ID: 969386397

View in Genome Browser
Species Human (GRCh38)
Location 4:6852219-6852241
Sequence CAGCTCTCATACAGGGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 158}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969386392_969386397 4 Left 969386392 4:6852192-6852214 CCATTCCGTGTTCAAGGATAGGA 0: 1
1: 0
2: 3
3: 58
4: 186
Right 969386397 4:6852219-6852241 CAGCTCTCATACAGGGGCCTTGG 0: 1
1: 0
2: 0
3: 15
4: 158
969386389_969386397 18 Left 969386389 4:6852178-6852200 CCAATTTTTTTAGACCATTCCGT 0: 1
1: 0
2: 0
3: 6
4: 133
Right 969386397 4:6852219-6852241 CAGCTCTCATACAGGGGCCTTGG 0: 1
1: 0
2: 0
3: 15
4: 158
969386393_969386397 -1 Left 969386393 4:6852197-6852219 CCGTGTTCAAGGATAGGAATCAC 0: 1
1: 0
2: 1
3: 42
4: 847
Right 969386397 4:6852219-6852241 CAGCTCTCATACAGGGGCCTTGG 0: 1
1: 0
2: 0
3: 15
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969386397 Original CRISPR CAGCTCTCATACAGGGGCCT TGG Intronic
900405218 1:2490033-2490055 CAGCTCTCATGCAGAGGGGTGGG - Intronic
901092805 1:6653508-6653530 CAGCTCTCATCCTGAGCCCTGGG - Intronic
904306480 1:29593285-29593307 CAGCTCTGATGCAGGGGGGTTGG + Intergenic
905092478 1:35440652-35440674 CAGCTGGCAGACACGGGCCTGGG + Intronic
905770974 1:40637806-40637828 CACCTCACACACAGAGGCCTGGG + Intronic
906312061 1:44761136-44761158 GATCTCACATACAGGGGCTTGGG - Intronic
907273268 1:53303169-53303191 CAGCTTTCCTACAGGGACTTTGG + Intronic
916172526 1:162011470-162011492 CAGCTCTCTTACCAGGGGCTAGG - Intronic
920285402 1:204875277-204875299 CTTCTCTCATAAAGAGGCCTGGG + Intronic
922538021 1:226397293-226397315 CAGCTCTCATTCTGTTGCCTAGG - Intronic
923779878 1:237012732-237012754 CAGCACTGATCCAGGGGCTTTGG - Intergenic
924010972 1:239664987-239665009 CAGATCTGCTGCAGGGGCCTGGG - Intronic
1062904124 10:1168604-1168626 CAGCTCTCATGCAGGGTTTTTGG - Intergenic
1062999129 10:1897951-1897973 CATGTCTATTACAGGGGCCTGGG - Intergenic
1065483227 10:26214873-26214895 CTGCTCTCATCCTGGCGCCTGGG + Intergenic
1065787493 10:29229950-29229972 CAGCTCACAGCCAGAGGCCTCGG - Intergenic
1067286656 10:44912138-44912160 CAGACCTCAGACAGGGGTCTGGG - Intronic
1069708048 10:70471519-70471541 CAGCTCACATACATCTGCCTTGG + Intergenic
1070962292 10:80507485-80507507 CTGCTCCCAGGCAGGGGCCTAGG - Intronic
1076420742 10:130329997-130330019 CAGCTGTGAGGCAGGGGCCTGGG + Intergenic
1076587894 10:131561605-131561627 CAGGTCTCATACAGCAGCCACGG - Intergenic
1078019111 11:7640708-7640730 CAGCTCTTGTGCAGGTGCCTGGG - Intronic
1081631663 11:44693857-44693879 AAGCTCTCATCCTGGGGCCCTGG - Intergenic
1083804670 11:65066732-65066754 CAGCTCTCCTAGAGGGGCTTCGG - Intronic
1084166264 11:67376084-67376106 CAGCTCTGAAACAGGGACCCAGG + Intronic
1084514185 11:69627130-69627152 CAACTCTGATTAAGGGGCCTTGG - Intergenic
1084590945 11:70089910-70089932 CAGCTCCCAGAGAGTGGCCTCGG - Intronic
1085793327 11:79515008-79515030 CAGCTATCATTCAGGGACCCAGG - Intergenic
1089497716 11:118916155-118916177 CACCTCCCATCCATGGGCCTGGG - Intronic
1090333366 11:125947704-125947726 CACCTCCTCTACAGGGGCCTCGG - Intergenic
1091106019 11:132920594-132920616 CAGCTCTCTCCCAGGGGCCGCGG - Intronic
1091338776 11:134794419-134794441 CAGCTCTGGCACAGGGGTCTAGG + Intergenic
1096258185 12:50075239-50075261 CTGCAGGCATACAGGGGCCTGGG + Intronic
1099937385 12:89143339-89143361 GAACTCTCATACATGGGCCCTGG - Intergenic
1102501973 12:113359045-113359067 CAGCTCCCAAACAGGGTACTTGG - Intronic
1103804423 12:123561245-123561267 TATCTCTCATACAGTGTCCTTGG - Intergenic
1103870271 12:124086263-124086285 CAGCTGTCATTCAGAGGCATGGG - Intronic
1104396741 12:128440480-128440502 AAGGTCTCATTCAGGGGCCGTGG - Intronic
1105432020 13:20345234-20345256 CAGTCCTCAGACAGGGGCCCTGG - Intergenic
1106134628 13:26964954-26964976 CTGCTCGCAGACAGGGTCCTTGG - Intergenic
1106633416 13:31501380-31501402 CAGCTCTCATTAATGGGACTAGG + Intergenic
1107982708 13:45748755-45748777 CAGCACGAATACAGGTGCCTTGG - Intergenic
1111390243 13:87584792-87584814 CAACTCTCTAACATGGGCCTCGG - Intergenic
1114528693 14:23381885-23381907 CAGCTCTGATACAGGGGCTGGGG + Intergenic
1117261602 14:54040229-54040251 CTGCTCTCAAGCAGGGGCTTGGG + Intergenic
1117759755 14:59014850-59014872 CACCTGCCATCCAGGGGCCTTGG - Intergenic
1118843530 14:69529180-69529202 CAGCTCCCAGCCAGGGCCCTAGG - Exonic
1121873166 14:97427635-97427657 CAGCTCTAGGAAAGGGGCCTGGG - Intergenic
1122076526 14:99238503-99238525 CTGCTCCCTCACAGGGGCCTTGG - Intronic
1122359289 14:101150169-101150191 CGGCTCACCTGCAGGGGCCTGGG - Intergenic
1132856749 16:2048412-2048434 CAGCTCGCAAACAGGCACCTAGG - Intronic
1132959063 16:2612261-2612283 CAGCTCTCAAGCAAGGGCCGGGG - Intergenic
1132972123 16:2694236-2694258 CAGCTCTCAAGCAAGGGCCGGGG - Intronic
1134812875 16:17182164-17182186 TAGCTCTCATACAGGGGATGAGG + Intronic
1137627662 16:49919893-49919915 AAGCCCTCATAGAGGGACCTGGG + Intergenic
1138248273 16:55483122-55483144 CAGATCACATACAGGTGCCGGGG + Exonic
1139275958 16:65727866-65727888 CAGCTGCCATTCAGTGGCCTTGG + Intergenic
1141257839 16:82419386-82419408 CAGTTCACAAACAGGGGCCGGGG + Intergenic
1142149100 16:88504922-88504944 CAGCTCTCCTGCAGGGACCTGGG - Intronic
1142151011 16:88512556-88512578 CTGCTCTCCTGCTGGGGCCTGGG - Intronic
1145775225 17:27523008-27523030 CCTCTCTCACACAGGGCCCTGGG + Intronic
1148742126 17:49898793-49898815 CAGGGCCCATACAGGTGCCTGGG - Intergenic
1149047688 17:52266821-52266843 CAGCTGTCATAAAGGGACTTGGG + Intergenic
1149539080 17:57455073-57455095 TAGCTCTCATTCAGGTGCGTGGG + Intronic
1151961992 17:77410397-77410419 CAGGTTTCAGACAGGGGCCGTGG - Intronic
1152467594 17:80474860-80474882 CAGCGCTCATCCAGGCGCCCTGG + Intronic
1152608538 17:81304740-81304762 CCGCTCTGGTCCAGGGGCCTGGG + Intergenic
1153047679 18:871637-871659 CAACTCTCATAAAAGGGACTGGG - Intergenic
1155079048 18:22389387-22389409 CCTCTCTCATACAGGGGCAGAGG + Intergenic
1155379259 18:25201107-25201129 CAGCTCTGGTACAGTAGCCTGGG - Intronic
1156465806 18:37347323-37347345 CATCTCCCACACAAGGGCCTCGG - Intronic
1156502967 18:37571267-37571289 CAGGTCTCAGACAGGTGCCAGGG + Intergenic
1157999316 18:52597690-52597712 CAGCTCTCCTACAGGCACGTTGG + Intronic
1161399926 19:4062712-4062734 GAGCTCTCACACAGGAGCCTGGG + Intronic
1163272362 19:16261966-16261988 CACCTGTCAAACGGGGGCCTGGG + Intergenic
1165233823 19:34404673-34404695 CAGCGCTGACACACGGGCCTGGG - Exonic
1165890606 19:39110128-39110150 CAGCTCTCCTCCAGAAGCCTAGG + Exonic
1167096448 19:47377230-47377252 CAGCTCTCATATCTGGGCATGGG - Intronic
925314091 2:2908063-2908085 AAGCTCCCACACTGGGGCCTGGG - Intergenic
926367206 2:12144301-12144323 GAGCTGTGATACAGGGGACTTGG + Intergenic
926761607 2:16283303-16283325 GAGCACACATACAGGTGCCTGGG + Intergenic
926906182 2:17807767-17807789 AGGCTCTCATCCTGGGGCCTTGG + Intergenic
927881168 2:26691312-26691334 CTGCTCTCAGTCAGGGGCCTTGG + Intergenic
931086399 2:58835639-58835661 AAGCTCTCATTCAGGTGCCTTGG + Intergenic
934654753 2:96111498-96111520 CAGCTCTCATTCAGTGGCGCTGG - Intergenic
936112046 2:109673114-109673136 GAGCTACCATACAGGTGCCTCGG + Intergenic
936349535 2:111702431-111702453 CTGCTCTAACACAAGGGCCTGGG - Intergenic
940781692 2:157940192-157940214 CAGCTCTGATCCAGGGACCATGG - Intronic
943016117 2:182512297-182512319 ATGCTCTAATACTGGGGCCTGGG - Intronic
944977611 2:205073760-205073782 CAGATGTCATACATGTGCCTAGG - Intronic
946841945 2:223828241-223828263 AAGCGCTCACACAGGGCCCTGGG + Intronic
948642342 2:239383688-239383710 CAGCTCTCACTCAAGGGCGTGGG + Intronic
948869524 2:240791322-240791344 CAGCTCTGACACAGAGGCCTGGG + Intronic
1170159154 20:13295101-13295123 CAGCTCTGACCCAGGAGCCTGGG - Intronic
1171332454 20:24352470-24352492 CAGCTCCCATACAAGGTCCCTGG + Intergenic
1174164694 20:48576553-48576575 CTGCTCTCATCCAGGCTCCTGGG + Intergenic
1174369463 20:50076835-50076857 CAGCTGTCACACACGGGCCAAGG - Intergenic
1174375475 20:50124044-50124066 CAGCTCTCATCCTGAGGCCAGGG + Exonic
1175192766 20:57222593-57222615 CAGCCCTCATCAAGGAGCCTTGG - Intronic
1175800817 20:61800185-61800207 CAGCACTCACAAAGGGCCCTTGG - Intronic
1180012079 21:45058124-45058146 CAGCTCTCCCAGAGGGGCGTTGG + Intergenic
1180636443 22:17266128-17266150 GAGCTCTCAGACAGGGGCCCTGG - Intergenic
1180642192 22:17307902-17307924 CAGGTATCTTACAGGGGCCGGGG + Intergenic
1181029839 22:20144380-20144402 CAGCTCTCCTACCTGGACCTGGG - Intronic
1181274872 22:21681953-21681975 CAGCGCTGCTCCAGGGGCCTTGG + Intronic
1181347029 22:22226982-22227004 CAGCTCCCATTCAAGGACCTTGG + Intergenic
1181513433 22:23398939-23398961 CAGCTCTCCTACCTGGGCCTGGG + Intergenic
1183493346 22:38128207-38128229 CTGCTGTGATCCAGGGGCCTGGG + Intronic
1184634684 22:45817757-45817779 CTTCACTCATACAGGGCCCTGGG - Intronic
1184818539 22:46891040-46891062 CAGCACTCAGGAAGGGGCCTGGG - Intronic
1185165961 22:49262373-49262395 CAGCTCTCATCCAGAGGCCAGGG - Intergenic
949135646 3:561552-561574 CAGCTCTGATACAGAAGCCCAGG + Intergenic
950851878 3:16069936-16069958 GAGCTCCCATAAAGGGCCCTGGG - Intergenic
952263716 3:31765537-31765559 CAGCTCTCAAAGAGATGCCTGGG - Intronic
956172467 3:66443627-66443649 CAGTTGTCATACAGGGGCTGGGG - Intronic
961368054 3:126413846-126413868 GAGCTCTCTTTCAGGGGCCAGGG + Intronic
962515601 3:136147615-136147637 CAGCTTTTATCAAGGGGCCTGGG - Exonic
962920997 3:139950327-139950349 TAGCTCTCATCCATGTGCCTGGG - Intronic
966639985 3:182178940-182178962 CTGCTCTCATAAGGGTGCCTTGG + Intergenic
966805169 3:183801898-183801920 CAGCTATCACACAGGAGGCTGGG - Intronic
968134115 3:196209295-196209317 CCTCCCTCATACAGGGGCCAGGG - Intronic
969386397 4:6852219-6852241 CAGCTCTCATACAGGGGCCTTGG + Intronic
969931645 4:10636667-10636689 CAGCTCTCATACCGTGCACTTGG + Intronic
970272021 4:14358304-14358326 CAGCTCTGCTAGAGGGGCCTGGG - Intergenic
976491058 4:85670863-85670885 CAGTTCTCAAACAGGGACATGGG + Intronic
978296848 4:107215368-107215390 CAACACTCATTCAGGTGCCTTGG - Intronic
992427836 5:76676432-76676454 CATCTCTCCTACAGGCACCTGGG - Intronic
997193692 5:131963221-131963243 CAGAAGTCCTACAGGGGCCTGGG - Intronic
997510682 5:134451789-134451811 CAGCTCTGATAGTGGGGCCTGGG - Intergenic
997887946 5:137648232-137648254 CAGTGCCCATCCAGGGGCCTGGG + Intronic
999371748 5:151059948-151059970 CACCTGTCTTACAGGGCCCTGGG + Intronic
1000280101 5:159774645-159774667 TAGCCCTCAAACAGGTGCCTGGG - Intergenic
1002277597 5:178113890-178113912 CATCTCTCAGACGGGAGCCTCGG - Intronic
1003399585 6:5780961-5780983 CAGCTCCCAGCCTGGGGCCTTGG + Intergenic
1003751162 6:9057946-9057968 GAGCACTAATTCAGGGGCCTTGG - Intergenic
1006430073 6:33990075-33990097 TAGCTCTCATTCTGGGGCCCAGG - Intergenic
1006650179 6:35545000-35545022 CAGCTCTTAAACATGGTCCTGGG - Intergenic
1009624711 6:66125366-66125388 CAGCCTTGATACAGGTGCCTGGG + Intergenic
1015294947 6:131580236-131580258 CAGTTTTGATACAGAGGCCTTGG - Intronic
1015718885 6:136220022-136220044 CAGCTACCATAAAGGAGCCTAGG + Intergenic
1018215052 6:161518509-161518531 CAGCTCTCACCCAGAGCCCTGGG - Intronic
1018867205 6:167755579-167755601 CACCTCTCTCACTGGGGCCTGGG + Intergenic
1022129920 7:27395677-27395699 TGGCTCTCACTCAGGGGCCTGGG - Intergenic
1022532920 7:31078357-31078379 CAGCTGACAGACAGGGACCTGGG - Intronic
1023907250 7:44531531-44531553 CATCTCTCTTACTGTGGCCTGGG + Intronic
1026830118 7:73605597-73605619 CAGCCCTCCCAGAGGGGCCTGGG + Intronic
1026930176 7:74219512-74219534 CAACCCTCACACAGGGCCCTGGG - Intronic
1031384992 7:121138459-121138481 CAGCTTTCAGACAGGGGTTTAGG + Intronic
1032115163 7:129110810-129110832 CAGCTCTGATGCAGTGTCCTGGG - Intergenic
1034251221 7:149692558-149692580 CCGCTCTAATACACGCGCCTAGG - Intergenic
1035927384 8:3743046-3743068 CAGCTGCCATACAGGGACCATGG - Intronic
1040006769 8:42627757-42627779 CAGCTCACATTCTGGTGCCTTGG + Intergenic
1040278276 8:46024933-46024955 AAGCCCTCTTACAGAGGCCTGGG - Intergenic
1041083591 8:54236362-54236384 GTGCTCTCATCCAGGGGCCATGG + Intergenic
1043131905 8:76472789-76472811 CAGCTCTCATGCAGGTCCCCAGG + Intergenic
1044988303 8:97774287-97774309 CAGCTCCCATACAGTGGGCGGGG + Intergenic
1049771633 8:144384987-144385009 CAGCACCCATGCAGGGGCCCAGG + Intronic
1058170002 9:101669256-101669278 CAGCTCACTTAGAGGGGCCCTGG + Intronic
1058186418 9:101860709-101860731 CAGATCTCAAACACAGGCCTGGG + Intergenic
1058957591 9:109963587-109963609 CAGCCCCCATACTGGGCCCTGGG + Intronic
1061243053 9:129385363-129385385 CAGCTTTGATACAGGGGCATGGG - Intergenic
1061448950 9:130658586-130658608 CAGGTCCCATACAAGGCCCTGGG - Intergenic
1061520109 9:131112778-131112800 CAGCTCTCCTACAGGTGGCTGGG - Intronic
1061586672 9:131573964-131573986 CAGATCTCAGGCAGGGGGCTGGG + Intergenic
1061849193 9:133404685-133404707 CAGAGCTCACACAGGGGCCTGGG - Intronic
1062108318 9:134767759-134767781 CAGCTCTCGTTCCAGGGCCTAGG - Intronic
1062207609 9:135345965-135345987 CAGCCCTCCTGCAGGCGCCTTGG - Exonic
1186388511 X:9134444-9134466 CAGCTCACAACCAGAGGCCTAGG - Intronic
1188441880 X:30221573-30221595 CTGCTCTCAGACACGGTCCTAGG + Intergenic
1189370881 X:40428123-40428145 CAGCCCTCCTACTGGGGCTTTGG + Intergenic
1195675670 X:107505782-107505804 TAGCTCCCATACAGAGGCCATGG + Intergenic
1196828827 X:119760468-119760490 GAGTTGTCATATAGGGGCCTTGG + Intergenic
1198522210 X:137464531-137464553 CACCTCTCAAAAAGTGGCCTAGG - Intergenic
1200310056 X:155069324-155069346 CAGGACTCATACACAGGCCTGGG - Intronic