ID: 969367050

View in Genome Browser
Species Human (GRCh38)
Location 4:6702009-6702031
Sequence TCAGAATTGTTGGCCAGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969367050_969367053 15 Left 969367050 4:6702009-6702031 CCACGCCTGGCCAACAATTCTGA No data
Right 969367053 4:6702047-6702069 GTACAGAAATAACAAACTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969367050 Original CRISPR TCAGAATTGTTGGCCAGGCG TGG (reversed) Intergenic
No off target data available for this crispr