ID: 969365835

View in Genome Browser
Species Human (GRCh38)
Location 4:6693891-6693913
Sequence CCTTCCTCCTGGGGGCTGGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 4, 3: 70, 4: 530}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969365835_969365844 3 Left 969365835 4:6693891-6693913 CCTGCCAGCCCCCAGGAGGAAGG 0: 1
1: 0
2: 4
3: 70
4: 530
Right 969365844 4:6693917-6693939 GTCTGAATCTAGCACCATGACGG 0: 1
1: 0
2: 0
3: 9
4: 110
969365835_969365846 21 Left 969365835 4:6693891-6693913 CCTGCCAGCCCCCAGGAGGAAGG 0: 1
1: 0
2: 4
3: 70
4: 530
Right 969365846 4:6693935-6693957 GACGGAACTAGAGACAGCCATGG 0: 1
1: 0
2: 0
3: 7
4: 102
969365835_969365847 22 Left 969365835 4:6693891-6693913 CCTGCCAGCCCCCAGGAGGAAGG 0: 1
1: 0
2: 4
3: 70
4: 530
Right 969365847 4:6693936-6693958 ACGGAACTAGAGACAGCCATGGG 0: 1
1: 0
2: 0
3: 5
4: 74

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969365835 Original CRISPR CCTTCCTCCTGGGGGCTGGC AGG (reversed) Exonic
900118272 1:1037805-1037827 CCTTCCTCCTGCCAGCTGGCAGG + Intronic
900298939 1:1967179-1967201 CCATCCTCCTGGGGTCAGCCTGG - Intronic
900315856 1:2056018-2056040 CCTTTCTCCCAGGGACTGGCGGG + Intronic
900537256 1:3184972-3184994 CCTTCCTCCTTGGGGAGGGGAGG + Intronic
900549768 1:3248543-3248565 CCCTCGCCCTAGGGGCTGGCTGG - Intronic
900599379 1:3496576-3496598 CCATCCTCCTGCAGGCTGGCTGG + Intronic
900624908 1:3603635-3603657 CCCACCTCCTGGGGGCAAGCAGG + Intronic
900710363 1:4109552-4109574 CCCTGCTCCTGAGGCCTGGCTGG - Intergenic
900796074 1:4709204-4709226 CCTGCCTGGTGGGGGCTGGTGGG + Intronic
900941263 1:5800089-5800111 CCTTCTTCCTGGGGGCTGTGTGG - Intergenic
901023515 1:6267171-6267193 CCTGGCTCCTGTGGGCTGGGTGG - Intronic
901148642 1:7085719-7085741 GCTGCCCCATGGGGGCTGGCAGG - Intronic
901320751 1:8338507-8338529 CCATCCCCATGGGGCCTGGCCGG + Intronic
901323911 1:8355922-8355944 CCTGCCCTCTGGGGGCTGTCTGG - Intronic
901412682 1:9095524-9095546 ACTTCCTGCTGAGGGCTGGGGGG - Intergenic
901455468 1:9360577-9360599 CCTCGCCCCTGGGGGCTGCCGGG + Intronic
902293684 1:15451559-15451581 CCTTCTGCCTGGGGGCTGGGAGG + Intergenic
902408936 1:16201805-16201827 TTGTCCTCCTGGGGGCTGGAGGG + Exonic
902656858 1:17875047-17875069 CCTTCCTCCTGCTGGCTGTGGGG + Intergenic
902685881 1:18077440-18077462 GCTGCCTCCCTGGGGCTGGCTGG - Intergenic
902752450 1:18526588-18526610 CCTTCCTCCTGGGGCAGAGCTGG - Intergenic
903275150 1:22216878-22216900 CCTTCTTGCTGGAGGTTGGCGGG + Intergenic
903348466 1:22703030-22703052 ACTTCCTCCTGGGAGCTGGGAGG - Intergenic
904627694 1:31816136-31816158 TCTTCCTCCTGAGGGCTTCCTGG + Intergenic
905166824 1:36087930-36087952 CCAGCCTCATGGGGGCTGGGGGG + Intronic
905206195 1:36344091-36344113 CCTGCCTCCCGGGGGGTGGGGGG - Intronic
905689277 1:39930818-39930840 CCTTCCTCCTTTGGGCTGGCTGG + Intergenic
905887115 1:41497284-41497306 CCCTTCTCCTGGGGAATGGCGGG + Intergenic
905889347 1:41509869-41509891 CCTGCCTGCTGGGGCCTGGGTGG + Exonic
905912308 1:41662878-41662900 CCTTCCCCCTGGGTGCCAGCCGG + Intronic
906004915 1:42460607-42460629 CCTTCCACCTGGGACCAGGCAGG + Intronic
906188042 1:43876697-43876719 CCTCCTTCCTGGTGGTTGGCTGG + Intronic
906380424 1:45328896-45328918 CCTTTCTCCTGGGGGTTGGAGGG + Intergenic
906659111 1:47570016-47570038 CCTTCCTCTTGGGGTCAGGGTGG - Intergenic
906901815 1:49843920-49843942 CCTTCCTCCTGCTTCCTGGCAGG - Intronic
907148458 1:52259098-52259120 GGTTCCTCCTGGGGGCTGTACGG + Intronic
907404165 1:54243613-54243635 CCTTCCCCCTGGGCTCAGGCGGG + Intronic
907668435 1:56453086-56453108 CTTTCCCCCTGGGGGCTCGAAGG + Intergenic
908390692 1:63680991-63681013 CCTAGCTCCTGGGGGTTGGCTGG - Intergenic
908535545 1:65073191-65073213 CCTTCCTCCCAGCTGCTGGCTGG + Intergenic
909051659 1:70774689-70774711 CCTGCCTACTGGTGGCTGGCTGG + Intergenic
909684015 1:78325476-78325498 CCTGCCACCAGGTGGCTGGCTGG + Intronic
913124627 1:115773492-115773514 CATTCCTCCTGGAGGCTTTCAGG - Intergenic
913217389 1:116631764-116631786 ATGTCCTCCTGTGGGCTGGCTGG - Intronic
913519466 1:119631618-119631640 CCTCTGCCCTGGGGGCTGGCGGG - Intronic
915557915 1:156670352-156670374 CCTTCCTCCTGGGGGCCCTCGGG + Exonic
916215607 1:162390533-162390555 CCTTCCTCCAGGTGGCTTCCCGG + Intergenic
916336527 1:163677319-163677341 CCATCCTGCTGGGGTTTGGCTGG + Intergenic
916890036 1:169105891-169105913 CACCCCTCCTGGGCGCTGGCGGG - Intronic
916991634 1:170250993-170251015 CCTCTCTGCAGGGGGCTGGCAGG + Intergenic
918080839 1:181206653-181206675 CCTTCCTCCTGTGTCCTGGGCGG - Intergenic
920260568 1:204685377-204685399 CCTTCCGCCCGGGGCCGGGCTGG + Intronic
920375034 1:205503760-205503782 GCTTCCTCCTGAGGGCTGTGAGG - Intergenic
920571801 1:207023195-207023217 GCAGCCTCCTGGGGGCTGGCAGG + Exonic
920630583 1:207647664-207647686 CCTTCCTCTTGGAGGCAGGAGGG - Intronic
920789579 1:209076929-209076951 GCTTCCTCCTGGAGGCTTGAGGG - Intergenic
921094437 1:211874546-211874568 CCTCACTGCCGGGGGCTGGCGGG + Intergenic
921663987 1:217844491-217844513 CTTTCCTCCTTGTGGCTGTCTGG + Intronic
922228946 1:223668872-223668894 CCTTCCTCATCGAGGCTGGCAGG + Intergenic
922763179 1:228144843-228144865 CCTTTCCCTTGGGGGCTGGGAGG + Intronic
923338952 1:232991781-232991803 GGTTCCTCCTGAGGGCTGGAGGG - Intronic
924249668 1:242118776-242118798 CCTTGCACCTGGGGGCTGAGTGG + Intronic
924798272 1:247308696-247308718 GCTCCGTCCTGGGGACTGGCAGG + Intronic
1062806086 10:420458-420480 CATTCCACCTGGAGGCAGGCAGG + Intronic
1063535243 10:6876753-6876775 CCTTCCCCCCGGCTGCTGGCTGG - Intergenic
1064412712 10:15121335-15121357 GCTTCCACCTGGGGGCATGCAGG - Intronic
1065184750 10:23160840-23160862 CCTTCCTGCTGGGTGCAGCCTGG - Intergenic
1065435823 10:25703040-25703062 CCTCTCTCCTGGCTGCTGGCAGG - Intergenic
1067771885 10:49132292-49132314 CCCTCCTCCCGGGGAATGGCAGG + Exonic
1069134745 10:64750354-64750376 CCTTCATCCAGGGTGCTGTCTGG + Intergenic
1069808791 10:71143283-71143305 CCCTGCTGCTGGGGGCTTGCTGG + Intergenic
1069865754 10:71501827-71501849 CCCTCCTCCTCCTGGCTGGCCGG - Intronic
1069982294 10:72260928-72260950 CCTTCCTCCCGAGGGTGGGCGGG + Intergenic
1071603371 10:86969706-86969728 CCTCCCTCCTGTGGCCTGCCCGG - Intronic
1072216383 10:93290860-93290882 TGTTCCTGTTGGGGGCTGGCAGG + Intergenic
1073134979 10:101215468-101215490 CTTTCCTCCTGGGCGCTGGGGGG - Intergenic
1073310264 10:102535150-102535172 CCTTCCTCCTGGTCCCAGGCTGG - Intronic
1073482043 10:103792061-103792083 CGCTCCACCTGGGAGCTGGCTGG - Intronic
1073596860 10:104809329-104809351 CCCTGCTCCTGGGGGTTGGCTGG + Intronic
1073799715 10:107027869-107027891 ACATTCTCCTGGGGGCTGACAGG - Intronic
1075340665 10:121644761-121644783 CCCTCCTCCTGTTGGATGGCTGG + Intergenic
1075445037 10:122507083-122507105 TCTTCCTCCTGGGAGGAGGCTGG - Intronic
1076036043 10:127198917-127198939 GCATCATGCTGGGGGCTGGCTGG + Intronic
1076334315 10:129694777-129694799 CCTTTCTCCTTTGAGCTGGCTGG - Intronic
1076619162 10:131775930-131775952 ACTTCCTTCTCGGTGCTGGCTGG + Intergenic
1076827500 10:132976720-132976742 CCTTCCTTCTGGGGGCTCCAGGG + Intergenic
1077034263 11:487310-487332 CCTTCTTCCCGGGGTCTGGCAGG + Intronic
1077043630 11:535198-535220 CCTTCCTCCCTGGGGCCTGCGGG - Intronic
1077167367 11:1149871-1149893 CCTTCCTTTTGGGGGCTGCTTGG + Intergenic
1077248109 11:1548835-1548857 GCTTCCTCCTGGGAGCTGCCTGG + Intergenic
1077359582 11:2134756-2134778 TCTCCAGCCTGGGGGCTGGCAGG - Intronic
1077444279 11:2583099-2583121 CCAGCCTCCTGGGGACAGGCAGG + Intronic
1077465181 11:2730600-2730622 CCTGCCTCCTGGGGCCTCCCAGG - Intronic
1077889119 11:6405918-6405940 CCTGCTTCATGAGGGCTGGCTGG + Intronic
1077967942 11:7155983-7156005 AGTTCCTGCTTGGGGCTGGCAGG - Intergenic
1078105822 11:8357401-8357423 CTTTCCTCCTGGAGGCCCGCGGG - Intergenic
1079247093 11:18760685-18760707 CCTTCCTGCGGGCAGCTGGCTGG - Intronic
1080791383 11:35525438-35525460 TTTTCCTCCTGGGGTCTGCCTGG - Intronic
1081857993 11:46316086-46316108 CCTGCCTCATGGTGACTGGCTGG - Intronic
1081937669 11:46916752-46916774 ACTTCCTCCAGGGGGCTGAGAGG + Intronic
1083033579 11:59615782-59615804 CCCTCCTCCCCGCGGCTGGCCGG - Exonic
1083177553 11:60960792-60960814 CCTTCCTTCTGGGGGTAGGACGG + Intergenic
1083327305 11:61879354-61879376 TCTACCTCCTGGGTCCTGGCTGG - Exonic
1083605509 11:63976259-63976281 CCTTCCTCCTGCCAGCGGGCTGG + Exonic
1084198693 11:67541225-67541247 CTTTCCTCTTGGGGACTGGGGGG - Intergenic
1084434025 11:69127532-69127554 GCCTCCTCCTGGGTGCTGGGTGG - Intergenic
1084460165 11:69292754-69292776 CCATCTTCCTGGGAGCTGTCTGG + Intergenic
1084460189 11:69292847-69292869 CCATCTTCCTGGGAGCTGTCTGG + Intergenic
1084518189 11:69647547-69647569 CCCTGCTGCTGGGGGGTGGCAGG + Intronic
1084643982 11:70443714-70443736 CCTTCCTGCTGGAGGCTCCCGGG - Intergenic
1084961119 11:72717239-72717261 CCTTCCTCTTGGGCTCTGGGAGG - Intronic
1085036956 11:73306605-73306627 CCTTGCTACTGGGGGTTGGAGGG + Intergenic
1085309199 11:75506293-75506315 TCTTCCTCCCTGGGGCTGGCTGG - Intronic
1088884887 11:113998863-113998885 CCTTCTTCCTGGGGGAGGGGAGG - Intergenic
1089076635 11:115743874-115743896 CCTTCCTCCTGGGGTGTGCCCGG - Intergenic
1089294289 11:117458677-117458699 CCTGCCTCCTGGGGTGGGGCTGG + Intronic
1090029693 11:123195999-123196021 CCCTTCCCCTGGGTGCTGGCTGG - Intergenic
1091146225 11:133282643-133282665 CCATCATTCTGGGGGCTGGAGGG - Intronic
1091878852 12:3960281-3960303 CATTCCTGCTTGTGGCTGGCAGG - Intergenic
1092365197 12:7871716-7871738 CCTTCCTCCTGGGGGCACACAGG - Intronic
1093092388 12:14936491-14936513 CCTTCAGCCTGGGGACTTGCAGG - Intronic
1095778929 12:46037476-46037498 CTTCCCTCTTTGGGGCTGGCAGG - Intergenic
1096415366 12:51407927-51407949 CCTGGCGCCTGGTGGCTGGCTGG + Intronic
1096526587 12:52213552-52213574 CTTCCCTCCTTGAGGCTGGCTGG + Intergenic
1096666727 12:53171197-53171219 ACATCCGCCTGGGGGCAGGCTGG + Intronic
1096799140 12:54097891-54097913 TCTTCCTGCTGGGGCCTTGCAGG - Intergenic
1097066612 12:56325210-56325232 CCTTCCTCCTGGGTCCAGGGTGG + Intronic
1099201998 12:79689648-79689670 TCTTCCTCCTGGGAGCTACCCGG - Intronic
1101807293 12:108075512-108075534 CCTTCCTCCTTCCTGCTGGCTGG + Intergenic
1102184574 12:110937591-110937613 CCTTCCTGCTGGGGGCCGGTGGG + Intergenic
1102612279 12:114122868-114122890 CCTTCCACCTGGGGTCAGGTAGG - Intergenic
1102769856 12:115466115-115466137 CCTTCCTCAGCGGGGCTGACTGG + Intergenic
1102949938 12:117024719-117024741 CCTTCCACCTGTGGGCAGGTGGG - Intronic
1103139522 12:118536333-118536355 CTTTCCTCCTGGGGGATGTGGGG + Intergenic
1103485918 12:121282534-121282556 CCTTCCCCCTCCGTGCTGGCTGG - Intronic
1103627278 12:122229297-122229319 ACTTCCTCCTGGTGACAGGCTGG + Intronic
1103700069 12:122844637-122844659 CCTGCCTCTTGGGAGCTGGATGG + Intronic
1103848982 12:123918741-123918763 CCCCCCTCCTGGCTGCTGGCCGG - Exonic
1103903899 12:124317663-124317685 CCTTCCGCCTTGTGCCTGGCTGG - Intergenic
1103969940 12:124664161-124664183 CCTTCCAGCTGAGGGCAGGCAGG + Intergenic
1104660511 12:130608569-130608591 CCCTCCTCCTGGGGGGAGGTGGG + Intronic
1105214542 13:18276665-18276687 ACTTCAGGCTGGGGGCTGGCAGG - Intergenic
1105851428 13:24339693-24339715 CGTTCCTCCTGGTGGCTTCCTGG - Intergenic
1106212600 13:27664181-27664203 TCTACCTCCTGGGGGCACGCTGG - Intronic
1107290594 13:38848881-38848903 GCTTCCTTCTGAGGGCTGTCAGG + Intronic
1108024990 13:46168422-46168444 CCTCGCTCCTGGGGGCTGGGGGG + Intronic
1108053450 13:46465669-46465691 CCTGCCTCGTGGGGGGTGGGGGG - Intergenic
1108104015 13:46989147-46989169 CCTACCTCCTGGTGGTTTGCTGG - Intergenic
1108808253 13:54186646-54186668 CATTCCTGGTGGGGGCTGGAGGG - Intergenic
1109302462 13:60603388-60603410 CTTTCCTCCTTGGGACAGGCAGG + Intergenic
1111445304 13:88339619-88339641 CCCTGCTGCTGGTGGCTGGCTGG + Intergenic
1112039813 13:95535622-95535644 CCTTTCTCCTGGTGGCTCGCAGG - Intronic
1112407200 13:99131575-99131597 CATTCCTCCTGGAGGCTCTCGGG - Intergenic
1112435093 13:99386168-99386190 CCTGCTGCCAGGGGGCTGGCTGG - Intronic
1113587565 13:111475723-111475745 CTGTCCTGCTGGGGGCTGGGAGG + Intergenic
1113607748 13:111622398-111622420 CCGGCCTCCTGGGTGCTGCCCGG + Intronic
1113608386 13:111626433-111626455 CCTCCCACCTGGGCCCTGGCAGG + Intronic
1113755391 13:112807894-112807916 CCTGCCTCCTGGGGCCAGGCTGG - Intronic
1113766037 13:112881661-112881683 CCCTCGTCCTGAGGGCAGGCCGG - Intronic
1113788814 13:113016644-113016666 CCTGCCTCCAGGGGGTGGGCAGG - Intronic
1114484936 14:23056825-23056847 CCTTTCTCCTAGGGGCGGGGGGG + Intronic
1115425117 14:33249588-33249610 CCTTCTTCCTGGGGACCTGCAGG + Intronic
1115520825 14:34231526-34231548 GCTTCCTCCTGTGGGCCGGAGGG - Intronic
1117009307 14:51454062-51454084 CCTCCCTGCTGGCTGCTGGCGGG - Intergenic
1118468906 14:66056815-66056837 CCTTCCTCTGGGGGGCTGGGTGG - Intergenic
1118722803 14:68606328-68606350 CCTGCCTCCTGGGAGCTTGGTGG - Intronic
1120845035 14:89117939-89117961 CCTGCCTCGTGGGGGCCGTCCGG - Intergenic
1121180505 14:91925406-91925428 CCATCTCCTTGGGGGCTGGCAGG - Intronic
1121449655 14:93999074-93999096 CCTCCCCTCTGGGGGCTGGTGGG + Intergenic
1122075576 14:99232629-99232651 CCTGGCTCCTGGTGGCTTGCAGG - Intronic
1122653494 14:103240745-103240767 CCTTCCTCCTGGGGAATGGCGGG - Intergenic
1123015046 14:105369509-105369531 CCTTCCTTCTGGGGTCGGCCAGG + Intronic
1123478772 15:20612299-20612321 CCTTCCTCCTGGGAAATAGCGGG - Intergenic
1123639241 15:22388086-22388108 CCTTCCTCCTGGGAAATAGCGGG + Intergenic
1123986182 15:25648230-25648252 CCTTCCTCCAGGGGCCTCGAGGG - Intergenic
1124010874 15:25837732-25837754 CCTTCCTGCTTTGCGCTGGCTGG + Intronic
1124375743 15:29127687-29127709 CCTCCCTCCTGGGACCTGGGCGG - Intronic
1124896878 15:33785697-33785719 CCTTCCAGCTGGGGGATGTCAGG - Exonic
1125413252 15:39426895-39426917 ACTTCCTCTTGTGGGCTGGCTGG - Intergenic
1126691973 15:51294719-51294741 CCTCCCTCCCGGGGGGCGGCTGG - Intronic
1127298012 15:57626999-57627021 CCTTCCTCCTGTGGTCGGGGGGG + Intronic
1127585420 15:60373470-60373492 CCTTCAGCCAGGGTGCTGGCTGG + Intronic
1127969292 15:63946104-63946126 TCTGCCTCCTGGTGGCAGGCAGG - Intronic
1129706311 15:77796573-77796595 CCTGCCTCCTGGGAACTGGCTGG - Intronic
1129719638 15:77871136-77871158 CCTGCCTCCCGGGGCCTGCCTGG + Intergenic
1130053231 15:80501614-80501636 CCTGCCTCCTGGCTGCTGGAGGG - Intronic
1131112927 15:89776682-89776704 CCTCCCTCCTTGGCGCCGGCCGG + Exonic
1131953226 15:97704285-97704307 ACTTCCTCCTGGGAGGTGGCTGG + Intergenic
1132115297 15:99131499-99131521 CCTTCCTCATCTGGGCTGCCAGG - Exonic
1132619366 16:857100-857122 CCTTCCTCCTCGTCGCTGACCGG + Intronic
1132673029 16:1109547-1109569 CCTCCCTCCTGGGTGTTTGCGGG + Intergenic
1132678148 16:1129204-1129226 CCGGCCTCCTCGGGGCAGGCAGG - Intergenic
1132722983 16:1326100-1326122 CCTTCCTGCTGGGAGGTGACCGG - Exonic
1132852573 16:2031379-2031401 GCTTCCTCCTGGGGGAGGGAAGG - Intronic
1132932151 16:2464309-2464331 CCATCCTCCTGGGTCCTGGGGGG - Intronic
1133008464 16:2897415-2897437 CCTAGCTGCTGCGGGCTGGCTGG + Intronic
1133166082 16:3948430-3948452 CATTCCTTCTGGTGGCTGCCTGG + Intergenic
1133209950 16:4258014-4258036 TCTCCCTTCTGGGGGCTGGAGGG - Exonic
1133384508 16:5358128-5358150 CCTTGCTCCTGGTGGTTTGCTGG + Intergenic
1133976352 16:10602090-10602112 CAGGCCTTCTGGGGGCTGGCGGG + Intergenic
1134116607 16:11553473-11553495 CCTTCTCTCTGGGTGCTGGCGGG - Intronic
1134308737 16:13057128-13057150 CCTTCCTGCCTGGGGCTGGAGGG + Intronic
1134571992 16:15298983-15299005 CCTTCCACCTGGAGGTTAGCAGG + Intergenic
1134730389 16:16457060-16457082 CCTTCCACCTGGAGGTTAGCAGG - Intergenic
1134865583 16:17604001-17604023 CCATCCTCCTGGGGGTGGGCAGG + Intergenic
1134872593 16:17665495-17665517 CCATCCCCCTGGGGGATGACCGG + Intergenic
1134880249 16:17739965-17739987 CCATCCTGCTGGGGTCAGGCTGG + Intergenic
1134937042 16:18254836-18254858 CCTTCCACCTGGAGGTTAGCAGG + Intergenic
1135125747 16:19808053-19808075 CCTTCATTCTGGGGTATGGCTGG - Intronic
1135152575 16:20021887-20021909 CCTGCCTCCTAGGGTCAGGCTGG - Intergenic
1135158725 16:20074840-20074862 CCTTTCTCCTCAGGGCAGGCAGG + Intergenic
1135415684 16:22266602-22266624 ACTTCCTCCCGCAGGCTGGCTGG + Intronic
1135547351 16:23375137-23375159 CCAGCCTCCTGGAGGCTGCCTGG + Intronic
1136069158 16:27777799-27777821 CCATCCTCCTTAGGGCTGGTGGG - Intronic
1136146964 16:28321502-28321524 CCTCCCTTCTGGAGGCTGGAGGG + Exonic
1136278751 16:29194720-29194742 CCTGCCTGCTGGCGGCTGGGTGG - Intergenic
1136544892 16:30949274-30949296 CCTTCATCCTGGGGGGGGGGCGG - Exonic
1137585598 16:49662393-49662415 CCTTCCTCTTGGAGGATGGTTGG - Intronic
1137668056 16:50263172-50263194 CCTTCCTCAGTGGGGCTGCCAGG + Intronic
1137709031 16:50553887-50553909 CTTTCCTCCTGGGGGATGGGAGG + Intronic
1137745076 16:50814566-50814588 CCTTCCCCCTGGGGGATTGGTGG + Intergenic
1138193715 16:55036723-55036745 CCTTCGTGCTGGGGGAAGGCAGG + Intergenic
1138205150 16:55119117-55119139 CCTTCCTCCTGGGGCAAAGCCGG - Intergenic
1138630178 16:58287667-58287689 TGGTCCTCCTGGGGCCTGGCAGG + Intronic
1139478163 16:67213532-67213554 CCTTCATTCTGGAGCCTGGCTGG + Intronic
1139964416 16:70737562-70737584 ACTTCCTGCCAGGGGCTGGCAGG - Intronic
1141125402 16:81397464-81397486 GCTTCCTCCTGGAGGCTCTCGGG - Intergenic
1141269758 16:82528429-82528451 TCATCCTCCTGGGGGATAGCTGG + Intergenic
1141639617 16:85333632-85333654 CCAGCCTCCTGGGAACTGGCTGG + Intergenic
1141665776 16:85464468-85464490 CCTTCCTCCGGGTGCCCGGCTGG + Intergenic
1141828339 16:86496160-86496182 CCTTCCACCTGCAGGCGGGCGGG + Intergenic
1142038583 16:87878083-87878105 CCTGCCTCCTGGGGACCAGCAGG + Intergenic
1142056016 16:87996490-87996512 CCCTCGTCCTGGGCGCCGGCTGG + Intronic
1142056040 16:87996584-87996606 CCCTCGTCCTGGGCGCCGGCTGG + Intronic
1142056063 16:87996678-87996700 CCCTCGTCCTGGGCGCCGGCTGG + Intronic
1142083142 16:88160801-88160823 CCTGCCTGCTGGCGGCTGGGTGG - Intergenic
1142172245 16:88628860-88628882 CCTGCCCCCTAGGGGCTGGGAGG - Intronic
1142340656 16:89520171-89520193 CCTTCCTCCTGTGTGCTTCCAGG - Intronic
1142401124 16:89859271-89859293 CGTCCCTCCTGGGGGGTGGGTGG - Exonic
1142563994 17:827732-827754 CCTCCCTGCTGGGGGCTTGAGGG + Intronic
1142719531 17:1766974-1766996 ACCTCCTCCGGGGGGCTGGCAGG - Exonic
1142887953 17:2924873-2924895 CTTTCCTCCGGGGGGCTAGTGGG + Intronic
1143482986 17:7238099-7238121 CCTGGACCCTGGGGGCTGGCGGG - Intronic
1143681918 17:8482034-8482056 AGTTCCTCCCGTGGGCTGGCAGG - Intronic
1143742742 17:8965977-8965999 CCTTACTCCTTGGGGGTCGCTGG - Intergenic
1144205926 17:12979543-12979565 CCTCCTGCCTGGGGGGTGGCTGG + Intronic
1144223383 17:13120553-13120575 CCCTCCCCCTGGGTGGTGGCTGG + Intergenic
1144626303 17:16845989-16846011 CCAGCCACCTGGGAGCTGGCAGG - Intergenic
1144880130 17:18426731-18426753 CCAGCCACCTGGGAGCTGGCAGG + Intergenic
1144958748 17:19033077-19033099 CTTTTCTCCTGGGGGCAGGCTGG - Intronic
1144976411 17:19141447-19141469 CTTTTCTCCTGGGGGCAGGCTGG + Intronic
1145152103 17:20517653-20517675 CCAGCCACCTGGGAGCTGGCAGG - Intergenic
1147570572 17:41568016-41568038 TCTTCATCCTGGGGGCCGGGGGG - Intronic
1147580449 17:41624687-41624709 CCAGCCACCTGGGAGCTGGCAGG - Intronic
1147644379 17:42025077-42025099 CCTGCCCCCTGGTGGCTGGAGGG - Exonic
1147653951 17:42077964-42077986 CCGTCCTCCTTGGGGCAGGATGG - Intergenic
1147995237 17:44356474-44356496 ATTTCCTGCTGGGTGCTGGCAGG + Exonic
1148157572 17:45432511-45432533 CCCTCCATCTGGGGGCTGGAGGG - Intronic
1148670333 17:49405324-49405346 ACTTCCTCCTGATGGCTAGCGGG + Intronic
1148687368 17:49508373-49508395 CCCTCCTCCTTCGGGGTGGCTGG - Intronic
1148846359 17:50532451-50532473 CCTTCCTCCTCTGGGCCGGGAGG - Intergenic
1150314424 17:64156458-64156480 CCTTCCACCAGAGGCCTGGCTGG + Intronic
1151178943 17:72311963-72311985 CCCTCCTCATGGGGGCTCCCTGG - Intergenic
1151343229 17:73485225-73485247 CCTCCCTCCTGAGGGCAGGAAGG + Intronic
1151557217 17:74852604-74852626 CCCGGCTCCTGGGGGCGGGCGGG + Exonic
1152230828 17:79113214-79113236 CCTTCCTCCCAGAGGCTGCCCGG - Intronic
1152456918 17:80422000-80422022 CCTTCCCCCTGGGGGAGGGAAGG + Intronic
1155026607 18:21946312-21946334 CCTTCCTTCTGGAGGCTGCAGGG + Intergenic
1155623461 18:27807792-27807814 CCTTGCTTCTGGGAGCTGGCTGG - Intergenic
1156255091 18:35387273-35387295 CCTGCCACCAGGTGGCTGGCTGG - Intergenic
1156546364 18:37967526-37967548 CCTGCCTCCAGGTAGCTGGCTGG - Intergenic
1157464302 18:47930795-47930817 CCCACCTCCCGGCGGCTGGCGGG + Intronic
1158664112 18:59416908-59416930 CCTTCCTCCTTTCTGCTGGCTGG - Intergenic
1158851176 18:61496557-61496579 CCTGACTCCTGGGAGCTGGCTGG - Intronic
1160081054 18:75727518-75727540 CCTTCCACCGAGGGGCTGCCTGG - Intergenic
1160663725 19:313201-313223 CCATCCTCCTGGGCGATGTCAGG + Intronic
1160980783 19:1815733-1815755 CCTCCCTCCCGGGTGGTGGCCGG - Exonic
1160982501 19:1822815-1822837 CCTGCCTCCCTGGCGCTGGCTGG - Intronic
1161018728 19:1997563-1997585 CATGCCTGCTGGAGGCTGGCAGG - Intronic
1161259790 19:3331406-3331428 GATTCCTCCTGAGGGCTGGCAGG + Intergenic
1161464717 19:4422509-4422531 GCTTCCTCCTGGGAGTTGGAGGG + Intronic
1161571526 19:5033253-5033275 CCTGGCTCCAGGGAGCTGGCAGG + Intronic
1162095286 19:8306504-8306526 GCTTCCTCCTGGGTGCGGCCAGG + Intronic
1162351935 19:10155777-10155799 TCTCCTTCCTGGGGGCTGACGGG - Intronic
1163920458 19:20283861-20283883 CCTTCTTCCTTGGGTTTGGCAGG - Intergenic
1164423996 19:28123894-28123916 GCTTCCTCCCTGGGGCAGGCAGG - Intergenic
1164442412 19:28289446-28289468 CCCTCCTCCTGGGGTCTGCAGGG + Intergenic
1164614064 19:29655617-29655639 CCTTTCTCCTGGTGTCAGGCTGG - Intergenic
1164761751 19:30733401-30733423 CCTTCCTCCTTCAGGCTGGAGGG - Intergenic
1164992094 19:32692010-32692032 GCATCGTCCTGGCGGCTGGCTGG + Exonic
1165094961 19:33405241-33405263 CCTTCTGCCTCTGGGCTGGCGGG - Intronic
1165895515 19:39138894-39138916 CCCTACTCTGGGGGGCTGGCAGG + Intronic
1166055073 19:40283768-40283790 CCTTCCTCCCTGGGCCAGGCTGG + Intronic
1166246558 19:41531624-41531646 CCTCTCTCCTGGGGGCGGGAGGG - Intergenic
1166767888 19:45263233-45263255 CCTTCCTGCGGGGGCCCGGCTGG + Intronic
1166777866 19:45323433-45323455 CCTTCCTCCTAGGGACTGAGTGG + Intergenic
1167166951 19:47804888-47804910 GATGACTCCTGGGGGCTGGCTGG - Intronic
1167174884 19:47858880-47858902 GATGACTCCTGGGGGCTGGCTGG + Intergenic
1167248382 19:48387875-48387897 CTTGCCTCCTGGGGCCTGGCAGG - Intronic
1167271047 19:48506501-48506523 TTTTCCTACTGGGGCCTGGCGGG + Intronic
1167476787 19:49706055-49706077 TGTTCCTCGTGGGGGCAGGCCGG - Exonic
1167736415 19:51297058-51297080 CCTTGCTCCTAGGAGCAGGCAGG - Intergenic
1168201239 19:54817386-54817408 CCTTGTTCCTGGGGGCAGGTAGG + Intronic
1168210005 19:54883477-54883499 CCTCCCTCCATAGGGCTGGCCGG - Intronic
1168464207 19:56589167-56589189 CCTTGCCCCTGTGGGCTGGTGGG - Intergenic
925164841 2:1709620-1709642 CCGGCCTCCTGGGGCCGGGCAGG - Intronic
925804377 2:7633764-7633786 CACTCCTCCTGGGGGCAGACTGG + Intergenic
926130954 2:10302884-10302906 CCTTCCTTCCCGGAGCTGGCAGG + Intronic
926141920 2:10372942-10372964 CCCTCCTTCTGGGGGCAGGAGGG - Intronic
926712824 2:15896311-15896333 CCTGCCTGCTTGGGGCTTGCTGG - Intergenic
926914054 2:17876832-17876854 TCTTTCTCCTGGGGTCTGGGCGG - Intergenic
927091760 2:19717820-19717842 CCTTCCCCCAAGGGGCTGGGTGG + Intergenic
927904122 2:26845212-26845234 CCGGCCTTCTGGAGGCTGGCAGG + Intergenic
927922314 2:26982499-26982521 CCTTCCTGGTAGGGACTGGCAGG - Intronic
928221251 2:29404893-29404915 TCCTCCTCCTTGGGGCTGGGTGG - Intronic
928524752 2:32128789-32128811 GCTTCCTCCTGAGGGCTGTGAGG + Intronic
928903641 2:36348251-36348273 CCATTCTGCTGGGGGATGGCAGG - Intergenic
929794390 2:45047823-45047845 CCCTCATCCTGTGGGCTGGTGGG + Intergenic
929907618 2:46060320-46060342 CCTTCCTCCTGGGCACTGCCCGG + Intronic
930928251 2:56847995-56848017 CCTTCCTGTTGGAGGGTGGCTGG + Intergenic
933979309 2:87537742-87537764 CCGTCCTCCTGGGGCTTGGGGGG - Intergenic
934561378 2:95315245-95315267 CCTGCCACCTGGTGGCTGGCTGG + Intronic
934772605 2:96916876-96916898 CCTTCTTCCTGGGGTCAGTCTGG + Intronic
934991730 2:98926403-98926425 CCATCCTCTTGGGAGCTTGCAGG + Intronic
935100727 2:99993006-99993028 CCTTCTTCCTGATGGCTGGAAGG + Intronic
935317893 2:101855266-101855288 TCTTCCAGCTGGGGGCTTGCTGG + Intronic
936314517 2:111413049-111413071 CCGTCCTCCTGGGGCTTGGGGGG + Intergenic
936526096 2:113242418-113242440 CCTTCCTCCAGGGGGCCTCCTGG + Intronic
936865582 2:117072847-117072869 CTGTCCTCCTGGGGGGTGGGGGG - Intergenic
936986247 2:118313687-118313709 CCTTCCACCAGGGGGCTACCTGG + Intergenic
937084465 2:119161523-119161545 CCTGCCTCCTGGTGGAGGGCTGG - Intergenic
937096824 2:119240935-119240957 CCCTCCTGCTGAAGGCTGGCAGG - Intronic
937127714 2:119484923-119484945 CCCACCTCCTCAGGGCTGGCTGG - Intronic
938751426 2:134334413-134334435 ACTTCATCCTGGTGGGTGGCTGG + Intronic
940329122 2:152455429-152455451 CCTCCCTCCTGTGTGCTGGCTGG - Intronic
942937994 2:181581713-181581735 CCTGCCACCAGGTGGCTGGCTGG + Intronic
943166081 2:184327902-184327924 CCTTACTGCCTGGGGCTGGCGGG + Intergenic
943745726 2:191461172-191461194 TTTTCCTCCTGGCTGCTGGCTGG - Intergenic
944433253 2:199659490-199659512 CCCTCCCTCTGGGGGTTGGCTGG - Intergenic
944892947 2:204136232-204136254 CCCTCCTCATGGGGGTTGGTGGG + Intergenic
946339344 2:219058081-219058103 CCTCCCTCCCGGCCGCTGGCTGG - Intronic
946396600 2:219446471-219446493 CCTCCCTGCAGGTGGCTGGCTGG + Intronic
946410315 2:219512243-219512265 CTTTCCTCCTGAGGGTAGGCAGG - Intergenic
946724434 2:222648074-222648096 CCTTCCTCGCGGGGGCTTGATGG - Intronic
947218247 2:227768445-227768467 CCATCCTGCTGGGGGCAGGCAGG - Intergenic
947820912 2:233068873-233068895 CCTTCCTCCTGCTGGCTTCCAGG - Intronic
948076720 2:235170750-235170772 CTTTCCTCCTGGGGGTTGGCAGG - Intergenic
948618415 2:239216706-239216728 CCTTCCTCCTGTGGGCTACTTGG + Intronic
948784581 2:240345709-240345731 GGTTCCTCCTGGGGGCTGTGGGG + Intergenic
948921417 2:241067704-241067726 CCTTGCTCCTGGGGGAGTGCAGG - Intronic
948963312 2:241356601-241356623 CCTGCCGCGTGGGGGCAGGCGGG + Intronic
1168753318 20:298533-298555 CCTTCTTCCTGGGGGCCGAGAGG + Exonic
1169061923 20:2666681-2666703 CCTATCTCCTGGGGGATGGGAGG + Intergenic
1170568897 20:17621940-17621962 GATTCCTCCTGGGGGGTGGGTGG + Exonic
1172705648 20:36880427-36880449 CCTTCCTCCTCTGGGCCGTCAGG - Intronic
1173258470 20:41412151-41412173 CCTGGCTCCTTGGGGATGGCAGG + Exonic
1173823037 20:46030835-46030857 CATTCCTCCTGGGGGCTGAGTGG + Intronic
1173861388 20:46286055-46286077 CCTTCCTGGAGAGGGCTGGCAGG + Intronic
1174409059 20:50321938-50321960 CCTTCCTCCCACTGGCTGGCTGG - Intergenic
1175084942 20:56450629-56450651 CCTGCCTTCTTGGGGCTGGCTGG - Exonic
1175292124 20:57882791-57882813 GCTCCCTCCTGGGGGCTCACAGG + Intergenic
1175731538 20:61357574-61357596 GGTTCCCCCTGGGGGCTGTCTGG - Intronic
1175802167 20:61807117-61807139 CCTTGCAGCTGGGGGCTGGCGGG - Intronic
1175844327 20:62050736-62050758 CCTTCTGCCTGGAGCCTGGCAGG - Intronic
1175863574 20:62163025-62163047 CCCTCCTGCTGGGTGCTGGAGGG + Intronic
1175923522 20:62461144-62461166 CCCTCCTCCTGAAGGCTGCCTGG + Intergenic
1175994027 20:62804525-62804547 CCGTCCTCTGGGGGGCGGGCAGG + Intergenic
1176373738 21:6077244-6077266 GCTTCCTCCAGGAGGCTGGGTGG + Intergenic
1176383708 21:6126679-6126701 CCTTCCTGCTGGGGCTTGGCCGG + Intergenic
1178631551 21:34265507-34265529 CTGCCCTCCTGGGAGCTGGCTGG - Intergenic
1178843766 21:36157428-36157450 CCCTTCTCCTGGGGACTGGCTGG - Intronic
1179262704 21:39772492-39772514 GGTTCCTCCTGAGGGCTGGGAGG + Intronic
1179266271 21:39806225-39806247 CCTTCCTGCTGGGTGTGGGCAGG + Intergenic
1179587666 21:42383848-42383870 CCTTCCTCCTGGGTGCCAGGCGG - Intronic
1179714027 21:43278654-43278676 CCTTCCTCCTGGGGTCTGTGGGG - Intergenic
1179714044 21:43278725-43278747 CCTTCCTCCTAGGGTCTGTGGGG - Intergenic
1179739762 21:43411559-43411581 CCTTCCTGCTGGGGCTTGGCCGG - Intergenic
1179749739 21:43460999-43461021 GCTTCCTCCAGGAGGCTGGGTGG - Intergenic
1179948914 21:44698605-44698627 CCTGCCAAGTGGGGGCTGGCTGG + Intronic
1180085777 21:45507308-45507330 GCACCCTCCTGTGGGCTGGCAGG + Intronic
1180731717 22:17987363-17987385 CCTTCCTCCTGGAGGCAGCAGGG + Intronic
1180838811 22:18948172-18948194 GCTTCCTCCTTGGGAGTGGCAGG - Intergenic
1180857473 22:19057614-19057636 CCTTTCTCCTGGGTGTTGGGTGG - Intronic
1180953711 22:19731931-19731953 TGGTCCTCCTGGGGGCGGGCAGG - Intergenic
1181015022 22:20063782-20063804 CTTTCCTGCCTGGGGCTGGCTGG + Intronic
1181051705 22:20241085-20241107 GCCTCCTCCTGGGGGCTGCCCGG + Intergenic
1181167596 22:20991929-20991951 CCTTGCTCCTGGTAGCTGTCTGG - Intronic
1181592366 22:23893354-23893376 CCTCCCAGCTGGAGGCTGGCTGG + Intronic
1181689957 22:24553777-24553799 CCTTGATCCTGAGGCCTGGCAGG + Intronic
1181805508 22:25372360-25372382 CCTTCCTCCGGGGAGCGGGCAGG + Intronic
1182684058 22:32107160-32107182 CCTGCCTCCCTGGGGCAGGCAGG + Intronic
1183195230 22:36349088-36349110 ACCTCCTCCTTGAGGCTGGCTGG + Exonic
1183477962 22:38046399-38046421 CCTTCCTGCTGGGGGGTGCCAGG - Intergenic
1183508678 22:38222847-38222869 GGTGCCTCCTGGGGCCTGGCAGG + Intronic
1183732742 22:39627835-39627857 CCTTCCCCATGGGGGCTGTCAGG - Intronic
1184096156 22:42317633-42317655 CATTCCCGCTGGGGGCTGGGGGG + Intronic
1184254615 22:43280050-43280072 CCTTCCTCCTCCTGACTGGCTGG - Intronic
1184406560 22:44303938-44303960 CCGTCCTCCTGGGGGGCGGAGGG - Intronic
1184839583 22:47044634-47044656 CCTACTTCCTGTGGGCGGGCAGG - Intronic
1185001808 22:48250818-48250840 CCTTCCTCCAGGAGAGTGGCAGG - Intergenic
1185163562 22:49244117-49244139 CCTGGCCTCTGGGGGCTGGCCGG - Intergenic
1185276704 22:49953057-49953079 CCCTCCTCCTGAGGGCTGGGAGG + Intergenic
1185366351 22:50438710-50438732 CCTTCTTCCCGGGGGCCGGTGGG - Exonic
949307671 3:2661262-2661284 CACTCCTCCTTGGGGCTGCCTGG - Intronic
949488465 3:4564290-4564312 CCTGGCTCCTGGTGGTTGGCGGG + Intronic
950703595 3:14766764-14766786 TCTGCATCCTGGGTGCTGGCAGG - Intronic
950952127 3:17011530-17011552 CCTCCCTCATGATGGCTGGCCGG - Exonic
952752198 3:36833643-36833665 GCTGCCTCCTGGAGGCTGCCAGG - Exonic
952954622 3:38549377-38549399 CCTTGCTCCTGGAACCTGGCAGG - Exonic
952960683 3:38587388-38587410 CCTTCCGCCTGGTACCTGGCTGG - Exonic
953572341 3:44080930-44080952 TCTTTGTACTGGGGGCTGGCAGG + Intergenic
954097754 3:48343536-48343558 CCTTCCCTCTGGGCCCTGGCTGG - Intergenic
954469580 3:50680752-50680774 CCTCCCTCCTGGGGAGTGGCGGG + Intronic
954642126 3:52106978-52107000 TCTTCCTCCTGGGGGCATGTCGG - Intronic
954645931 3:52131557-52131579 CCTGACTCCTGGAGGATGGCTGG - Intronic
954792815 3:53145503-53145525 CCTACCTCCTGGCTCCTGGCAGG - Intergenic
955224309 3:57048631-57048653 CCCTCCTCCTTAAGGCTGGCTGG + Intronic
955345911 3:58161758-58161780 CCTTCCTCTTGGTGGCAGGATGG + Intronic
955345917 3:58161781-58161803 CCTTCCTCTTGGTGGCAGGATGG + Intronic
957049947 3:75403801-75403823 CCTTCATCCTGGGAGATGCCTGG - Intergenic
958802898 3:98777130-98777152 CTTTCCTCCTCCTGGCTGGCAGG - Intronic
959060786 3:101614375-101614397 CCCTCCACCTGGGAGCTGGTGGG + Intergenic
960054912 3:113270264-113270286 CCTCCTTCCTGGAGGCTTGCAGG + Intronic
960937195 3:122911509-122911531 CCTCCATGCTGGAGGCTGGCAGG + Exonic
960968724 3:123124054-123124076 GCTTCCTCCCAGGTGCTGGCCGG + Exonic
961032509 3:123618909-123618931 CCTTTCTCCTGGGGACAGGTTGG + Intronic
961378954 3:126484782-126484804 CCTCCCACCTGGAGGCTGGTGGG - Intronic
961388156 3:126536123-126536145 CCTACCTCCTAGGGGCTTGGTGG - Intronic
961431988 3:126890022-126890044 CCTTTCTCCTGTGGGCTGCATGG + Intronic
961539300 3:127589509-127589531 CCTTCGGCCTTGGGGCTGGCAGG + Intronic
961864095 3:129941072-129941094 CCTTGCTCCTGGTGGTTTGCTGG - Intergenic
961882260 3:130070241-130070263 CCTTCATCCTGGGAGATGCCTGG - Intergenic
962389196 3:134957475-134957497 CCTTCCTCCTGGTGGCCTGTAGG - Intronic
962454643 3:135553842-135553864 TCTTCCTTCTGGGGGTTAGCCGG + Intergenic
964074411 3:152675918-152675940 GTATCCACCTGGGGGCTGGCTGG + Intergenic
964902416 3:161675564-161675586 GCTCCCTCCTTGGTGCTGGCAGG - Intergenic
966912276 3:184566219-184566241 CCGTCCTTCTGGCTGCTGGCAGG + Intronic
967784154 3:193471859-193471881 CATTCCTGCAGGGGGCTGGGTGG + Intronic
967982976 3:195076708-195076730 CCTCGCTCCTGGTGGCTTGCTGG + Intronic
968502698 4:958436-958458 CCTGGCCCGTGGGGGCTGGCGGG - Exonic
968643751 4:1728316-1728338 CCAACCACCTGGTGGCTGGCAGG + Exonic
968666786 4:1826772-1826794 CTGTCCTCCTGGGGGCTGGCTGG + Intronic
968672262 4:1857912-1857934 CTTGCCTCCTGGGGGATGGGTGG - Intergenic
968739854 4:2321990-2322012 ACTTCCTCCTGGGAGCCTGCGGG + Intronic
968789825 4:2651869-2651891 CTCTCCTCCTGGGGGCTGTCTGG - Intronic
968817102 4:2827871-2827893 CCCTCCTCCTGGGAGGTGGGAGG - Intronic
968874089 4:3256079-3256101 CCTTCCACCTGGCCTCTGGCAGG + Exonic
968914610 4:3491989-3492011 CCCTCCTCCTGGGGCAGGGCAGG - Intronic
968970211 4:3789762-3789784 CGTACCCCCTGGGGACTGGCCGG + Intergenic
969365835 4:6693891-6693913 CCTTCCTCCTGGGGGCTGGCAGG - Exonic
969911404 4:10450093-10450115 CCTTCCTCATGCGTTCTGGCTGG - Intronic
974799795 4:66801990-66802012 CCTTCCTTCTGGGTATTGGCAGG - Intergenic
975169308 4:71214805-71214827 CCTCACTCCTGGGAGCTGCCAGG - Intronic
975623903 4:76323047-76323069 CACTCCTCCTGAGGGATGGCCGG + Intronic
977928986 4:102731332-102731354 TATTCCCCCTGGAGGCTGGCTGG - Intronic
979696902 4:123622783-123622805 TCTACCTCCTGGTGGCTGGAAGG + Intergenic
980698740 4:136395453-136395475 CCTTACTGCCGGGGGCTGGCGGG - Intergenic
981666813 4:147237401-147237423 CCTTGCTGCTTGGGGCTGGTAGG - Intergenic
982265876 4:153538044-153538066 CCTCCTTCCTGTGGGGTGGCTGG - Intronic
983212984 4:164977576-164977598 CCTTCCTCGCGGGGGCTCGGTGG - Exonic
985628305 5:1001576-1001598 CCTTCCTTCTCGGGGCTGATTGG + Intergenic
985787656 5:1907702-1907724 CCTGTATCCTGGAGGCTGGCTGG + Intergenic
985808468 5:2065891-2065913 CCTCCCTCCTGGGGACAGACAGG + Intergenic
985810059 5:2076097-2076119 CCATCCATCTGGGGCCTGGCAGG - Intergenic
985814925 5:2120085-2120107 ACGCACTCCTGGGGGCTGGCAGG - Intergenic
985980177 5:3456341-3456363 CCATCCTGCCAGGGGCTGGCAGG - Intergenic
985980223 5:3456552-3456574 CCTCCCTCCTCCCGGCTGGCTGG - Intergenic
989213225 5:38878337-38878359 CATTCATGCTGGGGGCTGGGGGG + Intronic
990278934 5:54229355-54229377 CCTGCCCCCTGGTGGCTGGTGGG + Intronic
990287107 5:54310918-54310940 GCTTCCTACTGGGGGTTGGCGGG - Intergenic
992282497 5:75195935-75195957 CTTTCCTCCTGGGTGCTTTCTGG + Exonic
992542551 5:77779159-77779181 ACTTGCTCCTGGGGTCTGGATGG + Intronic
993996080 5:94724785-94724807 CCTTTTTCCTGGCTGCTGGCTGG - Intronic
995014002 5:107289758-107289780 AATTCCTCCTGGGGGTTGGAGGG + Intergenic
995395097 5:111678787-111678809 CCTTCCTCCTGGAGGATTGCAGG - Intronic
996399512 5:123046377-123046399 CATTCCTCCCTGGGCCTGGCTGG - Intergenic
997351005 5:133231324-133231346 CCATCCTCCTGGTGGGAGGCTGG - Intronic
998135557 5:139672601-139672623 CCTTCCTCCTGAGGTCTGGAGGG + Intronic
998165171 5:139838613-139838635 CCTTGCTCCTGGGGACAGGAGGG - Exonic
998736228 5:145144441-145144463 CCTTCCCTCTGGTGCCTGGCAGG - Intergenic
999447327 5:151650496-151650518 CCTTCCTTCTGGTGGCTGCATGG - Intergenic
999642097 5:153682225-153682247 CCTTCCTCCTGGATGCTCACTGG - Intronic
999749306 5:154615003-154615025 CTTTCCTCCTGTGCGCTGGGTGG - Intergenic
999798205 5:155007737-155007759 TCTTCCTCCTAGGGGGTGTCAGG - Intergenic
1000999341 5:167990917-167990939 CCTTGCCTCTGGGGGCTAGCAGG - Intronic
1001512859 5:172336010-172336032 CCTTCCTCCCGGGGGTCAGCTGG - Exonic
1001587258 5:172841449-172841471 CCTTCCTCCTGGCACCTGCCAGG + Intronic
1001600564 5:172925635-172925657 CCTTCCTCCTGGGGGCCACGTGG + Intronic
1001798619 5:174523907-174523929 CATTCCTCCTGGAGGCTGTGGGG + Intergenic
1001935319 5:175699450-175699472 CCTGCATCCTGGGAACTGGCAGG - Intergenic
1003525096 6:6890750-6890772 CCTTGCTCCTGGCTTCTGGCTGG - Intergenic
1004518284 6:16339213-16339235 CCAGCCCCCTGGTGGCTGGCAGG - Intronic
1006450446 6:34103010-34103032 CCTCCCTCCTGGGTTCAGGCAGG + Intronic
1006735461 6:36269919-36269941 CCGTCCTCCTGGAGGGAGGCGGG + Intronic
1006799515 6:36751026-36751048 CCTTCCTCCTGGGTCCAGGTGGG + Intronic
1006909492 6:37554950-37554972 CCTTGCTCCTGGGGGGAAGCAGG - Intergenic
1006912903 6:37575717-37575739 CCTTGCTTCTGGGGAGTGGCTGG + Intergenic
1007368569 6:41411696-41411718 GCTGCCTGCTGGGGGCTGGCAGG + Intergenic
1007702274 6:43772067-43772089 CCTTCCCGCGGAGGGCTGGCGGG - Intronic
1010404179 6:75483868-75483890 CCTGCTTGCTGGGGGCTGGGGGG + Intronic
1011820500 6:91247642-91247664 CTTTGCTTCTGGGGGTTGGCTGG + Intergenic
1011974755 6:93282751-93282773 CCTCACTGCTCGGGGCTGGCAGG - Intronic
1012255862 6:97031089-97031111 CCTTCCTCCTGGTTTCTAGCAGG + Intronic
1013273534 6:108562126-108562148 CCTACCTCCTCGGTGCTGTCCGG - Intronic
1013289434 6:108707905-108707927 CCTTCCCTCTGAGGACTGGCGGG - Intergenic
1013617405 6:111858000-111858022 TCTCCCTGCTGGAGGCTGGCTGG - Intronic
1016708173 6:147138133-147138155 GCTTCCTTCTGAGGGCTGGGAGG - Intergenic
1017040873 6:150307781-150307803 CCTGCCTCCTGGGAGCTGGGGGG + Intergenic
1017658404 6:156651354-156651376 CCTTACTCCTGAGGCCTGCCAGG - Intergenic
1017753954 6:157514012-157514034 CCTTTCTCTCGGAGGCTGGCTGG + Intronic
1019274213 7:167322-167344 CCTTCCTCCCGAGACCTGGCCGG + Intergenic
1019279163 7:191874-191896 CCTTCCTGCTTGGGGCCGACGGG - Intergenic
1019423997 7:964621-964643 CCTTGCTCCTGAGGCCTGGGTGG + Intronic
1019483598 7:1277347-1277369 CCTTCCTACTGGGGGGGGGGAGG - Intergenic
1019562620 7:1666033-1666055 TCTTCCTCCTCCGGGCTCGCTGG - Intergenic
1019660052 7:2219250-2219272 CCTCTCTCCTGGTGGCTGGGTGG - Intronic
1019744511 7:2692175-2692197 TCTTCCTCCAGGAGCCTGGCTGG - Intronic
1020408868 7:7868022-7868044 GCTTCCTCCTCGCTGCTGGCAGG - Intronic
1022019592 7:26385495-26385517 CTTTCCTCCTCTGGGATGGCTGG + Intergenic
1022629525 7:32071601-32071623 GGTCCCTCCTGGGTGCTGGCTGG + Intronic
1023302011 7:38783040-38783062 TCTGCCTCCTGGGTGCTCGCGGG - Intronic
1023609256 7:41957273-41957295 CCGGCCTCCTGGGGGCTGGGAGG + Intergenic
1023732210 7:43203016-43203038 CATTTCACCTGGGGGCAGGCGGG - Intronic
1023872302 7:44269622-44269644 TGTTTCTCCTGGTGGCTGGCGGG - Intronic
1025990304 7:66492397-66492419 CCCTCTTCCTGGGGACAGGCGGG - Intergenic
1026366427 7:69653149-69653171 CCTTCTTCATGTGGGCTTGCTGG + Intronic
1026955758 7:74375718-74375740 ACTCCCTCCTGAGTGCTGGCTGG - Intronic
1029115363 7:98233737-98233759 CCTCAGGCCTGGGGGCTGGCAGG - Exonic
1029128001 7:98308469-98308491 CCTTCCTCCTGGGAGCCTGGCGG - Intronic
1029226559 7:99033180-99033202 CCCTGCTCCTGGGGGCTGTGTGG - Intronic
1029334100 7:99885852-99885874 CCTCCCACCTGGGGGTTGGGAGG + Intronic
1029693544 7:102198491-102198513 GCTTTGTTCTGGGGGCTGGCGGG + Intronic
1029694698 7:102204999-102205021 CATTCCTCCTGGGGAGGGGCGGG - Intronic
1029977628 7:104849440-104849462 CCTGGCTCCTGGGGGCTGGGTGG + Intronic
1032801105 7:135317830-135317852 CCTCCCTCCTGAGGGCTGCCTGG - Intergenic
1032874581 7:136023882-136023904 CCTTCCTCTTAGGGTCTGGCTGG + Intergenic
1033424475 7:141231602-141231624 CCTGCTCCCTGGGGGCTGGAAGG + Intronic
1034477425 7:151293910-151293932 CCTATTTCCAGGGGGCTGGCTGG + Intergenic
1037781380 8:21871584-21871606 CCAGCCTCCTCGGGGCTGCCTGG - Intergenic
1037813095 8:22098170-22098192 CCGTCCAGCTGGGGCCTGGCAGG - Exonic
1038332028 8:26616669-26616691 CCTTGCTTCAAGGGGCTGGCGGG + Intronic
1038425320 8:27460814-27460836 CAGACCTCCTGGGGGCCGGCTGG + Exonic
1039801025 8:40954547-40954569 CCTTCCCCCAGGGAGCTGCCAGG + Intergenic
1040878506 8:52177523-52177545 CTTTCCTCCTAGGGGGTGGGGGG + Intronic
1041373887 8:57193212-57193234 CCATGCTCCTGGTGGCGGGCAGG - Intergenic
1042765273 8:72314397-72314419 CCTGCCACCTGGAGGCAGGCTGG + Intergenic
1045007997 8:97932677-97932699 CCTTCCTCCTCCGGGAGGGCAGG + Intronic
1047097426 8:121640058-121640080 CCTGCCTCCGGGCGGCCGGCGGG + Intronic
1047327328 8:123852323-123852345 CCTGCCTCCAGGTAGCTGGCTGG + Intronic
1047753027 8:127896926-127896948 TCCTCCACCTGGGGGCTGGGCGG + Intergenic
1048015266 8:130491312-130491334 CCTGCCTTGTGGGGGGTGGCGGG + Intergenic
1048457557 8:134591831-134591853 GCTTCCTCCTGAGGGCTGTGGGG - Intronic
1049033920 8:140060187-140060209 CCTTCACCCTGGGGCCAGGCCGG + Intronic
1049189151 8:141277009-141277031 CCTTGCTGCTGGGAGCTTGCTGG - Intronic
1049376658 8:142292566-142292588 ACAGCCTCCTGGGGTCTGGCCGG - Intronic
1049402506 8:142435872-142435894 CCTGCTGCCTGGGGGCTGGTGGG - Intergenic
1049423044 8:142525261-142525283 CCTTCCTCCAGGCGGGAGGCAGG + Intronic
1049515479 8:143052484-143052506 CCCTCCTGCTGAGGACTGGCAGG + Intronic
1049685573 8:143938007-143938029 CCTTCTCCCTGGGGGCAGGCTGG - Intronic
1050695562 9:8275784-8275806 ACTTCTTCCTGGGGGCTTTCAGG + Intergenic
1051937203 9:22457624-22457646 CCTGCCACCAGGTGGCTGGCTGG + Intergenic
1053131712 9:35619169-35619191 CCTTTTTCCTTGGGGCTGGGTGG - Intronic
1053188375 9:36037613-36037635 CCTGTCCCCCGGGGGCTGGCAGG + Intronic
1053214733 9:36260987-36261009 CCTTCCTACTGGAGGCTGCCAGG + Intronic
1053455963 9:38233300-38233322 CCTGCGCCCTGGAGGCTGGCAGG + Intergenic
1053788745 9:41670996-41671018 TCTTCCTGCTGGGGCCTTGCAGG - Intergenic
1053885035 9:42637262-42637284 CCCTCCTCCTGAGGCCGGGCAGG - Intergenic
1054156394 9:61643772-61643794 TCTTCCTGCTGGGGCCTTGCAGG + Intergenic
1054177026 9:61882335-61882357 TCTTCCTGCTGGGGTCTTGCAGG - Intergenic
1054224056 9:62444713-62444735 CCCTCCTCCTGAGGCCGGGCAGG - Intergenic
1054476167 9:65574782-65574804 TCTTCCTGCTGGGGCCTTGCAGG + Intergenic
1054660508 9:67698471-67698493 TCTTCCTGCTGGGGTCTTGCAGG + Intergenic
1055461953 9:76527950-76527972 TCTTCCTTCTGGGGGGTTGCTGG + Intergenic
1056101149 9:83301694-83301716 GCTTCCTCCTGGGGCCTGGAAGG - Intronic
1056220579 9:84447302-84447324 GGTCACTCCTGGGGGCTGGCTGG + Intergenic
1056289699 9:85130259-85130281 CCTTCCTCCAGGAGGCTGTTGGG - Intergenic
1057203554 9:93156948-93156970 CCTTCCTCCTTCCTGCTGGCTGG - Intergenic
1057551862 9:96057060-96057082 CCTGCCTCCTGCAGGCTGTCAGG + Intergenic
1059472046 9:114512767-114512789 CCTTTTTCCTGGCGGTTGGCTGG + Intergenic
1060477472 9:123997310-123997332 TCCTCCTCCTGGGGCCAGGCAGG - Intergenic
1060729402 9:126027652-126027674 CCTGGCACCTGGGGCCTGGCTGG + Intergenic
1061256292 9:129455556-129455578 CCCTCCTCCTTGGGGCTCCCTGG - Intergenic
1061425691 9:130496911-130496933 CCTCCCTCCTGGAGGCTGGTTGG + Intronic
1061822311 9:133235444-133235466 CCTTACTCCTGGGGTCTTCCAGG - Intergenic
1061870751 9:133519090-133519112 GATGCCTCCTGGGGGCTGGGGGG - Intronic
1061901972 9:133677685-133677707 CCTTCCTGCTTGGCCCTGGCTGG + Intronic
1061906814 9:133703257-133703279 CCAGCCTCCTGGGCCCTGGCTGG - Intronic
1061918909 9:133771608-133771630 GCTTCCAGCTGGGGCCTGGCCGG - Intronic
1062038319 9:134392562-134392584 GCTTCCTCCTTGGCGCTGGCTGG + Intronic
1062218030 9:135399641-135399663 CCTTGCTCCTGGTGGCTTCCTGG - Intergenic
1062442556 9:136577437-136577459 CCTTCTTCCTGGAGCCTGGATGG - Intergenic
1062519608 9:136952182-136952204 CCTCCCTCCTCAGGACTGGCAGG - Intronic
1185457283 X:317546-317568 ATTTCCTCCTGGGGGGTGGGGGG + Intronic
1185703431 X:2248731-2248753 CCTTCCTTCTGGGGGTGGGGTGG - Intronic
1188170548 X:26918721-26918743 CCATCCTGATGGGGGCAGGCAGG - Intergenic
1188205781 X:27355967-27355989 CTCTCCTCCTTGGGGGTGGCGGG - Intergenic
1189342813 X:40217510-40217532 CCTTCCTCCTTCATGCTGGCTGG - Intergenic
1189665421 X:43350088-43350110 TCTTCCTACTGGGACCTGGCAGG - Intergenic
1191252319 X:58265513-58265535 CCTTCCCCCTGGGGGCGTGCTGG + Intergenic
1192590438 X:72355266-72355288 CTTTCCTCTTCGGGGCTGGAGGG - Intronic
1194670722 X:96729090-96729112 CCTCCCTACTGGGGGCTTCCAGG + Intronic
1195909615 X:109876104-109876126 CCTCACTGCTGGGGGCTTGCGGG + Intergenic
1197708993 X:129653177-129653199 CCTGCCTCCAGGTAGCTGGCCGG - Intronic
1199511252 X:148625569-148625591 CCTTCCTCCTCTGGACTGGATGG + Intronic
1200083466 X:153591197-153591219 GGTGCCTCCTGTGGGCTGGCGGG - Intronic