ID: 969359859

View in Genome Browser
Species Human (GRCh38)
Location 4:6656698-6656720
Sequence TACCCAACTCCACTAAGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969359856_969359859 -5 Left 969359856 4:6656680-6656702 CCTCCCTAGAGGTGATGGTACCC No data
Right 969359859 4:6656698-6656720 TACCCAACTCCACTAAGTTCAGG No data
969359854_969359859 0 Left 969359854 4:6656675-6656697 CCACACCTCCCTAGAGGTGATGG No data
Right 969359859 4:6656698-6656720 TACCCAACTCCACTAAGTTCAGG No data
969359853_969359859 4 Left 969359853 4:6656671-6656693 CCTGCCACACCTCCCTAGAGGTG No data
Right 969359859 4:6656698-6656720 TACCCAACTCCACTAAGTTCAGG No data
969359858_969359859 -9 Left 969359858 4:6656684-6656706 CCTAGAGGTGATGGTACCCAACT No data
Right 969359859 4:6656698-6656720 TACCCAACTCCACTAAGTTCAGG No data
969359857_969359859 -8 Left 969359857 4:6656683-6656705 CCCTAGAGGTGATGGTACCCAAC No data
Right 969359859 4:6656698-6656720 TACCCAACTCCACTAAGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969359859 Original CRISPR TACCCAACTCCACTAAGTTC AGG Intergenic
No off target data available for this crispr