ID: 969354495

View in Genome Browser
Species Human (GRCh38)
Location 4:6617468-6617490
Sequence TCAGCCAGTGACAGTGAATC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 209
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 187}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969354491_969354495 10 Left 969354491 4:6617435-6617457 CCTATATGAAGTGGGCGAGGACC 0: 1
1: 0
2: 0
3: 2
4: 42
Right 969354495 4:6617468-6617490 TCAGCCAGTGACAGTGAATCTGG 0: 1
1: 0
2: 1
3: 20
4: 187
969354489_969354495 13 Left 969354489 4:6617432-6617454 CCACCTATATGAAGTGGGCGAGG 0: 1
1: 0
2: 0
3: 2
4: 46
Right 969354495 4:6617468-6617490 TCAGCCAGTGACAGTGAATCTGG 0: 1
1: 0
2: 1
3: 20
4: 187
969354486_969354495 28 Left 969354486 4:6617417-6617439 CCTGCTGCGGCTCTACCACCTAT 0: 1
1: 0
2: 0
3: 6
4: 74
Right 969354495 4:6617468-6617490 TCAGCCAGTGACAGTGAATCTGG 0: 1
1: 0
2: 1
3: 20
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969354495 Original CRISPR TCAGCCAGTGACAGTGAATC TGG Exonic
902040440 1:13488549-13488571 TCAGCCAGTCACGGTGGCTCAGG - Intronic
902124457 1:14196874-14196896 GCAGCCAGTGAAAGTGAAGGAGG + Intergenic
902563958 1:17297659-17297681 CCAGCCAGTGACATTGACTATGG - Intergenic
905232775 1:36525383-36525405 GCAGCCAGGGACAGTGAGTGAGG + Intergenic
907079186 1:51605699-51605721 TCAGCCGGGCACAGTGACTCAGG + Intronic
908503229 1:64766106-64766128 TCAGCAGGTGACACTGAATCTGG + Intronic
908884364 1:68770772-68770794 TCAGCCATTGACAGTTATTGAGG - Intergenic
909665028 1:78122937-78122959 TCAGCCATTGACAGGGATTGGGG + Intronic
909812825 1:79953070-79953092 TCATCAAGTGAGAGTGAATATGG - Intergenic
911547301 1:99233777-99233799 TAAGCTACTGACATTGAATCAGG + Intergenic
911659852 1:100489039-100489061 CCAACCAGTGGCAGTGAATGGGG + Intronic
912381971 1:109252591-109252613 TCAGCCACTGATCGTGATTCTGG + Exonic
914057872 1:144182077-144182099 TCTGTGAATGACAGTGAATCTGG + Intergenic
914121274 1:144784288-144784310 TCTGTGAATGACAGTGAATCTGG - Intergenic
914998329 1:152564180-152564202 TCACCCAGGGACAGTGAAGGGGG - Intronic
915033883 1:152906516-152906538 CCAGCCCGTGACAGTCAGTCTGG - Intergenic
918345252 1:183602198-183602220 TCAGCCAGTCTGAGTGAATTTGG + Intergenic
919544626 1:198899537-198899559 TCTGCGTCTGACAGTGAATCAGG - Intergenic
920213333 1:204344820-204344842 TCAGCCAGTGACTGGGAAGCAGG + Intronic
920515624 1:206582944-206582966 TCAGGCACTGACTATGAATCTGG - Intronic
1062813060 10:480047-480069 TCATCCAGTGAGCGTGAACCGGG - Intronic
1063470449 10:6280397-6280419 TCAGCCAGTGTTTGTGAACCTGG + Intergenic
1064341935 10:14494758-14494780 TCAGCCAGGCACGGTGACTCAGG + Intergenic
1064735512 10:18378235-18378257 TCAACCAATGACAGTGTATTTGG + Intronic
1065410154 10:25417308-25417330 TCAGCCAAGAACAGTGTATCAGG - Intronic
1066097281 10:32084381-32084403 CCAGCCAATGACAGTGCAGCAGG + Intergenic
1067041200 10:42954193-42954215 ACAGACGGTGACACTGAATCAGG + Intergenic
1069133968 10:64741116-64741138 TTAGCCACTCAGAGTGAATCTGG + Intergenic
1070101184 10:73388396-73388418 TCAGCCTGCCACAGTGACTCAGG - Exonic
1072033668 10:91544720-91544742 TCATCCATTGAAAGTGAATTGGG + Intergenic
1072887924 10:99296786-99296808 TCGGCCAGTGACAGTCAGTAGGG + Intergenic
1073126058 10:101150316-101150338 TCAGCCAGGCACAGTGGCTCAGG - Intergenic
1075112954 10:119602719-119602741 TCAGCCAGTGACTGAGATTGTGG - Intergenic
1076253585 10:129002121-129002143 TCAGGCAGTGACAGTTCATTGGG - Intergenic
1078703570 11:13715902-13715924 ACTGCCAGTTACAGTGTATCAGG + Intronic
1080400695 11:31933025-31933047 GCAGCCAGTGACAGTGATAAGGG + Intronic
1089520940 11:119062965-119062987 GCAGCCAGGCACAGTGACTCAGG - Intergenic
1090864154 11:130681712-130681734 GGAGCCAGTGGCAGTGAATGTGG + Intronic
1093968409 12:25351614-25351636 TCAGCCAGGCACAGTGGCTCAGG + Intergenic
1100731442 12:97474773-97474795 CCAGCAAGTGAAAGTGAAACTGG - Intergenic
1105567150 13:21560990-21561012 TCAACCAATGAAAGTGAAGCTGG - Intronic
1107675214 13:42789111-42789133 TCACCCAGTGACAGAGGACCTGG - Exonic
1107782757 13:43922105-43922127 TCAGCCAGTGGCAGTGGCTCAGG - Intergenic
1109475057 13:62870018-62870040 TCAGCAAGAGTCAGTGTATCTGG - Intergenic
1109688683 13:65855913-65855935 TCAAGCAGTGAAAGTTAATCAGG - Intergenic
1110254957 13:73423183-73423205 TGTGCCTGTGGCAGTGAATCAGG - Intergenic
1111982959 13:95036427-95036449 TCAGACAATGAGAGGGAATCTGG - Intronic
1113446918 13:110376269-110376291 TCTGCCAGGAACAGTGAAGCGGG - Intronic
1114482865 14:23046265-23046287 TGAGACAGTCACATTGAATCTGG - Intergenic
1119707347 14:76791397-76791419 TCATCCACAGACAGTGAAGCAGG + Intronic
1120863302 14:89274258-89274280 TCAGACAGTGACACTGAAAATGG + Intronic
1122707886 14:103632858-103632880 TCAGCCAGTGTCAGGGGGTCAGG + Intronic
1123133656 14:106008005-106008027 TCAGCCAGGGACACAGAACCAGG - Intergenic
1123136054 14:106027978-106028000 TCAGCCAGGGACAGAGAACCAGG - Intergenic
1123165409 14:106320691-106320713 TCAGCCAGGGACACAGAACCAGG - Intergenic
1126556799 15:49997284-49997306 TCAGCAAGTCACAGTGAGTTGGG + Intronic
1128613012 15:69088752-69088774 TCTGCAGGTGACAGTGATTCAGG - Intergenic
1129895539 15:79102965-79102987 CCAGCCAGAGACAAGGAATCTGG - Intergenic
1130020507 15:80226744-80226766 TCAGCCATTGATTGTCAATCTGG + Intergenic
1130901134 15:88207529-88207551 TCATCCAGTCACAGAGACTCAGG + Intronic
1132066083 15:98732428-98732450 ACAGGCAGTGACGGTGAAGCAGG + Intronic
1133611606 16:7438853-7438875 TCAGCCATTGACAGAGCATCAGG - Intronic
1133663370 16:7940858-7940880 TAAACCAGTGACAGTGAAGAAGG + Intergenic
1133914941 16:10101068-10101090 TCAGCCAGTGACAGGGCATGAGG + Intronic
1134093366 16:11403236-11403258 CCAGCCAGTGCCAGTGTCTCTGG - Intronic
1134166110 16:11930998-11931020 TCAGCCTCTGACTGAGAATCAGG - Intronic
1134494607 16:14722730-14722752 TCAGCCTCTGACTGAGAATCAGG + Intronic
1134499990 16:14761850-14761872 TCAGCCTCTGACTGAGAATCAGG + Intronic
1134526535 16:14948469-14948491 TCAGCCTCTGACTGAGAATCAGG + Intronic
1134545870 16:15107877-15107899 TCAGCCTCTGACTGAGAATCAGG - Intronic
1134714112 16:16346942-16346964 TCAGCCTCTGACTGAGAATCAGG + Intergenic
1134721985 16:16390305-16390327 TCAGCCTCTGACTGAGAATCAGG + Intronic
1134945440 16:18321564-18321586 TCAGCCTCTGACTGAGAATCAGG - Intronic
1134952705 16:18361716-18361738 TCAGCCTCTGACTGAGAATCAGG - Intergenic
1135311500 16:21408423-21408445 TCAGCCTCTGACTGAGAATCAGG - Intronic
1135364452 16:21840875-21840897 TCAGCCTCTGACTGAGAATCAGG - Intronic
1135447391 16:22530474-22530496 TCAGCCTCTGACTGAGAATCAGG + Intronic
1136150660 16:28346321-28346343 TCAGCCTCTGACTGAGAATCAGG - Intronic
1136308206 16:29387419-29387441 TCAGCCTCTGACTGAGAATCAGG - Intronic
1136321622 16:29488957-29488979 TCAGCCTCTGACTGAGAATCAGG - Intronic
1138235217 16:55376726-55376748 TCAGCCAGTGTCACAGACTCTGG + Intergenic
1139855899 16:69979836-69979858 TCAGCCTCTGACTGAGAATCAGG - Intergenic
1140139959 16:72246109-72246131 TTAGCCGATGAGAGTGAATCTGG - Intergenic
1141028051 16:80566286-80566308 TCAACCAGTGACTATGAATCTGG - Intergenic
1142410904 16:89916152-89916174 TCAGCCAGAGAGAGTGAACTGGG + Intronic
1144236115 17:13262302-13262324 TCACCCAAACACAGTGAATCGGG - Intergenic
1144375922 17:14641510-14641532 TCACCCTGTGGCAGTGAAGCAGG + Intergenic
1145313613 17:21715243-21715265 TCAGCCACTTACTGTGAAGCAGG + Intergenic
1148724856 17:49781693-49781715 TCAGCCAGGCACAGTGGCTCAGG + Intronic
1148903477 17:50896115-50896137 TCAGCCAGTCACAAAAAATCTGG + Intergenic
1149603590 17:57909413-57909435 TCTTCCAGTTATAGTGAATCAGG - Intronic
1154017665 18:10633927-10633949 TCAGAAATTTACAGTGAATCTGG - Intergenic
1154117371 18:11623044-11623066 TCAGCCTCTGACTGAGAATCAGG - Intergenic
1155023647 18:21920611-21920633 TCAGCCAGTCACAGTGGCTCAGG - Intergenic
1155259763 18:24030530-24030552 ACAAACAGTGACAGTGAATGGGG + Intronic
1157701210 18:49762452-49762474 TCTGGCAGTGCCAGTGTATCAGG + Intergenic
1157718806 18:49907773-49907795 TCAGTCAGTGACACTCAAGCTGG - Intronic
1158777055 18:60595452-60595474 TCAGCGAGTGACAGTTAATAGGG + Intergenic
1159807556 18:72974415-72974437 TCAGCCAGTGCAAGGGAATAGGG - Intergenic
1159810483 18:73012933-73012955 TAAGCCAGAGAGAGAGAATCAGG + Intergenic
1163205052 19:15796350-15796372 TCACCCAGTGTCAGAGAATTAGG + Intergenic
1167775336 19:51550921-51550943 TCAGTCAGTGACGGTGAAGAGGG - Intergenic
1167794990 19:51703229-51703251 TCAGGATGTGACAGTGACTCGGG + Intergenic
926688806 2:15718574-15718596 GCACCCAGTGGCAGTGAATCTGG - Intronic
926924600 2:17974583-17974605 TCAGCAAGTGACAGGGAAATGGG + Intronic
927759999 2:25744166-25744188 TCAGACAGAGTCAGTGAAACTGG - Exonic
929434925 2:41921252-41921274 CCTGCCAGAGACAGTGAAGCAGG + Intergenic
929776068 2:44931706-44931728 TCAGCCAGAGACAGGGGAGCAGG + Intergenic
930871159 2:56172410-56172432 TCAGTCAGTGATAGTATATCTGG + Intergenic
931031960 2:58186615-58186637 TCAGCCAGTGGCATGGAAGCCGG - Intronic
931937048 2:67210457-67210479 TCAAGCTGTGACAGTGCATCAGG - Intergenic
932966613 2:76483015-76483037 TAAGCCAGGGACAGTGAAGTTGG - Intergenic
934278523 2:91591770-91591792 TCTGTGAATGACAGTGAATCTGG + Intergenic
935135988 2:100302488-100302510 TCATCCAGTCACACTGAATGTGG - Intronic
937206665 2:120241014-120241036 ACACCCCGTGACAGTGGATCTGG - Intronic
938565513 2:132514936-132514958 TCAGCCAGTGGCAGATACTCTGG - Intronic
938752060 2:134342067-134342089 TCAGCAAGAGACAGGGAATTAGG - Intronic
939958200 2:148544219-148544241 TCAGCCAGGCACAGTGGCTCAGG + Intergenic
940657652 2:156508107-156508129 TCAGCCAGTTTCAGTAAGTCAGG + Intronic
942557121 2:177183300-177183322 TAAGCCAGAGACATTGAATTAGG + Intergenic
946788445 2:223273630-223273652 TCAGCCAGTGACTGAGCATAAGG - Intergenic
948250876 2:236527874-236527896 CCGGGCAGGGACAGTGAATCTGG - Intergenic
948969536 2:241414355-241414377 TCAGCTGGTGAAAGTGAGTCAGG + Intronic
1171104265 20:22417644-22417666 TCAGCCAGGCACAGTGGCTCAGG + Intergenic
1174254691 20:49245839-49245861 TCAGCCAAAGACAGTGAAGACGG - Intronic
1174428497 20:50450118-50450140 TCATCCTGTGACAGTGGATAAGG + Intergenic
1178834214 21:36082878-36082900 TAAGCCAGTGCCAGTGAAGGAGG + Intergenic
1179184998 21:39078911-39078933 TCAGCCAGGCACAGTGACTCAGG + Intergenic
1179825450 21:43963150-43963172 TCATCCAGTGACAGTAAAGGAGG + Intronic
1180714681 22:17863859-17863881 TCAGCCAGTGCCAGGAAATGTGG - Intronic
1181942034 22:26485393-26485415 ACAGCCAGAGACAGTGATTATGG - Intronic
1182164122 22:28155067-28155089 CCAGCCAGGGAGACTGAATCAGG - Intronic
950218169 3:11174636-11174658 TATGCCAGTGACAGTAAAACTGG + Intronic
950584636 3:13883548-13883570 TCAGCCAGTCTCAGAGGATCAGG + Intergenic
952892114 3:38050312-38050334 TCAGCCAGTAGCACTGAAGCAGG - Intronic
952978991 3:38719999-38720021 TCAGCCAGGGACAGTGACAGGGG + Intronic
953434853 3:42870411-42870433 TAAGACAGTGACAGAGAACCAGG - Intronic
955204758 3:56885736-56885758 TCAGCCATAGACAGTCAATCTGG + Intronic
955994897 3:64669655-64669677 TCTGACAGTGACAGTGGCTCAGG - Intronic
957544638 3:81621830-81621852 CCATCCAGTGAAAGTGAATGAGG - Intronic
959017529 3:101152638-101152660 TCCTCCAGGTACAGTGAATCAGG - Intergenic
959026579 3:101246820-101246842 TCAGCCAGGCACAGTGGCTCAGG + Intronic
959806724 3:110562907-110562929 GCAGCCAGTGCCAGGGAATGGGG + Intergenic
961571149 3:127799679-127799701 TCAGGAAGAGACAGTGAATCAGG + Intronic
963224845 3:142851707-142851729 GAAGACAGTGACAGTGAACCAGG + Intronic
969032227 4:4224598-4224620 TCTGTGAATGACAGTGAATCTGG - Intronic
969354495 4:6617468-6617490 TCAGCCAGTGACAGTGAATCTGG + Exonic
969591722 4:8126083-8126105 TCAGGCAGTGACAGTGGCCCTGG - Intronic
971869957 4:32221759-32221781 TAAGCCATTCACAGTGAACCAGG + Intergenic
973319220 4:48793248-48793270 TCTGCCAGTCTCAGAGAATCTGG + Intergenic
974020100 4:56685503-56685525 TCAGCCAATGGCAGAGAACCTGG + Intergenic
975888559 4:78995854-78995876 ACAGGCAGTGACAGAAAATCAGG + Intergenic
978460639 4:108947781-108947803 TCAGCCATTGTCAGTGACACTGG - Intronic
979800462 4:124902234-124902256 ACACACAGTGACAGAGAATCAGG + Intergenic
980823055 4:138041089-138041111 TCAGAGAATGACAGTGAATTAGG - Intergenic
985643971 5:1076479-1076501 TCAGCCAGGGACAGTGTGGCTGG - Intronic
986197150 5:5548102-5548124 TCCCCCAGTGACAGTGTACCAGG - Intergenic
986865737 5:11984471-11984493 GCAGGCAATGACAGTGATTCAGG + Intergenic
988803424 5:34718042-34718064 GCAGCCAGTGACAGTGATTGTGG - Intronic
991245190 5:64502975-64502997 TAAGCTAGTGACAGTGAAAGAGG + Intergenic
993449023 5:88051669-88051691 TCTGGCACTGATAGTGAATCAGG + Intergenic
994122571 5:96133453-96133475 TCAGGGTGTCACAGTGAATCAGG - Intergenic
997237161 5:132279388-132279410 GCAGCCATTGTCAGTGAAGCTGG - Intronic
998767909 5:145508864-145508886 TCATCCTGTGGCAGGGAATCAGG + Intronic
1000056632 5:157612704-157612726 TTGGCAAGTGAGAGTGAATCTGG + Intergenic
1003329640 6:5119345-5119367 TCACCCAGGGACAGTGGATGTGG - Intronic
1004242878 6:13943400-13943422 TCAGCCAGGCACAGTGGCTCAGG - Intronic
1007284748 6:40739540-40739562 CAAGCCAGTGACAGTGTAACAGG - Intergenic
1007978784 6:46129580-46129602 TCAGCCAGTTCCAGTGAGTTGGG - Intergenic
1007992572 6:46272085-46272107 TCAGCTAGTGACAGTATAGCTGG + Intronic
1009751300 6:67882120-67882142 TCAGCCACTGCCAGTGGAACAGG - Intergenic
1014483599 6:121970356-121970378 TCAGCCACTCACACTGAATACGG - Intergenic
1014713440 6:124836839-124836861 TAAGCAAATGACAGTGAATATGG + Intergenic
1015866536 6:137732783-137732805 TCTGCCAGAACCAGTGAATCTGG + Intergenic
1016674568 6:146749061-146749083 ACAGGCAGTGACAGTGAATCTGG + Intronic
1016911187 6:149200752-149200774 TCAGCCAGTGTCACTGCATTTGG - Intergenic
1018373512 6:163189817-163189839 TAAGCCCGGGACAGTGAATGCGG - Intronic
1018572302 6:165224416-165224438 TCAGCCTCTCAGAGTGAATCTGG - Intergenic
1021295064 7:18894363-18894385 TCTGCCAGTGAAAATCAATCAGG - Intronic
1022477425 7:30720675-30720697 TCAGCCAGTGTCTCTGAATCAGG + Intronic
1026407251 7:70079179-70079201 TCTGCCAATGACAGTGAGGCAGG + Intronic
1028234678 7:88346478-88346500 TCAGAAAGAGACAGAGAATCAGG - Intergenic
1033171139 7:139085710-139085732 TCAGCCAGGCACAGTGGTTCAGG + Intronic
1035132183 7:156665670-156665692 TCAGCCACTGACAGAGAGTCAGG - Intronic
1036686558 8:10915362-10915384 TCAGCCAGTGAAAGTGAGCGAGG - Intronic
1038352344 8:26788708-26788730 TCAGCCAATAAGAGTGAAGCTGG + Intronic
1038937913 8:32272620-32272642 TCAGGCATTGAGAGGGAATCTGG + Intronic
1039247649 8:35627352-35627374 TCCTGCAGTGACAGAGAATCAGG + Intronic
1040337495 8:46423483-46423505 TGGGCGAGTGACAGGGAATCAGG + Intergenic
1044726839 8:95201305-95201327 TCAGCCAGTGACACTGATTGTGG - Intergenic
1047263016 8:123279286-123279308 TTAGCAAGTGGCAGAGAATCTGG - Intergenic
1048343693 8:133560433-133560455 TCACCCAGTGATGGTGAATCGGG + Intronic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049379798 8:142306301-142306323 CCAGCCCGTGAGAGTGAAGCAGG + Intronic
1055991160 9:82107168-82107190 CCAGTCTGTGACAGTGAATGGGG + Intergenic
1057820751 9:98328806-98328828 TCAGCCAGTCACTGAGAATGTGG + Intronic
1058474409 9:105317294-105317316 TCAGCCAGTGACAGGGTTTCAGG + Intronic
1058552253 9:106127412-106127434 TCAGCCAGATACAGTGAGGCTGG + Intergenic
1058777481 9:108298812-108298834 TTAGCCAGTGACACTGATTTTGG + Intergenic
1059565009 9:115375434-115375456 TCAGCTAGTGGCTGTGAATTTGG + Intronic
1060083588 9:120676147-120676169 TCAGCCAGGCACAGTGGCTCTGG + Intronic
1061860746 9:133467594-133467616 AGAGCCTGTGACAGAGAATCTGG - Intronic
1186352278 X:8752017-8752039 TCAGCCAGTCACGGTGGCTCAGG + Intergenic
1186815764 X:13236370-13236392 TTTGACAGTGACAGTGAATATGG - Intergenic
1186860083 X:13664289-13664311 TGAGCCAGTCTCAGTGAGTCAGG - Intronic
1187486636 X:19710293-19710315 GCAGACAGTGTCAGTGACTCAGG - Intronic
1188353960 X:29166915-29166937 TAAGGAAGTGACATTGAATCTGG - Intronic
1195530296 X:105946335-105946357 TAAGCCAGTGACAGTTGACCTGG + Exonic
1196192988 X:112813604-112813626 TCAGCCAGTGACAGGGAAGAGGG - Intronic