ID: 969387770

View in Genome Browser
Species Human (GRCh38)
Location 4:6867261-6867283
Sequence CTCAACCTTCACAGGCTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969387770_969387777 24 Left 969387770 4:6867261-6867283 CCTTCCAGCCTGTGAAGGTTGAG 0: 1
1: 0
2: 2
3: 19
4: 204
Right 969387777 4:6867308-6867330 TGTCCAGAGTAGAAGGACGGAGG No data
969387770_969387780 29 Left 969387770 4:6867261-6867283 CCTTCCAGCCTGTGAAGGTTGAG 0: 1
1: 0
2: 2
3: 19
4: 204
Right 969387780 4:6867313-6867335 AGAGTAGAAGGACGGAGGCAGGG 0: 1
1: 0
2: 2
3: 51
4: 856
969387770_969387776 21 Left 969387770 4:6867261-6867283 CCTTCCAGCCTGTGAAGGTTGAG 0: 1
1: 0
2: 2
3: 19
4: 204
Right 969387776 4:6867305-6867327 GAGTGTCCAGAGTAGAAGGACGG 0: 1
1: 0
2: 2
3: 30
4: 372
969387770_969387775 17 Left 969387770 4:6867261-6867283 CCTTCCAGCCTGTGAAGGTTGAG 0: 1
1: 0
2: 2
3: 19
4: 204
Right 969387775 4:6867301-6867323 ATCTGAGTGTCCAGAGTAGAAGG 0: 1
1: 0
2: 1
3: 44
4: 846
969387770_969387779 28 Left 969387770 4:6867261-6867283 CCTTCCAGCCTGTGAAGGTTGAG 0: 1
1: 0
2: 2
3: 19
4: 204
Right 969387779 4:6867312-6867334 CAGAGTAGAAGGACGGAGGCAGG 0: 1
1: 0
2: 0
3: 29
4: 465

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969387770 Original CRISPR CTCAACCTTCACAGGCTGGA AGG (reversed) Intronic
900947179 1:5837537-5837559 CGCATCCTTCCTAGGCTGGAGGG + Intergenic
901181774 1:7346918-7346940 CTCAACTGTCACAGACTGAAGGG + Intronic
901473259 1:9472286-9472308 CTCAACCTGTAAAGGCTGGATGG + Intergenic
904292735 1:29498234-29498256 CACAGCCTTCCCAGCCTGGATGG + Intergenic
908391903 1:63690904-63690926 CCCAACTTTCACTGCCTGGAAGG + Intergenic
908616474 1:65928473-65928495 CTCAACCTTCAAAGGCAAGGTGG - Intronic
908673163 1:66571261-66571283 CTCAACGTTAACAAGGTGGAGGG + Intronic
910113738 1:83709958-83709980 ATTACCCTGCACAGGCTGGAAGG + Intergenic
910361919 1:86421510-86421532 CTCCACCTTTTCAGGCTGTAAGG + Intergenic
911369871 1:96983985-96984007 TTCAACCTACACATTCTGGAGGG - Intergenic
912373682 1:109193019-109193041 CTCCACAGTCACAGCCTGGATGG - Intronic
915648420 1:157290288-157290310 CTCTACCTTCCCAGGATGCAGGG + Intergenic
915873266 1:159584926-159584948 CTGAACTTTCACTGGCAGGATGG + Intergenic
916015054 1:160742333-160742355 CTCCACCTTCAAAGGCAGGCGGG + Intronic
917409437 1:174742689-174742711 GTCAACCATCCCAGGCTGCAGGG - Intronic
917650000 1:177066970-177066992 CTCAACCTTGAAAGACTGCAGGG - Intronic
920439350 1:205968558-205968580 CTCAAACTTCTCAAGCAGGAGGG + Intergenic
1065886079 10:30078480-30078502 AACTACCTTCACAGGCTTGATGG - Intronic
1067180362 10:43980823-43980845 CTCCTCCTTCACAGGCTGAAGGG - Intergenic
1067241974 10:44505255-44505277 CTCAACCTTGCAGGGCTGGAGGG - Intergenic
1068081432 10:52322628-52322650 CTCAGCCTTCACAGAATTGAAGG - Intergenic
1068736702 10:60421477-60421499 CTCTAGTTTCACAGGCTGGTAGG - Intronic
1070828665 10:79405650-79405672 CCCAGCCTTCCCTGGCTGGAGGG + Intronic
1071683467 10:87730793-87730815 CTCAACCTTCATAGAATTGAAGG - Intronic
1073630951 10:105148616-105148638 CTCAACCATCACAGTCTGTATGG - Intronic
1074763483 10:116684362-116684384 CCAAACCATCACAGGGTGGAAGG + Intronic
1074930244 10:118117664-118117686 CTTTACCTTGACAGGCTGCATGG - Intergenic
1075498301 10:122947605-122947627 ATGAACCTTCAGTGGCTGGAAGG - Intronic
1075651448 10:124130293-124130315 CTCTCCCTCCACATGCTGGAAGG + Intergenic
1076633913 10:131870459-131870481 CTCAATCTCCCCTGGCTGGAGGG - Intergenic
1078711053 11:13791500-13791522 CTGAATCCTCACATGCTGGAAGG - Intergenic
1085655340 11:78309552-78309574 CTCAACCTCCCCAGGGTTGAGGG + Intronic
1087961485 11:104355832-104355854 CTCATCCCTCACAGTCTGGAAGG - Intergenic
1089940534 11:122411775-122411797 CTGAACCTTCAAAGGGTGAAGGG + Intergenic
1090221845 11:125033355-125033377 CTCAACCATCAAAGGCAAGATGG - Intronic
1093680277 12:21994259-21994281 CTCACAGTTCTCAGGCTGGAAGG - Intergenic
1095126317 12:38482128-38482150 CTGAACCCTCACATGGTGGAAGG - Intergenic
1095719357 12:45384187-45384209 CTCAGCCTTCATAGAGTGGAAGG + Intronic
1096456148 12:51788694-51788716 GGCAACCTTCAAAGGCTGGATGG + Exonic
1096501097 12:52064203-52064225 CTCAGCCTGCCCAGGCTGGAGGG + Intergenic
1096998978 12:55859779-55859801 GTGAACCTTCAGAGGCTAGAGGG - Intergenic
1099176166 12:79425101-79425123 CACGACCTTCATAGACTGGAAGG - Intronic
1099401347 12:82206480-82206502 CTCAACCATCAAAGGCAAGATGG - Intergenic
1099663529 12:85596801-85596823 CTCACCCATCACAGGCTTGGAGG - Intergenic
1100083085 12:90876458-90876480 CTCAACCATCAAAGGCAAGATGG + Intergenic
1102016322 12:109650264-109650286 CTTAACCCTCACAGCCTCGAAGG - Intergenic
1102569665 12:113819725-113819747 TTCAACCCCCACATGCTGGATGG + Intronic
1105430447 13:20332669-20332691 CTCATCTTTCACACGCAGGAGGG + Intergenic
1107488834 13:40859994-40860016 CTCTGCCACCACAGGCTGGAGGG - Intergenic
1108709213 13:53016539-53016561 CTCCACCTTCACAGTCAGCATGG - Intergenic
1110167129 13:72456669-72456691 CTCCTCCTTCACAGTTTGGATGG - Intergenic
1110442314 13:75539039-75539061 CTCCACCTTCAAAGCCAGGAAGG + Intronic
1110456421 13:75694935-75694957 GTCAACCTTCACAGTTTCGAGGG + Intronic
1110767428 13:79296910-79296932 TCCAACCTTCACAGGCATGAAGG - Intergenic
1114614417 14:24060686-24060708 CTCATCCTGCACAGGCTCCAGGG - Exonic
1117001348 14:51374515-51374537 CTCAACCTTCAAAGGCAAGGTGG + Intergenic
1118880995 14:69825790-69825812 CTCAACCATCAAAGGCTAGGTGG - Intergenic
1122039978 14:98980284-98980306 CTGTATCTTCACAGGGTGGAAGG - Intergenic
1123876889 15:24632515-24632537 ATCAACCTTCAAAGGCTAGTCGG - Intergenic
1124201598 15:27682951-27682973 CTGCATCCTCACAGGCTGGAAGG - Intergenic
1126150959 15:45523014-45523036 TTCCACCTTCCCAGGCTGGGAGG + Intergenic
1128258526 15:66215770-66215792 CTCCACCTCCACTGGCAGGAGGG + Intronic
1128263794 15:66251609-66251631 CACATCCTTGACAGGCTCGAGGG - Intronic
1132349232 15:101128298-101128320 CTGTTCCTTCAAAGGCTGGAAGG - Intergenic
1134552607 16:15145009-15145031 CCCACCCTTCACAGCCTGGGTGG + Intergenic
1134669512 16:16044446-16044468 CACAACCTTCACCGGCTGCCTGG - Exonic
1135122173 16:19775722-19775744 CTTAACCTTCTCAGTCTAGAAGG + Intronic
1135610107 16:23859045-23859067 CTCAACCCTCACAAGCTCAAGGG - Intronic
1136118879 16:28115952-28115974 CTCAGCCTTCACAGAATTGAAGG + Intronic
1136984778 16:35090554-35090576 CTGGACCTTCACAGCCTGTATGG - Intergenic
1137243638 16:46683532-46683554 CTGGACCTTCACAGCCTGTATGG + Exonic
1139259472 16:65577945-65577967 GACAACTTTCACAGGCAGGAGGG - Intergenic
1139289546 16:65844997-65845019 CTCAATCTTCACAGGCAGAGTGG + Intergenic
1141126885 16:81407267-81407289 CTCAAACATCACAGGCTGGCAGG + Intergenic
1141521201 16:84580786-84580808 CCCACCATTCACAGGCTGCATGG + Intronic
1141635153 16:85310635-85310657 CTCAGCCATCCCAGGCTGGCAGG + Intergenic
1144780077 17:17803684-17803706 CTCAAGCTTTACAGGCTGGTAGG - Intronic
1147582615 17:41635811-41635833 CAGCACCTTCACAGGCTGGGCGG - Intergenic
1148052661 17:44776751-44776773 CCTAACCTGCACAAGCTGGACGG + Exonic
1148798447 17:50208812-50208834 GTCAAGCTTCCCAGGCTGGGCGG - Intergenic
1151132754 17:71915170-71915192 CTGAACCTTCCCAGACTGGGTGG - Intergenic
1152122953 17:78429836-78429858 CTCTACTTCCACAGGGTGGAAGG - Intronic
1152624094 17:81380283-81380305 GTCATCCTTCACAGGCTGTGTGG + Intergenic
1153655857 18:7281605-7281627 CTCAACCTTCAGAGGTTCTAGGG + Intergenic
1153980174 18:10302233-10302255 CTCATCACTCACTGGCTGGATGG - Intergenic
1154071202 18:11153022-11153044 CACATTCTCCACAGGCTGGATGG - Intergenic
1155016805 18:21850517-21850539 TTCAACCTTCTAAGCCTGGATGG + Intronic
1157029917 18:43893558-43893580 TGCAACCCTCACAGACTGGATGG - Intergenic
1157626825 18:49057622-49057644 CTCAGCCTAGACAGGCTGGAAGG + Intronic
1157826163 18:50814357-50814379 CCCCACCTTCACTGGCTGCAGGG - Intronic
1160218650 18:76956620-76956642 CTAAACCTTGGGAGGCTGGAGGG - Intronic
1161364761 19:3872017-3872039 ACCAACCTCCACAGGCTGGCCGG + Intergenic
1162793381 19:13074391-13074413 TTCAGCCTGCACAGGCTGGCGGG + Intronic
1164015852 19:21255442-21255464 CAAAAGCTTCAGAGGCTGGAAGG + Intronic
1166654656 19:44601782-44601804 CTCCACCATCACAGGCAGGTGGG + Intergenic
1167349675 19:48966655-48966677 ACCAACCTCCACAGGCTGGGTGG + Exonic
924976471 2:180188-180210 CTCAAGTTTCTCAGGCTGGCTGG - Intergenic
925914356 2:8594182-8594204 CTCAGCCACCACAGGCTGGGCGG - Intergenic
926728905 2:16020003-16020025 ATGAACCTGCACAGGGTGGAAGG - Intergenic
927060952 2:19418870-19418892 CTCTGTCTTCACAGGCTGGAAGG - Intergenic
927146964 2:20172520-20172542 CTGAACCTTCTCAGGCTGCCAGG + Intergenic
927757508 2:25720918-25720940 CTTAACCTTCACAGGTTCCAGGG - Intergenic
928403457 2:30996202-30996224 ATGAACCATCACAGGCAGGAAGG + Intronic
928792031 2:34969006-34969028 TTCAACCTTCACAGACTTGAAGG + Intergenic
937152856 2:119697778-119697800 GTGAACCTTCAGAGGGTGGAGGG - Intergenic
938096518 2:128467503-128467525 CTCAGCCTTCAGGGGCAGGAGGG + Intergenic
939796998 2:146657315-146657337 CTGCATCTTCACAGTCTGGAAGG - Intergenic
940048068 2:149430937-149430959 CTGAACCTTCACTGTGTGGATGG - Intronic
940171554 2:150834498-150834520 CTCAACCATCAAAGGCAAGAGGG - Intergenic
941880122 2:170472622-170472644 CTGAACCTTAACTGCCTGGAAGG + Intronic
943708949 2:191067759-191067781 ATCAACCTTCAGAGGGTGAAGGG + Intronic
944527404 2:200634021-200634043 CTCAACCTTCACAGTAGGGGTGG + Intronic
946079569 2:217106080-217106102 CTGAAGCTTGACAGGCAGGAAGG - Intergenic
948898466 2:240941949-240941971 CTGCACCTTCACATGGTGGAAGG - Intronic
1169375964 20:5066809-5066831 ATCATCCCTCACAGGCAGGAGGG + Intergenic
1171214420 20:23341886-23341908 CTCAGCTTTCCCAGGCTGCAGGG + Intergenic
1173201407 20:40957781-40957803 CTCAACCTTCCTAGGGTGGATGG - Intergenic
1173522083 20:43707721-43707743 CTCAAATTTGACAGGCTGTATGG + Intronic
1173869320 20:46331727-46331749 CACACCCTTCACTGGCTGGGAGG + Intergenic
1179573732 21:42294118-42294140 TGCAGCCTTCACAGGCGGGATGG - Intronic
1179893719 21:44350338-44350360 CTCAACCTTCACAAGCTCCCGGG - Intronic
1180953724 22:19731977-19731999 CACTACCTCCACAGGCTGAAGGG + Intergenic
1181469800 22:23131075-23131097 CTCACCCATCCCAGGCTGGCAGG - Intronic
1181910942 22:26237777-26237799 CCCCACCTTCACAGGCTTGGAGG - Intronic
1184595077 22:45509088-45509110 CTGGAGCTTCAAAGGCTGGAGGG - Intronic
1185240300 22:49739220-49739242 CTCATCCATCACTGGCAGGAGGG - Intergenic
952977827 3:38710876-38710898 GGCAACCTTTAAAGGCTGGATGG - Exonic
953722027 3:45364461-45364483 CACATCCTTCAGTGGCTGGAAGG - Intergenic
954683483 3:52358390-52358412 CTGGGCCTTCCCAGGCTGGATGG - Intronic
954873572 3:53785877-53785899 CACAACTTGCAGAGGCTGGAAGG - Intronic
955948312 3:64216860-64216882 CCCAACCTCCACAGGATGCAAGG + Intronic
960313225 3:116142434-116142456 TTGCACCTGCACAGGCTGGATGG - Intronic
960947729 3:122978353-122978375 CTCAATGTTCACAGGCAGGCTGG + Intronic
961155823 3:124678700-124678722 CTCAGCCTTCACAGGGTTGGGGG - Intronic
962232239 3:133675828-133675850 ATCAACTTTCACAGGCTTCAAGG + Intergenic
963370397 3:144392547-144392569 CTCAACCCACCTAGGCTGGAGGG + Intergenic
964425861 3:156553171-156553193 CTCAACCTTCCCAGGCTCAAGGG - Intronic
968759420 4:2434370-2434392 CTCAACCTCCACATATTGGAGGG - Intronic
969387770 4:6867261-6867283 CTCAACCTTCACAGGCTGGAAGG - Intronic
970674073 4:18428621-18428643 GTCGACCTGCACAGGGTGGATGG + Intergenic
970870292 4:20809294-20809316 CACACCATTCACAGGCTGAATGG - Intronic
972201520 4:36718924-36718946 CTCAGCCTTCACAGGCAAGGTGG - Intergenic
973020187 4:45195017-45195039 CTTAACCTCCTCAGGCTAGAAGG + Intergenic
978537176 4:109774664-109774686 CTCAACCTCTACACACTGGAGGG - Intronic
978686280 4:111448112-111448134 CTCAGCCTTCACAGGCTTGAAGG + Intergenic
980038225 4:127909289-127909311 CACATTCTCCACAGGCTGGATGG + Intergenic
980308925 4:131101365-131101387 ATCTACTTTCACAGGCTGGCTGG - Intergenic
980628437 4:135405844-135405866 CTCAACCATCAAAGGCTGTAGGG + Intergenic
985965149 5:3333875-3333897 CTGCACCTTCACAGGCTAGGCGG - Intergenic
986262187 5:6157317-6157339 TTCAACCTTTACATGTTGGAGGG - Intergenic
987504170 5:18748081-18748103 CTCAACCATCAAAGGCAAGATGG + Intergenic
987657350 5:20823423-20823445 CTCAACCATCAAAGGCAAGATGG - Intergenic
988766196 5:34380525-34380547 CTCAACCATCAAAGGCAAGATGG + Intergenic
990261064 5:54022823-54022845 TTGAACCTTCAAAGGATGGAGGG + Intronic
991434236 5:66580158-66580180 CTCAAACTCCACAGGCTTGCAGG - Intergenic
994518214 5:100796173-100796195 CTTAAACTTCAAAGGCTGTAGGG - Intergenic
995261798 5:110112927-110112949 GTCCATCTTAACAGGCTGGAGGG - Intergenic
995427973 5:112045547-112045569 CTCAACCTTCAAAGGCAAGGTGG - Intergenic
995505761 5:112859404-112859426 CTCAGCCTTCACAGAATTGAAGG + Intronic
997230417 5:132238521-132238543 CTAAACCTTGGCAGGTTGGAAGG - Intronic
997498286 5:134349711-134349733 CTCAGCTCTCACAGGCTGAATGG - Intronic
998531120 5:142885597-142885619 TTCCACCTTGACAGGCGGGAAGG - Intronic
1005704369 6:28436808-28436830 CTCTACCTTCTATGGCTGGAGGG - Intronic
1006342692 6:33455212-33455234 CTGAACCGCCACAGGCTAGAGGG + Exonic
1006733124 6:36251559-36251581 CTGAACCTTCACTGGCAGCAGGG - Intronic
1007225202 6:40308794-40308816 CTCAACCTTGACAGGATCTAGGG + Intergenic
1007243277 6:40442340-40442362 TTCAACCTACACAGGATAGAGGG + Intronic
1007920982 6:45609374-45609396 CTCAAGCTTCACAGGCAAGAAGG - Intronic
1012794958 6:103748403-103748425 GTCCACCAGCACAGGCTGGAGGG - Intergenic
1013261250 6:108445211-108445233 CTCAACCTTCATAGAATTGAAGG + Intronic
1013445162 6:110218188-110218210 CTCAACTTTCACAGGCCAGTTGG + Intronic
1014493739 6:122093601-122093623 CTCAACCTCCCCAGTCTTGATGG + Intergenic
1015626614 6:135185588-135185610 TTAAACCTTCACTGGTTGGAAGG + Intronic
1015786485 6:136924087-136924109 CTGGACCTTCCCGGGCTGGAAGG + Exonic
1018214124 6:161510275-161510297 CTCAACCATCACAGGATGTGCGG + Intronic
1020923383 7:14293723-14293745 TCCATCCTTCACAGGCTAGATGG + Intronic
1021867416 7:24971846-24971868 CTCCACCTTCAAAGGAAGGATGG + Intronic
1022955665 7:35377898-35377920 ATTAAAGTTCACAGGCTGGAGGG + Intergenic
1024958492 7:54950866-54950888 CTCAACCTTCAAAGGCAAGGTGG - Intergenic
1026840044 7:73665443-73665465 CTCCACCTTCCCAGGCTAGGGGG - Intergenic
1028980646 7:96964432-96964454 TTCAACCTTCACAGGCTTTGAGG + Intergenic
1029920551 7:104257826-104257848 CTCTTGCTGCACAGGCTGGAGGG - Intergenic
1030587668 7:111441010-111441032 CTCAACCTTCATAGAATTGAAGG + Intronic
1030988711 7:116273729-116273751 CTCTAGCCTCACAGGGTGGAAGG - Intergenic
1031882400 7:127211709-127211731 CTGCATCTTCACAGGGTGGAAGG - Intronic
1032949337 7:136889234-136889256 CTCAGCCTTCACTGGATGGCTGG + Intronic
1034256551 7:149727867-149727889 CTGAATGTCCACAGGCTGGAAGG - Intronic
1034764018 7:153700666-153700688 CTCACACCTCACAGGCTGCAAGG + Intergenic
1037390324 8:18386400-18386422 CTCAAAATTCAAAGGGTGGAAGG - Intergenic
1038122407 8:24632127-24632149 CTCAATCTTCATATCCTGGAAGG - Intergenic
1038176079 8:25183578-25183600 GAAAACCTTCACAGGCTGCAAGG + Intergenic
1038672301 8:29592084-29592106 CTCAACCTCCGGAGGCTGAATGG - Intergenic
1038684901 8:29707675-29707697 CTGAGCCTTCTCTGGCTGGAAGG + Intergenic
1038777188 8:30541705-30541727 CTCAAACTTTACAGGATGGAAGG - Intronic
1039313340 8:36343997-36344019 ATCAACATACACAGACTGGATGG + Intergenic
1039813976 8:41075874-41075896 CTCAGCCATGACAGGATGGAAGG + Intergenic
1041646704 8:60260354-60260376 CTCTAACTTCACAGCCTGTAAGG + Intronic
1044603704 8:94031053-94031075 CTCAACCTCAACATGCTGGCGGG + Intergenic
1045387525 8:101686161-101686183 CTGAACCTTCTCAGGCTGAGAGG + Intergenic
1046511442 8:115209395-115209417 CTCTACCTTTAATGGCTGGAAGG + Intergenic
1046586009 8:116149419-116149441 CTCAACTGTCACAGGCAAGATGG - Intergenic
1048084077 8:131158629-131158651 CTCAACCATCAAAGGCAAGATGG - Intergenic
1048498230 8:134953382-134953404 CTCAATCTCCACAGGCTGGAAGG + Intergenic
1048726195 8:137387624-137387646 CTCTCCCATCACAGGCTGGGAGG - Intergenic
1048834788 8:138509005-138509027 CTCACTCTGCACAGGCTGGAGGG + Intergenic
1049005990 8:139856058-139856080 CTCCAGCTTCACAGGCTGTGTGG + Intronic
1050156373 9:2670504-2670526 TTAATCTTTCACAGGCTGGAAGG - Intergenic
1051483418 9:17583431-17583453 CTAAACCCTCACACGGTGGAAGG - Intronic
1052227373 9:26106585-26106607 CTCAACCTTCAAAGGCAAGGTGG + Intronic
1056735471 9:89205967-89205989 CACAGCCTTCACAGGTGGGAGGG - Intergenic
1056853334 9:90103180-90103202 CTGCACCTTCACATGGTGGAAGG - Intergenic
1057332461 9:94128746-94128768 CCCACCCATCACAGGCTGGGAGG + Intergenic
1058962802 9:110007695-110007717 GTGAACCTTCACAGGGTGAAAGG - Intronic
1059061929 9:111042105-111042127 CTCTACCTTAATAGACTGGAGGG - Intergenic
1059642701 9:116233102-116233124 CTCAATGTTAACAGGCTAGAAGG + Intronic
1060534238 9:124370674-124370696 GTCAGCTTTCACAGGCTGGAAGG - Intronic
1187762070 X:22598321-22598343 CTGTACCTTCACATGGTGGAAGG - Intergenic
1191719478 X:64217439-64217461 CTCAACCGTCAAAGGCAAGATGG - Intergenic
1192511382 X:71722425-71722447 CTGATCCTCCACAGGATGGATGG + Intergenic
1192515315 X:71759080-71759102 CTGATCCTCCACAGGATGGATGG - Intergenic
1192661791 X:73049543-73049565 CTCAACCTTCAGAGGCAAGGTGG - Intergenic
1194179820 X:90697735-90697757 CTCAACCATCAAAGGCCAGATGG - Intergenic
1194833713 X:98657012-98657034 CTCAACCATCAAAGGCAGGGTGG + Intergenic
1200526476 Y:4279904-4279926 CTCAACCATCAAAGGCCAGATGG - Intergenic
1201489871 Y:14528460-14528482 CACATCCTTCACAGGATGGCAGG + Intronic
1202605597 Y:26637235-26637257 ATCCACCTTCACAGGATGGAAGG - Intergenic