ID: 969392360

View in Genome Browser
Species Human (GRCh38)
Location 4:6900413-6900435
Sequence ATGTGGGGTTGGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969392351_969392360 14 Left 969392351 4:6900376-6900398 CCGGTGTGTGTAGACCACTCTTT No data
Right 969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG No data
969392353_969392360 0 Left 969392353 4:6900390-6900412 CCACTCTTTCTGGAAGCTTGACC No data
Right 969392360 4:6900413-6900435 ATGTGGGGTTGGAGAGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969392360 Original CRISPR ATGTGGGGTTGGAGAGAAGT GGG Intergenic
No off target data available for this crispr