ID: 969371041

View in Genome Browser
Species Human (GRCh38)
Location 4:6731836-6731858
Sequence CAGGGTACCCCCTCTGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969371041_969371043 -8 Left 969371041 4:6731836-6731858 CCTTCTGCAGAGGGGGTACCCTG No data
Right 969371043 4:6731851-6731873 GTACCCTGCAGACAGAGTCAGGG No data
969371041_969371047 9 Left 969371041 4:6731836-6731858 CCTTCTGCAGAGGGGGTACCCTG No data
Right 969371047 4:6731868-6731890 TCAGGGAGAGATCAAGAGACGGG No data
969371041_969371053 29 Left 969371041 4:6731836-6731858 CCTTCTGCAGAGGGGGTACCCTG No data
Right 969371053 4:6731888-6731910 GGGGATGGCCAGGAGGGCACAGG No data
969371041_969371048 10 Left 969371041 4:6731836-6731858 CCTTCTGCAGAGGGGGTACCCTG No data
Right 969371048 4:6731869-6731891 CAGGGAGAGATCAAGAGACGGGG No data
969371041_969371054 30 Left 969371041 4:6731836-6731858 CCTTCTGCAGAGGGGGTACCCTG No data
Right 969371054 4:6731889-6731911 GGGATGGCCAGGAGGGCACAGGG No data
969371041_969371046 8 Left 969371041 4:6731836-6731858 CCTTCTGCAGAGGGGGTACCCTG No data
Right 969371046 4:6731867-6731889 GTCAGGGAGAGATCAAGAGACGG No data
969371041_969371050 19 Left 969371041 4:6731836-6731858 CCTTCTGCAGAGGGGGTACCCTG No data
Right 969371050 4:6731878-6731900 ATCAAGAGACGGGGATGGCCAGG No data
969371041_969371052 23 Left 969371041 4:6731836-6731858 CCTTCTGCAGAGGGGGTACCCTG No data
Right 969371052 4:6731882-6731904 AGAGACGGGGATGGCCAGGAGGG No data
969371041_969371042 -9 Left 969371041 4:6731836-6731858 CCTTCTGCAGAGGGGGTACCCTG No data
Right 969371042 4:6731850-6731872 GGTACCCTGCAGACAGAGTCAGG No data
969371041_969371049 14 Left 969371041 4:6731836-6731858 CCTTCTGCAGAGGGGGTACCCTG No data
Right 969371049 4:6731873-6731895 GAGAGATCAAGAGACGGGGATGG No data
969371041_969371051 22 Left 969371041 4:6731836-6731858 CCTTCTGCAGAGGGGGTACCCTG No data
Right 969371051 4:6731881-6731903 AAGAGACGGGGATGGCCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969371041 Original CRISPR CAGGGTACCCCCTCTGCAGA AGG (reversed) Intergenic
No off target data available for this crispr