ID: 969386891

View in Genome Browser
Species Human (GRCh38)
Location 4:6857430-6857452
Sequence GAGATTCCTGCAACCAAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 99}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969386888_969386891 -7 Left 969386888 4:6857414-6857436 CCAGCAGTCACTCATAGAGATTC 0: 1
1: 0
2: 0
3: 9
4: 100
Right 969386891 4:6857430-6857452 GAGATTCCTGCAACCAAGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 99
969386887_969386891 -6 Left 969386887 4:6857413-6857435 CCCAGCAGTCACTCATAGAGATT 0: 1
1: 0
2: 0
3: 5
4: 129
Right 969386891 4:6857430-6857452 GAGATTCCTGCAACCAAGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 99
969386886_969386891 29 Left 969386886 4:6857378-6857400 CCATCTGCAGCTCTGTTAGTGGC 0: 1
1: 0
2: 2
3: 14
4: 186
Right 969386891 4:6857430-6857452 GAGATTCCTGCAACCAAGGGAGG 0: 1
1: 0
2: 1
3: 14
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969386891 Original CRISPR GAGATTCCTGCAACCAAGGG AGG Intronic
900697252 1:4020097-4020119 GAGATTCCTGCAAGGAGTGGGGG - Intergenic
901425740 1:9181599-9181621 GAGTTTTTTGCAACCATGGGTGG + Intergenic
901610684 1:10495598-10495620 GAGATTCCTGCGCCCGTGGGAGG + Intronic
901670329 1:10852218-10852240 CAGATTCCTGCAACACAGCGTGG + Intergenic
902337599 1:15762816-15762838 CAGTTTCCTGCTGCCAAGGGTGG - Intronic
905082691 1:35338368-35338390 GTGGATCCTGCAACCAAGCGTGG + Intronic
906514882 1:46433008-46433030 GAGAAGCCTGCGACCAAGGACGG + Intergenic
911614786 1:99997905-99997927 GAGATTCATGCAACCAAGAAGGG + Intronic
913562597 1:120036936-120036958 GAGATTCCTAAAACAAAGGGAGG - Intronic
913635525 1:120756671-120756693 GAGATTCCTAAAACAAAGGGAGG + Intergenic
914283194 1:146196317-146196339 GAGATTCCTAAAACAAAGGGAGG - Intronic
914544224 1:148647037-148647059 GAGATTCCTAAAACAAAGGGAGG - Intronic
914622409 1:149423975-149423997 GAGATTCCTAAAACAAAGGGAGG + Intergenic
915896545 1:159815562-159815584 GAGATGCCTGCAGCCCAGTGAGG + Exonic
920789620 1:209077326-209077348 GAGATTTCTGCACTGAAGGGTGG + Intergenic
1073199859 10:101726678-101726700 CAGATTCCTGCCACCAAGCCCGG + Intergenic
1074822080 10:117187293-117187315 GAGCTTCCTGCAACACTGGGTGG - Intergenic
1076832928 10:133006022-133006044 GAGATTCCTGCCACCATGCGAGG + Intergenic
1078063811 11:8064954-8064976 GTGATTTGTGCAACCAAAGGAGG + Intronic
1078819212 11:14859934-14859956 CAGCTTCCTGCAAGCCAGGGTGG - Intronic
1079332799 11:19547490-19547512 CAGGCTCCTGCAGCCAAGGGGGG - Intronic
1079382900 11:19954306-19954328 GTAATTCCTGCCACCAAGGAGGG - Intronic
1081648257 11:44805033-44805055 CTGATTCCCCCAACCAAGGGCGG - Intronic
1082228983 11:49741561-49741583 GTCATGCCTGCAACCATGGGTGG - Intergenic
1083408704 11:62476952-62476974 GTGATTTCTGCAACCAATGCCGG - Intronic
1084962675 11:72725581-72725603 GAGATTCTTTCCACCCAGGGAGG - Intronic
1085770403 11:79320373-79320395 AAGATTCCTCCAACCAAAGCCGG - Intronic
1089652240 11:119921927-119921949 GAGATGGCTGCAACCAGGAGGGG - Intergenic
1099916807 12:88904931-88904953 GAAAATCCTGCAAACATGGGAGG - Intergenic
1106879569 13:34114591-34114613 AAGAATGCTGCTACCAAGGGTGG - Intergenic
1106907318 13:34422455-34422477 GTGATTCCTACAGCCAAAGGAGG + Intergenic
1115923313 14:38402711-38402733 GAGATTCCTTCAATGAGGGGTGG - Intergenic
1116856094 14:49953550-49953572 CAGATTCCTGGAAACAAGGAGGG - Intergenic
1117648293 14:57875803-57875825 GAGATTGCTGCAAACAATTGTGG + Intronic
1121391802 14:93582281-93582303 GAGAATCCTGCAAGCAAGCATGG + Exonic
1126369701 15:47932854-47932876 GAGATGCCTCAAACCAAAGGGGG - Intergenic
1126884475 15:53135009-53135031 GACATTCATGCAACAAAGGAAGG + Intergenic
1127132716 15:55883655-55883677 GAGATGCCTGGAACTAGGGGAGG - Intronic
1127564357 15:60172107-60172129 GAGGGTCCTGAAACCAAGTGGGG - Intergenic
1133387753 16:5384154-5384176 GCAATTCCTGCAGCCAAGGGTGG + Intergenic
1133518298 16:6531286-6531308 GAGGCTCCTGCAACAAGGGGAGG - Intronic
1133993605 16:10729786-10729808 CAGATCCCTGCAAGCACGGGAGG + Intergenic
1134684354 16:16148321-16148343 GAACTTGCTGTAACCAAGGGTGG - Intergenic
1137299067 16:47129319-47129341 CATATTCCTGCAACCCAGTGTGG - Exonic
1137665127 16:50245534-50245556 GTGATCCCTGCAACCCAGGGTGG - Intergenic
1146624434 17:34424811-34424833 GAGATACCTGAGACCCAGGGAGG + Intergenic
1150226718 17:63528412-63528434 GAGATTCCTACTCCCCAGGGAGG + Intronic
1151170245 17:72239558-72239580 GACTTTCCTTCAAACAAGGGAGG + Intergenic
1155769761 18:29681759-29681781 GAGAGTCCTGGAACCAAAGTCGG - Intergenic
1156077835 18:33301914-33301936 GAGATTTGAGGAACCAAGGGTGG + Intronic
1157596490 18:48867138-48867160 GAGTCTCCTGCAACCCATGGGGG + Intergenic
1160221937 18:76984380-76984402 GAGATCCCTGGAGCCACGGGAGG - Intronic
1165972966 19:39648988-39649010 GAGACTCATGGAACCAAGAGGGG + Intergenic
1167539316 19:50075230-50075252 GAGATGCCTGCATCTGAGGGAGG + Intergenic
1168330125 19:55563292-55563314 GGGAGGCCTGAAACCAAGGGTGG + Intergenic
929628637 2:43435443-43435465 GAGACTCCTGGAAGGAAGGGAGG + Intronic
940294776 2:152111081-152111103 CAGACTCTTGCAGCCAAGGGTGG - Intergenic
940468373 2:154061563-154061585 GAGCTTCATCCAACCAAGGGAGG - Intronic
941342832 2:164328929-164328951 AAGATTTCTGGACCCAAGGGTGG + Intergenic
945009072 2:205442443-205442465 CAGATGCCTGCAACCACGGCTGG + Intronic
945509576 2:210684113-210684135 GAGATCCCTGCAGCCAAGAGAGG - Intergenic
948284729 2:236774640-236774662 GATATTCATGTAACCAGGGGCGG - Intergenic
948534953 2:238638825-238638847 GTGAGTCCTGCACCCAGGGGAGG - Intergenic
949037193 2:241821281-241821303 TAGATTCCTCCCACCACGGGCGG + Intergenic
1170761229 20:19253271-19253293 CAGATTCCTGCAACCAAGCGTGG - Intronic
1172534553 20:35663579-35663601 GAGAATCCTGGAGCCAAGGAGGG + Intronic
1179994554 21:44967960-44967982 GTGATGCCAGCAGCCAAGGGTGG - Intronic
950144147 3:10635843-10635865 GAGATTCCTGCTGGCAAGGGAGG + Intronic
951682695 3:25311090-25311112 GAGATTAGTGCAATCAAGGAAGG + Intronic
958681712 3:97340265-97340287 GTGATGCCTCCAACCACGGGTGG - Intronic
961562964 3:127743609-127743631 GAGAGTACTGGAACAAAGGGAGG + Intronic
965455416 3:168894122-168894144 GAGAAACCTGCAACCCAGGTAGG + Intergenic
968680498 4:1915650-1915672 GAGCTGCCTGCAACCATGGGTGG + Intronic
969386891 4:6857430-6857452 GAGATTCCTGCAACCAAGGGAGG + Intronic
971660273 4:29405654-29405676 GAGTTTTATGCAACAAAGGGAGG - Intergenic
972569748 4:40299806-40299828 GAGTTTCCTCCTACCATGGGAGG + Intergenic
973534826 4:51870737-51870759 GGGATCCCTGCAACCATTGGGGG + Intronic
973795467 4:54421106-54421128 GAGGTTGCTGGCACCAAGGGGGG - Intergenic
982181857 4:152755136-152755158 GAACTTCATGCAATCAAGGGTGG + Intronic
982685142 4:158479958-158479980 GAGATTTCTGAAACTAATGGTGG + Intronic
986494057 5:8323771-8323793 GAGATCCCTGCAGTCAGGGGAGG + Intergenic
986944899 5:13005082-13005104 GGGAATGCTGCAACCAAGGAAGG - Intergenic
989753759 5:44926021-44926043 GAGGCTCCTTCCACCAAGGGAGG - Intergenic
995581480 5:113607242-113607264 GTCATGCCTGCAACCATGGGTGG + Intergenic
998182647 5:139956182-139956204 GTGATTCCTACAAGCTAGGGAGG - Intronic
1000530962 5:162419320-162419342 TAGATGCCTGAAACCAAGGATGG - Intergenic
1000723470 5:164737947-164737969 GAGTTTCATGCAAACAAGGTGGG - Intergenic
1003378742 6:5603400-5603422 GAGGGTCCTGAAACAAAGGGCGG + Intronic
1004652887 6:17628957-17628979 GAAATGCCTGCCACCAAAGGAGG - Exonic
1004951635 6:20679538-20679560 GAGCTTCATGCAACCAAGAGAGG - Intronic
1005165708 6:22917924-22917946 AAGATCCCTCCAACCAATGGTGG + Intergenic
1005181805 6:23114919-23114941 GTCATGCCTGCAACCATGGGTGG - Intergenic
1009608724 6:65908324-65908346 GAGCTGCCTGGAACCAGGGGTGG - Intergenic
1015258734 6:131210417-131210439 GGAATTCCTGTAGCCAAGGGTGG - Intronic
1015289337 6:131520466-131520488 TAAATTCCTTCAACTAAGGGAGG + Intergenic
1018555866 6:165050161-165050183 GTCATTCCTGCAACCACAGGTGG + Intergenic
1019426128 7:977671-977693 TAGATTCCTGCGCCCAAGGTCGG + Intergenic
1019435248 7:1019275-1019297 GAGATCCATGCAACCACAGGTGG - Intronic
1022812776 7:33885833-33885855 TACATTCCTGAAACCAAGTGAGG - Intergenic
1023318227 7:38964059-38964081 GAGATGCCTGCAACCCTGGCTGG - Intergenic
1023606470 7:41935981-41936003 TAGATTCCAGCAATCAAGGAAGG + Intergenic
1028913861 7:96237453-96237475 GAGATGCCAGCCACCTAGGGTGG + Intronic
1032227411 7:130043807-130043829 GAGATTCATGCAAGAAAGGATGG + Intronic
1034488543 7:151381043-151381065 GGGATTCCAGGAACCCAGGGCGG - Intronic
1039465840 8:37784515-37784537 GAGCTGCCTGCACCCCAGGGCGG + Intronic
1040108930 8:43557319-43557341 GAGATTCCTCCACAAAAGGGAGG + Intergenic
1051434485 9:17016622-17016644 GATTTTCCTACAACAAAGGGAGG - Intergenic
1051528503 9:18074338-18074360 GAGATTCCTGCAAATAGGTGTGG + Intergenic
1055638919 9:78304268-78304290 GCTAATCCTGCAACCAATGGTGG - Intronic
1062347341 9:136121088-136121110 GAGTGTCCTGCAGCCAGGGGCGG + Intergenic
1186178706 X:6951767-6951789 GAGTGTTCTGCAACCAAGGAAGG - Intergenic
1186388099 X:9130499-9130521 GAGATCTCTGCAACCAGGGATGG - Intronic
1192417745 X:70998862-70998884 GAGATGCCTGCAGCTGAGGGAGG + Intergenic
1200073401 X:153539754-153539776 GAGAATCCTGGGGCCAAGGGTGG + Intronic
1200768141 Y:7098060-7098082 GATATTCCTGATACAAAGGGAGG + Intergenic