ID: 969385409

View in Genome Browser
Species Human (GRCh38)
Location 4:6843307-6843329
Sequence TAGTCCAGGAAGGAAGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 181}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969385409_969385413 9 Left 969385409 4:6843307-6843329 CCAGAAACTTCCTTCCTGGACTA 0: 1
1: 0
2: 0
3: 16
4: 181
Right 969385413 4:6843339-6843361 TGGTCTAGTGTTGCGATCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969385409 Original CRISPR TAGTCCAGGAAGGAAGTTTC TGG (reversed) Intronic
902078946 1:13808014-13808036 TACTCTAGGAGGGAAATTTCTGG - Intronic
902244205 1:15108707-15108729 TGGTGCAGGAAGGAAGGTTGGGG - Intronic
905714123 1:40133393-40133415 TAGGCCATGAAGCAAGTGTCGGG - Intergenic
906836898 1:49093252-49093274 CAGTCCAGGCAGTAAGTCTCTGG - Intronic
910471853 1:87562031-87562053 TAGTTCAGGAACTCAGTTTCAGG - Intergenic
911581767 1:99642641-99642663 GAGTTCAGGAAAGAAGTCTCAGG - Intergenic
913353255 1:117886680-117886702 TATTCTTGGAATGAAGTTTCTGG - Intronic
914791312 1:150879696-150879718 TAAACCAGACAGGAAGTTTCTGG - Intergenic
915241151 1:154522894-154522916 TGGTCCAGGAAGTAAGTGACTGG - Intronic
915510127 1:156382353-156382375 AGGACCAGGAAGGCAGTTTCTGG - Intronic
916581365 1:166112415-166112437 TAGTCTAGGAGTGAAGTCTCTGG + Intronic
917456057 1:175186987-175187009 TTGGGCAGGAGGGAAGTTTCAGG + Intronic
919158163 1:193793703-193793725 TATTCCTGGAAGGCAGATTCTGG + Intergenic
919395504 1:197042478-197042500 TAGTCAAGGAAGTAAGGTTCTGG + Intronic
920074593 1:203327200-203327222 CTGTCCAGCAAGGAAGCTTCGGG + Intergenic
921344430 1:214167621-214167643 TTTTCCAGAAAGGAAATTTCAGG + Intergenic
921731709 1:218586346-218586368 GTGGCCAGGAAGGAAGTTCCTGG - Intergenic
921762318 1:218930338-218930360 AAGTACAGGAAGGCAGATTCTGG + Intergenic
922349408 1:224723188-224723210 CAGTCCACGAAGGCAGTGTCTGG + Intronic
1063319775 10:5041951-5041973 AAATCCAGGAAGTGAGTTTCAGG + Intronic
1063789504 10:9425735-9425757 TTGTCCAGGGAGGGAGTTGCAGG + Intergenic
1066256612 10:33685522-33685544 TAGTCAAGGTAGGAAGAATCAGG + Intergenic
1067300522 10:45004007-45004029 TGGTACAGGAAGGAAGTCTGTGG + Exonic
1067523370 10:47024445-47024467 TAGTTCAAGAAGGAAGTTAAAGG + Intergenic
1067530801 10:47070959-47070981 AAATCCAAGAATGAAGTTTCCGG + Intergenic
1067962160 10:50866122-50866144 CATTCCAGGATGGAAATTTCAGG - Intronic
1071823727 10:89303516-89303538 GAGCCCAGGAAGCAAGTGTCTGG + Intronic
1071903573 10:90147292-90147314 TACCACAGGAAAGAAGTTTCAGG - Intergenic
1074432771 10:113408011-113408033 AAGGCCAGGAAAGAAGCTTCTGG - Intergenic
1076840060 10:133041420-133041442 GAGTCCAGGAAGGCAGGGTCCGG + Intergenic
1077482980 11:2825232-2825254 TAGCCCAGGAAGCCAGTTCCTGG + Intronic
1077902732 11:6502817-6502839 CTATCCAGGAAGGAAGTCTCAGG - Exonic
1078159393 11:8827893-8827915 TAGTAGAGGAAGGAAGTTTGTGG - Intronic
1078575247 11:12496558-12496580 TGCTCCTGGGAGGAAGTTTCAGG - Exonic
1078729952 11:13964642-13964664 TACTCCACGAAGAAAGATTCTGG + Intronic
1083925510 11:65803768-65803790 AAGTGCAGGAAGGAAGATGCTGG + Intergenic
1086137860 11:83460976-83460998 TAATCCAGGAAGAAAGTTCTTGG + Intronic
1087050305 11:93880225-93880247 TAGCCCAGGAATGAAATTCCCGG - Intergenic
1087834485 11:102858841-102858863 TAGTCCAGGAAGGAAGAAAACGG - Intergenic
1088329689 11:108638260-108638282 CAACCCAGGAAGAAAGTTTCAGG - Intergenic
1091993969 12:4978404-4978426 TAGTCAGGGAAGGAAGCTTTTGG + Intergenic
1094392588 12:29967982-29968004 TATTCTATGAAGGAGGTTTCTGG + Intergenic
1095691430 12:45093770-45093792 AATTGCAGGAAGTAAGTTTCTGG + Intergenic
1096654095 12:53077853-53077875 TATTCCAAGATGGAAATTTCTGG + Intronic
1096713095 12:53472217-53472239 TAGGACAGCAAGGCAGTTTCTGG + Intronic
1098148935 12:67526604-67526626 TAGTCCAGGGAAGAAGTTCCAGG + Intergenic
1099396904 12:82151381-82151403 TAGGCCAGGAAGGAAGTCCTGGG - Intergenic
1101503200 12:105323304-105323326 TAGTGCAGCAAGGAAATTGCAGG + Intronic
1101854937 12:108434361-108434383 TAGTTCTGGAAGGTAGTTCCAGG - Intergenic
1103018817 12:117517159-117517181 TAGTCCAAGATGCAAGTTTTTGG - Intronic
1103978778 12:124722139-124722161 TAGACCAGGAGGGAATTTCCAGG - Intergenic
1106193372 13:27473327-27473349 TTGGGCAGGAAGGAAGTTTTGGG + Intergenic
1106528533 13:30565890-30565912 TGGTCCTGGAAAGAATTTTCTGG - Intronic
1107732709 13:43364864-43364886 GAGTCCAGGAAGGGAATTGCTGG + Intronic
1110693689 13:78461784-78461806 TAGTCAAGGCAGGAATTTTAGGG + Intergenic
1110731455 13:78883276-78883298 TATTCCAGGAGGGACATTTCCGG + Intergenic
1111651859 13:91101086-91101108 TTATCCAGGATGGCAGTTTCAGG + Intergenic
1113618373 13:111696725-111696747 TAGTCAAGGAAGGCTGTTTCTGG + Intergenic
1113623905 13:111781986-111782008 TAGTCAAGGAAGGCTGTTTCTGG + Intergenic
1114166023 14:20219184-20219206 TACTAAAGGAAGCAAGTTTCTGG + Intergenic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1120047924 14:79829253-79829275 TTCTCCAGAAAGGAAATTTCAGG + Intronic
1121226964 14:92328179-92328201 TAGGCCAGGGAGGAAGATGCTGG - Intronic
1122692335 14:103537324-103537346 TGGGCCAGGCAGGGAGTTTCTGG - Intergenic
1127285949 15:57533881-57533903 AAGTCCAGGGAGGAAGTTAAGGG + Intronic
1128171663 15:65518627-65518649 TAGACCAGGAAAGAAATTGCAGG - Intergenic
1130622853 15:85482033-85482055 TATTACAGGAAGGCAGTTTTTGG - Intronic
1130632455 15:85582512-85582534 TAGGGGAGGAAGGGAGTTTCAGG - Intronic
1131913332 15:97233348-97233370 TTCTCCAAGAAGGAAATTTCTGG - Intergenic
1133718906 16:8475774-8475796 GAGTCCAGGAAGGTAGGTACTGG - Intergenic
1133769012 16:8856972-8856994 TGCTCCAGGAAGGAAGTTTGGGG - Intronic
1135824874 16:25717886-25717908 TAGTCCAGGAAAAACATTTCTGG + Intronic
1136459952 16:30403916-30403938 TAGTCTAGTAAAGAAGTTTTTGG - Intergenic
1137888114 16:52128263-52128285 TAGTTGAGGAAGGCTGTTTCAGG - Intergenic
1138031874 16:53565525-53565547 TGGTCCAGGAGGGAAGTGTTTGG + Intergenic
1138203404 16:55106675-55106697 GAGTCCAGCATGGCAGTTTCTGG - Intergenic
1138240741 16:55425190-55425212 CAGCACAGGAAGGAAGTTCCAGG - Intronic
1139189697 16:64847811-64847833 TAGTCCTGAAAGGAAGTTCATGG - Intergenic
1139968679 16:70760308-70760330 TATCCTAGAAAGGAAGTTTCAGG + Intronic
1140993020 16:80232566-80232588 TATTCCAGGCAGCAAGTTCCGGG - Intergenic
1146690428 17:34871325-34871347 TAGTACAGAGAGGGAGTTTCAGG - Intergenic
1147835715 17:43330119-43330141 TATTCAAGGAAGGAAGTTTGAGG - Intergenic
1147837418 17:43344337-43344359 TATTCAAGGGAGGAAGTTTGAGG - Intergenic
1150936251 17:69638833-69638855 TAATACAGGAAGGAAGTTCCAGG - Intergenic
1150958572 17:69889512-69889534 TAGTACAAGAAAGAAGTTTCTGG + Intergenic
1155319039 18:24600301-24600323 TAGTTTATAAAGGAAGTTTCAGG + Intergenic
1157200710 18:45657051-45657073 CAGTCCAGATAGGAAGTCTCAGG + Intronic
1157443149 18:47725335-47725357 TAGTCCAGGCTCGTAGTTTCTGG - Intergenic
1159935753 18:74366081-74366103 AAGAGCAGGAAGGAAGTTCCAGG - Intergenic
1161646885 19:5458574-5458596 TAGTGCAGGAAGGATATTCCAGG + Intergenic
1162330679 19:10027432-10027454 TTGTCCAGGTAGGAGGTGTCAGG - Intergenic
1164604983 19:29591364-29591386 GAGTTGAGGAAGGAAATTTCTGG - Intergenic
1164873677 19:31667996-31668018 TACTCCTGGAGGGAAGTTTCTGG - Intergenic
925355589 2:3238948-3238970 TAGTCCTGGAAGGAAGCCTCTGG - Intronic
925857307 2:8142184-8142206 TTGTCCAGGAAGGTGCTTTCAGG + Intergenic
926334277 2:11851523-11851545 TCCTCCAGGCAGAAAGTTTCAGG + Intergenic
929335413 2:40737994-40738016 TATTCCAGGAAGGAAGAATGAGG + Intergenic
929581702 2:43085530-43085552 GAGCCCAGGAAGGAACTTGCAGG - Intergenic
929646622 2:43635138-43635160 AAGTCCAGTAAGCAAGTATCAGG - Intergenic
931592315 2:63898510-63898532 TAGTATAGGATGGAAGTTTGAGG + Intronic
933666505 2:84969651-84969673 AAGTCCAGGAAGTAGGTTTTGGG - Intergenic
933718067 2:85376619-85376641 TAGGCCAGGATGGAAGTCTAGGG + Intronic
936527832 2:113253835-113253857 TAGTCAAGGGAGGAATTTTGGGG + Intronic
936836105 2:116711141-116711163 AAGACCGGGAAGGCAGTTTCAGG - Intergenic
937103925 2:119293103-119293125 TAGGCCAGCAGGGATGTTTCTGG - Intergenic
937192142 2:120112686-120112708 TAGTCCAGGAATGATGAATCAGG + Intronic
937668054 2:124509288-124509310 TATTCTAGGGATGAAGTTTCAGG + Intronic
941549579 2:166898141-166898163 CAGCCCAGGTAGGAAATTTCAGG + Intronic
943615410 2:190086639-190086661 TATTTCAGGAATGAAGGTTCAGG - Intronic
944300399 2:198117872-198117894 GAGAACAGGAAGGAAGTTGCTGG - Intronic
947260372 2:228215109-228215131 TATTCCAGTGAGGAAATTTCTGG + Intergenic
947714461 2:232332749-232332771 CAGTCAAGGGAGGCAGTTTCCGG - Intronic
1168960549 20:1866538-1866560 TGGTCTAGGAAGGTGGTTTCAGG - Intergenic
1169460498 20:5790229-5790251 TAGGGGAGGAAGGAAGTTTCAGG - Intronic
1169474109 20:5915586-5915608 TTGTCAAGGAAGTAAGTTTTGGG + Intronic
1169753041 20:9014952-9014974 GAGAACAGGAGGGAAGTTTCTGG - Intergenic
1171063865 20:21994073-21994095 TAGGTTAGGAAGCAAGTTTCTGG - Intergenic
1172876963 20:38170223-38170245 TAGAGCAAGAAGGAAGTCTCTGG - Intergenic
1178214436 21:30578219-30578241 GAGTCCAGGAAGGAACTTGGTGG + Intergenic
1178685760 21:34709457-34709479 TGTTTCTGGAAGGAAGTTTCTGG + Exonic
1178918689 21:36724009-36724031 TCCTCCTGGAAGAAAGTTTCTGG - Intronic
1179289961 21:40009732-40009754 TAAGCCAGGAAGGAATCTTCAGG - Intergenic
1179711191 21:43264121-43264143 TTGTCCTTGAAGGAAGTTCCTGG - Intergenic
1182468452 22:30532437-30532459 GAGCCCAGGAAGGCAGATTCTGG + Intronic
1185068311 22:48642949-48642971 TAGTCCCAGAAGGAGGTTTTGGG + Intronic
952188126 3:30992907-30992929 TAGTGCAGGAAGGAAATGTGGGG - Intergenic
953642387 3:44721047-44721069 TTTTCCAGGAAGGAGGTTTTGGG + Exonic
956994426 3:74808035-74808057 AAGTTCAGGAAAGAAGTGTCAGG - Intergenic
957118755 3:76061631-76061653 TTCTCCAGGAGGGAAATTTCTGG - Intronic
960703332 3:120458532-120458554 TGGGCCAGGAAGGAACTTACTGG + Intergenic
965110634 3:164416709-164416731 GAGTCCAGGAAGGCTGTCTCTGG + Intergenic
965916722 3:173857396-173857418 TAGACCTGGGAGGGAGTTTCAGG - Intronic
967487495 3:190050826-190050848 TAGTATAGGTAGTAAGTTTCAGG - Intronic
967669214 3:192212377-192212399 TAGTTCAGGCAGTTAGTTTCAGG + Intronic
969385409 4:6843307-6843329 TAGTCCAGGAAGGAAGTTTCTGG - Intronic
970978264 4:22066833-22066855 TGGTCTAGGAAGGCTGTTTCTGG - Intergenic
973116745 4:46470187-46470209 GAGACCAGAAAAGAAGTTTCTGG + Intronic
978930886 4:114310378-114310400 TAGACCAGTAAGGAAGTCACTGG - Intergenic
980552143 4:134352359-134352381 TAGATCAGTGAGGAAGTTTCAGG - Intergenic
981706610 4:147665745-147665767 TAGACAAGGAAGGAAGTTTATGG - Intronic
982440898 4:155434538-155434560 GAGCCCAGGAAGGAAACTTCTGG - Intergenic
983138364 4:164115086-164115108 CAGACAAGGAAGGAAGTTTGAGG + Intronic
983867055 4:172780082-172780104 TTGTCATGGAAGGAAGGTTCAGG + Intronic
987886284 5:23817232-23817254 TAATTTAGGAAGCAAGTTTCTGG + Intergenic
988701459 5:33679265-33679287 TAATACAGGAAGGAAATTCCAGG - Intronic
990859465 5:60310742-60310764 TATTCCATAAAGGAAGATTCAGG - Intronic
992655802 5:78908462-78908484 GAGCACAGGAAGGCAGTTTCAGG + Intronic
997639905 5:135442345-135442367 TGGGGGAGGAAGGAAGTTTCTGG + Intergenic
999046800 5:148478415-148478437 CATTCTAGGAAGGAAGTTTCAGG + Intronic
999640386 5:153666449-153666471 TATACCAAGAAGGAAGTATCAGG - Intronic
1000343907 5:160298387-160298409 AAGTCCAGGAAGGCAATTTGCGG + Intronic
1004308390 6:14521820-14521842 AAGCCCAGGAGGGAAGTCTCAGG + Intergenic
1004799042 6:19125218-19125240 TCTTCCAGGAAGAAAGTATCTGG + Intergenic
1010619226 6:78053970-78053992 TGGTTCAGGATGGAAGTTACTGG + Intergenic
1013627423 6:111951619-111951641 CAGTGCAGGTAGGAAGTTGCCGG + Intergenic
1013718791 6:112997525-112997547 TAGTGCAGAAAAGAAATTTCAGG - Intergenic
1014257121 6:119172232-119172254 TAGACCAGGAAGGCCTTTTCAGG + Intergenic
1014708670 6:124780207-124780229 AAGGCCAAGAAGGAACTTTCGGG + Intronic
1022070702 7:26911001-26911023 TAGAACAGAAAGGAAATTTCAGG + Intronic
1022360553 7:29652631-29652653 AAGTTCAGGAATGAAGGTTCAGG + Intergenic
1022476569 7:30714757-30714779 TAGTCCAGGAGGGATGTTCATGG + Intronic
1024047082 7:45592279-45592301 TAGCCCAGGAACGAGGTCTCAGG - Intronic
1024426267 7:49229898-49229920 TAGTCCCGGATGCAAGGTTCTGG + Intergenic
1026430998 7:70347179-70347201 TAATACAAGAAGTAAGTTTCAGG - Intronic
1027133551 7:75608660-75608682 AAGTCCAGAGAGGCAGTTTCTGG + Intronic
1029854502 7:103501576-103501598 AAGTACATGAAGGAACTTTCTGG + Intronic
1032648776 7:133855267-133855289 TATTCCAGGAAGGTTGGTTCAGG - Intronic
1034692693 7:153026802-153026824 CAGTGCAGGAAAGAAGGTTCCGG + Intergenic
1035360794 7:158313192-158313214 TAGTCCAGGATGCAGGCTTCTGG - Intronic
1036550403 8:9810590-9810612 TAGCACAGGAAGGAAGGTTGGGG - Intergenic
1036984804 8:13516945-13516967 AAGTCAAGGAAGGCAGTTTATGG - Intergenic
1037838102 8:22226423-22226445 TTTTCCAGGAAGAAAGGTTCTGG + Intronic
1038382574 8:27110590-27110612 TAGTGCAGGAAAGGAGTTCCAGG + Intergenic
1039711967 8:40064024-40064046 AATTCCAAGAAAGAAGTTTCTGG + Intergenic
1039981531 8:42412922-42412944 TAGGCCCGGGAGGAAGTTCCAGG - Intergenic
1040386182 8:46916424-46916446 GAGCCCAGGATGGAAGATTCTGG + Intergenic
1041125028 8:54628148-54628170 TTGTTCACTAAGGAAGTTTCAGG + Exonic
1042209021 8:66359227-66359249 TGGTGCATGAAGGAACTTTCTGG + Intergenic
1044494842 8:92864625-92864647 AAGTCAAGTAAGGAATTTTCTGG - Intergenic
1045203037 8:100006786-100006808 TACTTCCAGAAGGAAGTTTCTGG + Intronic
1046518413 8:115293038-115293060 TAGTCCAGAAAAGAAGTCACTGG + Intergenic
1047210989 8:122840129-122840151 TAGTGCAGGAAGCACGTCTCAGG - Intronic
1049567100 8:143346367-143346389 TGGTCCAAGAACTAAGTTTCTGG - Intronic
1053144913 9:35705805-35705827 TAATCCACGAAGGAACCTTCTGG + Exonic
1055175772 9:73316025-73316047 AAGGACAGGAAGGAACTTTCAGG - Intergenic
1056934492 9:90905504-90905526 TATTCAAGGAAGGAAGTTTGAGG + Intergenic
1057491946 9:95527219-95527241 TATTCATGGAAGGAAGTTTAGGG - Intergenic
1057703826 9:97383988-97384010 AAGCCCAAGAAGGAAGTTACAGG + Intergenic
1186628201 X:11317837-11317859 TAGAGCAGGAAGGAATTTTAGGG + Intronic
1187492532 X:19765307-19765329 TAGCCCAGTAAGACAGTTTCTGG - Intronic
1189783974 X:44542904-44542926 TAGGCCAGGATGGAAGTCTATGG + Exonic
1189852423 X:45190977-45190999 CCGGCCAGGAAGGAATTTTCTGG - Intronic
1195429188 X:104769116-104769138 TAGTCCTGGAAGGAATGTTAGGG - Intronic
1197179498 X:123518944-123518966 TAATACATGAAGGAAGTTTCTGG - Intergenic
1200975810 Y:9210999-9211021 TAGTACAGGAAGGAATGTTTGGG + Intergenic
1201050416 Y:9927234-9927256 TACTCCAGGAGGAAAGTTGCAGG + Intergenic
1201058546 Y:10019873-10019895 TAAGCCAGGAGGAAAGTTTCGGG + Intergenic
1202135351 Y:21655533-21655555 TAGTACAGGAAGGAATGTTTGGG - Intergenic