenic
914084908 1:144444749-144444771 AGAGTTTTGACTTCTGCAACTGG - Intronic
914190917 1:145409906-145409928 AGAGTTTTGACTTCTGCAACTGG - Intergenic
914363315 1:146955496-146955518 AGAGTTTTGACTTCTGCAACTGG + Intronic
914488361 1:148131643-148131665 AGAGTTTTGACTTCTGCAACTGG - Intronic
914588723 1:149086759-149086781 AGAGTTTTGACTTCTGCAACTGG - Intronic
914858912 1:151370882-151370904 AGTCTCTTGGCTGCTGCGAGTGG - Intronic
917507049 1:175636818-175636840 AGACTCTTGCCTGAGGCATCAGG - Intronic
917836532 1:178945894-178945916 GGACTCCTCTCTGCTGCACCAGG + Intergenic
919235090 1:194830598-194830620 AGAATCATGTCACCTGCAACAGG - Intergenic
920238870 1:204529254-204529276 AGGCTCTGGTCAACTGCAACTGG - Intronic
920317814 1:205091599-205091621 AGTCTGTTGTCTGTTGCAACAGG - Intronic
920406678 1:205719375-205719397 AGGGTCTTGTATTCTGCAACTGG - Intronic
922652822 1:227355767-227355789 GGGCTCTTGTCTTCTGTAACTGG - Intergenic
1063128466 10:3156442-3156464 AGACTGTTGTCTGCTGTGAAGGG - Intronic
1065650408 10:27882958-27882980 AGCCTCTTATTTACTGCAACTGG - Intronic
1067547489 10:47204766-47204788 AGTCTCTTCTCTGATCCAACAGG + Intergenic
1069197396 10:65570479-65570501 GGACTCCTGGCTGCTGCAAAGGG - Intergenic
1071928689 10:90440861-90440883 ATATCCTTGTCTGCTGCAACTGG + Intergenic
1080941259 11:36921348-36921370 AGACTCCTTCCTGCTGCAAAGGG + Intergenic
1082185178 11:49170754-49170776 AGAATCTTGTCTGATTCAAAGGG - Intronic
1085386371 11:76160512-76160534 AGACCCTTAGCTCCTGCAACAGG + Intergenic
1086667251 11:89498060-89498082 AGACTCTTCCCAGCTGCATCAGG + Intronic
1086681156 11:89674587-89674609 AGAATCTTGTCTGATTCAAAGGG + Intergenic
1089216867 11:116839446-116839468 AGACTCGTGACTGCTGGAAGGGG + Intergenic
1089709770 11:120306541-120306563 AGATTCTTGGCTGTTTCAACTGG - Intronic
1095936150 12:47683905-47683927 AGAATCTTGGTTGCTGGAACTGG - Intronic
1098208954 12:68142409-68142431 AGACTCTTCTCTGTTGCATCAGG - Intergenic
1098403369 12:70097768-70097790 ACAATCCTGTCTGGTGCAACTGG + Intergenic
1100454745 12:94741395-94741417 TGACTCTTTTATGCTGCAGCTGG + Intergenic
1100478222 12:94953492-94953514 AGATTCTTTTCTGCAGCAGCAGG + Intronic
1104768877 12:131347500-131347522 AGACTCCTGTCTCCTCCTACTGG - Intergenic
1105296879 13:19095492-19095514 AGACTCTCCTCTCCTGCAGCAGG + Intergenic
1107875946 13:44790321-44790343 AGACCCAGGTCTGCTGCCACAGG + Intergenic
1109103122 13:58211769-58211791 TGACGTTTGACTGCTGCAACTGG + Intergenic
1110421890 13:75320028-75320050 AGTGTCTTGTCTGGTACAACAGG + Exonic
1110705055 13:78595866-78595888 AGACTGTTGACTTATGCAACTGG + Intergenic
1111332831 13:86782356-86782378 AGTCTCCAGTCTGCTGCCACTGG + Intergenic
1112015354 13:95326907-95326929 AGGCTCCTCTCTGCTGCAAAGGG - Intergenic
1115152843 14:30305177-30305199 AGAATTCTGTCTCCTGCAACTGG - Intergenic
1117942767 14:60986115-60986137 AGACTATTCTGTGCTGAAACAGG + Intronic
1118622878 14:67630357-67630379 AGATTCTTATCTGGTGCTACTGG + Intronic
1120185764 14:81392278-81392300 AGGCTCTTCCCTGCTGCAAGTGG - Intronic
1120314417 14:82872862-82872884 AGGCTCCTTTCTGCTGCAAATGG - Intergenic
1121564778 14:94901176-94901198 GGACTCCTGTCTGCTCCACCAGG - Intergenic
1122305800 14:100765678-100765700 AGACTCTCATCTCCTGCAGCTGG - Intergenic
1125760531 15:42093131-42093153 AGCCTCATTTCTGCTGGAACAGG - Intronic
1126706549 15:51411242-51411264 AGACTCTTGTCTCCTGCAGAAGG + Intergenic
1132135756 15:99337066-99337088 TGACTTTTGTTTGCTGCAGCTGG + Intronic
1141479504 16:84296960-84296982 ATGCTCTTCTCTGGTGCAACAGG + Intronic
1141797122 16:86282588-86282610 AGCCTTTTGTCTGTTCCAACAGG - Intergenic
1145291979 17:21554043-21554065 ATAATCTTGTCTGCTGCTCCAGG - Intronic
1145977748 17:28993977-28993999 TTACTTTTGTCTGCTGCATCTGG + Intronic
1146994987 17:37312259-37312281 AGGCAATTGTCTACTGCAACTGG + Intronic
1152125001 17:78441324-78441346 AGACTCTGCTCTCCTGCCACAGG - Intronic
1153090988 18:1342502-1342524 AGTCTCTGGTGTGCTGCTACTGG + Intergenic
1155498739 18:26466497-26466519 ACACTCTTGGTTGTTGCAACCGG + Intronic
1156082365 18:33353156-33353178 AGTCTTTTGTCTTCTGTAACAGG + Intronic
1156402899 18:36756842-36756864 AGACTCTTGGCTGATGGCACTGG - Intronic
1159926013 18:74269647-74269669 AGGCTTTTGGCTGCAGCAACTGG - Intronic
1162791815 19:13066915-13066937 AGTCTCCTGTCTGCTGAGACGGG + Intronic
1164772632 19:30822192-30822214 AGCTTCTTGTTTGCTCCAACTGG - Intergenic
1167211473 19:48136499-48136521 AGCCACTTGTCTCCTGCCACTGG - Intronic
925437567 2:3853687-3853709 AGACTCTTATTAGCTCCAACTGG + Intergenic
930314856 2:49785369-49785391 GGACTGTAGTCTGCTGCCACTGG - Intergenic
933495534 2:83046129-83046151 AGACTCCTCCCTGCTGCAAAGGG + Intergenic
934019016 2:87924458-87924480 AGAGACTTGGCTGCTGCAGCTGG + Intergenic
934701728 2:96447166-96447188 AAACTCTTGACTCCTGCAATTGG - Intergenic
936840170 2:116758746-116758768 AGACTCTTCCCTGCTGCAAATGG - Intergenic
936846894 2:116845988-116846010 ACACTTTTGTCTGCTGAAACTGG + Intergenic
945056333 2:205872599-205872621 AGGTTCTTGTCTGCTGCAGTGGG + Intergenic
946822945 2:223648845-223648867 TGACTCTTGTGTGCAGCAAAAGG + Intergenic
946885383 2:224217395-224217417 AGACCCTTCCCTGCTGCAAATGG - Intergenic
1169351033 20:4868047-4868069 AGATTCTTTTCTGCTTCAGCAGG - Intronic
1174111770 20:48202186-48202208 AGACACATGTCTGCAGCTACAGG - Intergenic
1176659555 21:9621668-9621690 AGACTTTTGGCTGAAGCAACTGG + Intergenic
1177408814 21:20703582-20703604 AGACTGATCTCTGCTGAAACAGG - Intergenic
1178819923 21:35965833-35965855 AGACTGTTTTCTCCTGCAGCAGG + Intronic
1182941865 22:34284428-34284450 AGACTCTTGACTCCTGCCTCTGG + Intergenic
1184711423 22:46251298-46251320 AGACCCCAGCCTGCTGCAACTGG - Intergenic
956754831 3:72374126-72374148 AGACTCCTGCCTGCTGCTGCAGG - Exonic
958042050 3:88238459-88238481 TGACTTTGGTCTGCTGCAAATGG + Intergenic
959572927 3:107904860-107904882 AGACTCCTCCCTGCTGCAAATGG + Intergenic
961033127 3:123623699-123623721 AGAACCTTGGCTGCTGCAAGAGG + Intronic
963508045 3:146212641-146212663 AGGCTCATGTCTTCTGCAAATGG + Intronic
967256082 3:187593456-187593478 AGGCTCCTGCCTACTGCAACCGG + Intergenic
967981930 3:195071065-195071087 AGCCTCATGTGTGCTGCAAGGGG + Intronic
969352181 4:6604239-6604261 AGACTCTTGTCTGCTGCAACTGG - Intronic
969639752 4:8389645-8389667 AGTTGCTTGTCTGCTGCAGCAGG + Exonic
971998276 4:33995169-33995191 AGGCTCTTCCCTGCTGCAAATGG - Intergenic
974246106 4:59320657-59320679 AGACTGTTGGCTACAGCAACAGG + Intergenic
974613585 4:64250243-64250265 AGACTTTTCTCTGCTCCATCTGG - Intergenic
980477527 4:133336818-133336840 AGAATCATGTCTTCTGCAAACGG + Intergenic
982199309 4:152944656-152944678 AGACTCTTGGCTATTTCAACAGG - Intronic
985415817 4:189734745-189734767 AGACTTTTGGCTGAAGCAACTGG - Intergenic
986507315 5:8465787-8465809 AGACTCTTGTGTTCTGCCATTGG + Intergenic
987714863 5:21554839-21554861 AGATTCTTGTTTTCTGTAACTGG - Intergenic
991335791 5:65545840-65545862 AGACTCCTATCTGCAGAAACTGG + Intronic
994400021 5:99266961-99266983 AGACTCATGTCATCTGCAAGGGG + Intergenic
994477730 5:100291411-100291433 ATGCTCTTGTCTGCTCCAGCTGG + Intergenic
995258316 5:110072810-110072832 AGTCTCTAGCCTGCTGCCACTGG + Intergenic
995689434 5:114807431-114807453 AGAATTTTGACTGCAGCAACTGG + Intergenic
1001644357 5:173269213-173269235 AGACTCAGGTCAGCAGCAACAGG + Intergenic
1004066878 6:12255622-12255644 AGACAAATGTCTGCTTCAACTGG + Intergenic
1009001854 6:57727202-57727224 AGATTCTTGTTTTCTGTAACTGG + Intergenic
1009039910 6:58163757-58163779 GAACTCTTGTCTGCTGCCAGGGG + Intergenic
1009215800 6:60918606-60918628 GAACTCTTGTCTGCTGCCAGGGG + Intergenic
1009501354 6:64418721-64418743 AGATTCCTGTATGCTGCAATTGG + Intronic
1014573580 6:123042210-123042232 AGACTGATGTCTCCTGTAACAGG + Intronic
1022515378 7:30971893-30971915 GGATTCTGGTGTGCTGCAACTGG - Intronic
1022588021 7:31634242-31634264 AGACACTTGTGTGCTGAAAATGG + Intronic
1023237106 7:38100814-38100836 TGCCTCTTGTCTGCTGAAAGGGG - Intergenic
1023865083 7:44234667-44234689 AAACTCTTGGCTGCTGCATGGGG + Exonic
1037616612 8:20524987-20525009 AGACTCTTGTCTGCTAATCCAGG - Intergenic
1043521219 8:81047566-81047588 AGGCTCTTGTCTCATGCATCTGG + Intronic
1043739471 8:83792225-83792247 ATCCTCTTGTTTGCTTCAACTGG + Intergenic
1048322640 8:133412259-133412281 AGACTCTTCTCCTCTGGAACAGG + Intergenic
1055343364 9:75308902-75308924 AGTCTCTAGCCTGCTGCCACTGG + Intergenic
1056578892 9:87876240-87876262 AGTCTCTTCTCTGCTGCTGCTGG - Intergenic
1059379310 9:113910744-113910766 AGCCTCTTGTCAGCTGGGACGGG - Intronic
1060894706 9:127210154-127210176 GGACTCTTGGATGCTGCAGCAGG + Intronic
1061709138 9:132475736-132475758 AGACTCTTGTCACCTCCACCTGG + Intronic
1203637116 Un_KI270750v1:123511-123533 AGACTTTTGGCTGAAGCAACTGG + Intergenic
1188126437 X:26374530-26374552 AGCCTCTTGTCAGTTGCAAAGGG + Intergenic
1189023087 X:37362776-37362798 GGACTCTAGTCTACTTCAACTGG + Intronic
1192156958 X:68753819-68753841 AGGCTCTTGGCTTGTGCAACTGG - Intergenic
1193637426 X:83969343-83969365 AGTCTCCTGCCTGCTGCCACTGG - Intergenic
1193844847 X:86455717-86455739 AGACTCCAGCCTGCTGCCACTGG + Intronic
1196568790 X:117241240-117241262 ATACCATTGTCTGCTGAAACAGG - Intergenic
1197038194 X:121903600-121903622 AGACTCCTCCCTGCTGCAAAAGG - Intergenic
1198141273 X:133806276-133806298 AGACTATTGTCAGATGTAACTGG + Intronic
1199125511 X:144114682-144114704 AGAGACTTGGCTGCTGCAGCTGG - Intergenic
1201590267 Y:15607109-15607131 ATACTCTTGTCTACTGCCTCAGG + Intergenic