ID: 969377459

View in Genome Browser
Species Human (GRCh38)
Location 4:6772183-6772205
Sequence CTGGTGCTGGGGCCTGTGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969377459_969377467 8 Left 969377459 4:6772183-6772205 CCCGTCACAGGCCCCAGCACCAG No data
Right 969377467 4:6772214-6772236 CTCAGCCCCTCCAAAAATCTTGG No data
969377459_969377468 12 Left 969377459 4:6772183-6772205 CCCGTCACAGGCCCCAGCACCAG No data
Right 969377468 4:6772218-6772240 GCCCCTCCAAAAATCTTGGCAGG No data
969377459_969377473 28 Left 969377459 4:6772183-6772205 CCCGTCACAGGCCCCAGCACCAG No data
Right 969377473 4:6772234-6772256 TGGCAGGTCATTCTCTAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969377459 Original CRISPR CTGGTGCTGGGGCCTGTGAC GGG (reversed) Intergenic
No off target data available for this crispr