ID: 969357817

View in Genome Browser
Species Human (GRCh38)
Location 4:6640984-6641006
Sequence CGCTGACGCGCGAGCACGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969357813_969357817 11 Left 969357813 4:6640950-6640972 CCGGTCATCAACGAGATGCGCGA 0: 2
1: 0
2: 0
3: 0
4: 14
Right 969357817 4:6640984-6641006 CGCTGACGCGCGAGCACGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 36
969357812_969357817 12 Left 969357812 4:6640949-6640971 CCCGGTCATCAACGAGATGCGCG 0: 2
1: 0
2: 0
3: 1
4: 17
Right 969357817 4:6640984-6641006 CGCTGACGCGCGAGCACGGGCGG 0: 1
1: 0
2: 0
3: 2
4: 36

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969357817 Original CRISPR CGCTGACGCGCGAGCACGGG CGG Exonic
923782967 1:237042328-237042350 CGCGGACGCTCGGGCGCGGGTGG - Exonic
1077214531 11:1389955-1389977 CGCTGACGGGCGTGCGCTGGGGG + Intronic
1083733821 11:64668469-64668491 TGCTGACGGGCGAGCCCGGCAGG + Exonic
1085396338 11:76208907-76208929 CCCTGACCCGCGAGCTCAGGCGG - Intronic
1090344991 11:126062651-126062673 CGCCGCCGCGCGCGCGCGGGGGG - Intronic
1095753024 12:45730515-45730537 CGCTGCCGCTCTAGCACAGGCGG + Intronic
1104697102 12:130872022-130872044 CGCCGGCGCGAGAGCAGGGGCGG - Exonic
1112290889 13:98143345-98143367 CGCGGGCGCGCGAGCAGGGCTGG - Intronic
1113806074 13:113110515-113110537 GGCTGACCCGGGAGCACGGCAGG + Intronic
1116325774 14:43533057-43533079 CGCTGGCCCGCGAGCACCGTGGG - Intergenic
1124592144 15:31063088-31063110 TTCTGACGCGCGAGGAAGGGCGG - Intronic
1137738311 16:50741707-50741729 AGCTGAGGCGGGAGCACGGGAGG + Intergenic
1141083867 16:81077385-81077407 CGCCGACCCGAGAGCCCGGGTGG - Intergenic
1147210407 17:38869875-38869897 CGCTGAGGCGCCAGCACCGCGGG + Exonic
1147427126 17:40351251-40351273 TGCTGACGCGGGAGGAAGGGAGG - Intronic
1152736584 17:82000283-82000305 TCCCGACGGGCGAGCACGGGCGG - Intronic
1153480495 18:5543118-5543140 CCCGGGCGCGGGAGCACGGGCGG - Intronic
1160668526 19:344725-344747 CGCGGACGCGCGGGGGCGGGGGG + Intronic
1161924959 19:7293588-7293610 CGCGGAGGCGCGAGCCCGGGCGG + Intronic
1165325495 19:35112093-35112115 AGCTGACGTGCTAGCAGGGGAGG + Intergenic
1168078501 19:53992966-53992988 GGCTGACGCCCGAGCGCGAGGGG + Exonic
927472745 2:23387090-23387112 CGCCGCGGCGCAAGCACGGGAGG - Intronic
940639592 2:156332754-156332776 CGCTGACGCGCGCTGACGCGCGG - Intronic
1181149151 22:20870331-20870353 CGCTGACGGGCGAGCTCCTGGGG - Exonic
1182274169 22:29174811-29174833 GGCTGAGGCGTGAACACGGGAGG - Intergenic
950509878 3:13419834-13419856 CGCTGAGGCGCGAGCAGAGCGGG - Intronic
969357817 4:6640984-6641006 CGCTGACGCGCGAGCACGGGCGG + Exonic
969367814 4:6709486-6709508 CTCTTATACGCGAGCACGGGCGG - Exonic
972396518 4:38663730-38663752 CGCCGCCGCCCGAGCCCGGGGGG - Intergenic
1018950820 6:168377757-168377779 GGCTGACGCCTGAGCTCGGGCGG + Intergenic
1024597062 7:50947185-50947207 CGCTTCAGCTCGAGCACGGGAGG - Intergenic
1036379411 8:8227671-8227693 CGCCGACGCGGGACCAGGGGCGG - Intergenic
1049826893 8:144674754-144674776 TGCCGACGAGCGAGCACAGGAGG - Intergenic
1052862876 9:33447548-33447570 CGCTGTCGGGCGGGCAGGGGTGG + Exonic
1052922604 9:33984002-33984024 CGCTGAGGCACGAGAACTGGGGG - Intronic
1060478197 9:124000353-124000375 CACTGAGCCGGGAGCACGGGAGG + Intergenic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1196808117 X:119606268-119606290 CACTCACGCGCGAGCCGGGGAGG + Intergenic
1200107868 X:153724683-153724705 CGCCGAGGGGCGAGAACGGGAGG + Intronic