ID: 969372888

View in Genome Browser
Species Human (GRCh38)
Location 4:6745421-6745443
Sequence CACAAAAATTAGCTGGGCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969372885_969372888 -7 Left 969372885 4:6745405-6745427 CCGTCTCTACTAAAAACACAAAA 0: 7651
1: 202013
2: 142183
3: 69982
4: 56505
Right 969372888 4:6745421-6745443 CACAAAAATTAGCTGGGCCATGG No data
969372882_969372888 -4 Left 969372882 4:6745402-6745424 CCCCCGTCTCTACTAAAAACACA 0: 79
1: 2038
2: 4355
3: 3788
4: 4063
Right 969372888 4:6745421-6745443 CACAAAAATTAGCTGGGCCATGG No data
969372884_969372888 -6 Left 969372884 4:6745404-6745426 CCCGTCTCTACTAAAAACACAAA 0: 6301
1: 173952
2: 213474
3: 129693
4: 84145
Right 969372888 4:6745421-6745443 CACAAAAATTAGCTGGGCCATGG No data
969372881_969372888 10 Left 969372881 4:6745388-6745410 CCAACATGGCGAAACCCCCGTCT 0: 52
1: 1195
2: 2995
3: 3590
4: 6824
Right 969372888 4:6745421-6745443 CACAAAAATTAGCTGGGCCATGG No data
969372883_969372888 -5 Left 969372883 4:6745403-6745425 CCCCGTCTCTACTAAAAACACAA 0: 3518
1: 107828
2: 222961
3: 155562
4: 92841
Right 969372888 4:6745421-6745443 CACAAAAATTAGCTGGGCCATGG No data
969372880_969372888 19 Left 969372880 4:6745379-6745401 CCAGTCTGGCCAACATGGCGAAA 0: 465
1: 16923
2: 131821
3: 203251
4: 163225
Right 969372888 4:6745421-6745443 CACAAAAATTAGCTGGGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969372888 Original CRISPR CACAAAAATTAGCTGGGCCA TGG Intergenic
No off target data available for this crispr