ID: 969386867

View in Genome Browser
Species Human (GRCh38)
Location 4:6857201-6857223
Sequence ACTCTGAAGGTCTTTCAGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 149}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969386867_969386870 -10 Left 969386867 4:6857201-6857223 CCAGACTGAAAGACCTTCAGAGT 0: 1
1: 0
2: 0
3: 13
4: 149
Right 969386870 4:6857214-6857236 CCTTCAGAGTAAGCAAGGTGAGG 0: 1
1: 0
2: 2
3: 17
4: 160
969386867_969386871 19 Left 969386867 4:6857201-6857223 CCAGACTGAAAGACCTTCAGAGT 0: 1
1: 0
2: 0
3: 13
4: 149
Right 969386871 4:6857243-6857265 GCACTGTGCGCACACATGCCAGG 0: 1
1: 0
2: 0
3: 6
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969386867 Original CRISPR ACTCTGAAGGTCTTTCAGTC TGG (reversed) Exonic