ID: 969392752

View in Genome Browser
Species Human (GRCh38)
Location 4:6902017-6902039
Sequence CTGGCTGTTCTCAGATCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969392752_969392769 26 Left 969392752 4:6902017-6902039 CCATGAGATCTGAGAACAGCCAG No data
Right 969392769 4:6902066-6902088 CCGTGGGGCTGCGGGCAGGGAGG No data
969392752_969392762 11 Left 969392752 4:6902017-6902039 CCATGAGATCTGAGAACAGCCAG No data
Right 969392762 4:6902051-6902073 AGGAAGGACAGGCCGCCGTGGGG No data
969392752_969392767 23 Left 969392752 4:6902017-6902039 CCATGAGATCTGAGAACAGCCAG No data
Right 969392767 4:6902063-6902085 CCGCCGTGGGGCTGCGGGCAGGG No data
969392752_969392759 0 Left 969392752 4:6902017-6902039 CCATGAGATCTGAGAACAGCCAG No data
Right 969392759 4:6902040-6902062 CTGCAGTGGGGAGGAAGGACAGG No data
969392752_969392761 10 Left 969392752 4:6902017-6902039 CCATGAGATCTGAGAACAGCCAG No data
Right 969392761 4:6902050-6902072 GAGGAAGGACAGGCCGCCGTGGG No data
969392752_969392763 17 Left 969392752 4:6902017-6902039 CCATGAGATCTGAGAACAGCCAG No data
Right 969392763 4:6902057-6902079 GACAGGCCGCCGTGGGGCTGCGG No data
969392752_969392756 -9 Left 969392752 4:6902017-6902039 CCATGAGATCTGAGAACAGCCAG No data
Right 969392756 4:6902031-6902053 AACAGCCAGCTGCAGTGGGGAGG No data
969392752_969392765 22 Left 969392752 4:6902017-6902039 CCATGAGATCTGAGAACAGCCAG No data
Right 969392765 4:6902062-6902084 GCCGCCGTGGGGCTGCGGGCAGG No data
969392752_969392757 -5 Left 969392752 4:6902017-6902039 CCATGAGATCTGAGAACAGCCAG No data
Right 969392757 4:6902035-6902057 GCCAGCTGCAGTGGGGAGGAAGG No data
969392752_969392760 9 Left 969392752 4:6902017-6902039 CCATGAGATCTGAGAACAGCCAG No data
Right 969392760 4:6902049-6902071 GGAGGAAGGACAGGCCGCCGTGG No data
969392752_969392764 18 Left 969392752 4:6902017-6902039 CCATGAGATCTGAGAACAGCCAG No data
Right 969392764 4:6902058-6902080 ACAGGCCGCCGTGGGGCTGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969392752 Original CRISPR CTGGCTGTTCTCAGATCTCA TGG (reversed) Intergenic
No off target data available for this crispr