ID: 969367053

View in Genome Browser
Species Human (GRCh38)
Location 4:6702047-6702069
Sequence GTACAGAAATAACAAACTTA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969367049_969367053 18 Left 969367049 4:6702006-6702028 CCACCACGCCTGGCCAACAATTC No data
Right 969367053 4:6702047-6702069 GTACAGAAATAACAAACTTACGG No data
969367051_969367053 10 Left 969367051 4:6702014-6702036 CCTGGCCAACAATTCTGAATTAA No data
Right 969367053 4:6702047-6702069 GTACAGAAATAACAAACTTACGG No data
969367050_969367053 15 Left 969367050 4:6702009-6702031 CCACGCCTGGCCAACAATTCTGA No data
Right 969367053 4:6702047-6702069 GTACAGAAATAACAAACTTACGG No data
969367052_969367053 5 Left 969367052 4:6702019-6702041 CCAACAATTCTGAATTAAAATTT No data
Right 969367053 4:6702047-6702069 GTACAGAAATAACAAACTTACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969367053 Original CRISPR GTACAGAAATAACAAACTTA CGG Intergenic
No off target data available for this crispr