ID: 969395901

View in Genome Browser
Species Human (GRCh38)
Location 4:6921111-6921133
Sequence TGCCAGTGTTCTCAGTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969395899_969395901 14 Left 969395899 4:6921074-6921096 CCGGCCATTTTAAAGAAAAATAA 0: 1
1: 0
2: 6
3: 103
4: 1169
Right 969395901 4:6921111-6921133 TGCCAGTGTTCTCAGTGTGCTGG 0: 1
1: 0
2: 2
3: 25
4: 215
969395897_969395901 23 Left 969395897 4:6921065-6921087 CCACTGCACCCGGCCATTTTAAA 0: 1
1: 20
2: 132
3: 870
4: 4719
Right 969395901 4:6921111-6921133 TGCCAGTGTTCTCAGTGTGCTGG 0: 1
1: 0
2: 2
3: 25
4: 215
969395900_969395901 10 Left 969395900 4:6921078-6921100 CCATTTTAAAGAAAAATAAAAGA 0: 1
1: 0
2: 44
3: 1226
4: 16410
Right 969395901 4:6921111-6921133 TGCCAGTGTTCTCAGTGTGCTGG 0: 1
1: 0
2: 2
3: 25
4: 215
969395898_969395901 15 Left 969395898 4:6921073-6921095 CCCGGCCATTTTAAAGAAAAATA 0: 1
1: 0
2: 3
3: 83
4: 765
Right 969395901 4:6921111-6921133 TGCCAGTGTTCTCAGTGTGCTGG 0: 1
1: 0
2: 2
3: 25
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969395901 Original CRISPR TGCCAGTGTTCTCAGTGTGC TGG Intronic
900298160 1:1963082-1963104 AGCCAGTGTTTTCAGTGTCAAGG - Intronic
902432959 1:16377821-16377843 TGCCATTGCTCTGAGTGTGAAGG + Intronic
906229328 1:44147259-44147281 TTCCCCTGTTCTCATTGTGCAGG + Intergenic
906668287 1:47637163-47637185 TGAGAGTGTTTTCAGTGTGCAGG + Intergenic
907006930 1:50923689-50923711 TGCCATTGATTTCAGTTTGCTGG - Intronic
908193417 1:61726190-61726212 TACCAGTGTTCTCAAAGTGGGGG - Intergenic
908504179 1:64778628-64778650 CGCCAGTGTTATCAGTTTTCAGG - Intronic
909867496 1:80692656-80692678 TTCCAGTATTCTCAAGGTGCTGG + Intergenic
911531769 1:99051817-99051839 TCTCAGTGTTCTCAGAGTGGGGG + Intergenic
912429800 1:109623085-109623107 TCCCACTGTCCTCAGTGGGCGGG + Intronic
912748325 1:112264614-112264636 TGTCACTGTTCTGAGTGTCCAGG + Intergenic
915096164 1:153464302-153464324 TGACTCTGTTCTGAGTGTGCAGG + Intergenic
915241380 1:154524768-154524790 TGCCAGAGGTCTCACAGTGCTGG - Intronic
916400960 1:164448279-164448301 TACCAGTGTTCCCAGGATGCAGG - Intergenic
916576859 1:166075019-166075041 TCCCAGTGTTCTCTGTTTCCTGG - Intronic
920275486 1:204801455-204801477 TGCCAGTTTCCTTAGTGTGGAGG + Intergenic
921964410 1:221072902-221072924 TGAAAGTCTTGTCAGTGTGCAGG - Intergenic
922994756 1:229946660-229946682 TGCCTGTCTTCCCAGAGTGCTGG - Intergenic
923041691 1:230324127-230324149 GGCCAGTGTTCTCAGGGTCTGGG - Intronic
923566344 1:235079479-235079501 TGCCAGTTTTCTCACTGACCTGG + Intergenic
924686066 1:246291570-246291592 TGCAAGTGTTCTCAAAGTGACGG - Intronic
924710854 1:246529053-246529075 TCACAGTGTCCTCAGGGTGCCGG + Intergenic
1063158459 10:3401155-3401177 AGCCAGTGTTCTCAGGGCACAGG - Intergenic
1063609138 10:7548216-7548238 GGTCAGTGTTCTCAGTCTGAAGG - Intergenic
1064099586 10:12451855-12451877 TGTCCATGTTCTCAGTGTCCCGG + Intronic
1064234045 10:13556836-13556858 TGGCAGTGTTTTGACTGTGCAGG + Intergenic
1064268618 10:13845900-13845922 AGCCTGTGCTCTCAGCGTGCTGG + Intronic
1065821834 10:29532833-29532855 TGCCTGTCCTCTCAGTGGGCTGG + Exonic
1065870701 10:29953807-29953829 TGCCAGTGTTTACATTTTGCTGG - Intergenic
1069944463 10:71976314-71976336 TGCCATTGCTCTCAGTGGGCAGG + Intronic
1070361869 10:75698327-75698349 GGCCAGTGTTCTTACTTTGCTGG - Intronic
1071920579 10:90345517-90345539 TCCCAGTGTGCTCAGTGCCCTGG - Intergenic
1075399904 10:122153381-122153403 GGCCAGTGTTCTGACTTTGCTGG - Intronic
1075895235 10:125989338-125989360 TGCCTGTGTTTTCAGTGGGTGGG - Intronic
1079186849 11:18245760-18245782 TGCCTCTGTGCTCAGTGTGAGGG - Intronic
1079934010 11:26596004-26596026 TGTCAGTGGTCTCAGTGTTTTGG + Intronic
1080242181 11:30139222-30139244 TCCCAGTGTTTTCAGTTTGCAGG - Intergenic
1081379192 11:42394443-42394465 TGCCAGTCTTCACAGTATCCTGG - Intergenic
1084442145 11:69180671-69180693 TTCCAGTGTTGTCACTGAGCCGG + Intergenic
1085542805 11:77288290-77288312 TGGCAGTGTTAGCAGTGTGCAGG - Intronic
1087223766 11:95575284-95575306 TGCCATTGTTCTCAGTTTACAGG - Intergenic
1088237486 11:107741458-107741480 TCTCAGTGTTCTGAGTGTGCAGG + Intergenic
1089535932 11:119160815-119160837 TGGCAGTTTTCTCAGAGAGCAGG + Intronic
1091023822 11:132124334-132124356 TGTGAGTGCTCTCAGTCTGCAGG + Intronic
1091780941 12:3214352-3214374 TACGTGTGTGCTCAGTGTGCTGG + Intronic
1091791826 12:3276322-3276344 TGCAAGTGTCCTCAGTGTGACGG - Intronic
1093119272 12:15248314-15248336 TGCCTGTTTTCTCATTGTTCTGG - Intronic
1096757759 12:53814402-53814424 TGCCAGTGTTCACAGAGTTTAGG + Intergenic
1097947665 12:65389717-65389739 TGCCAGTGCTCTCTGGGTCCTGG + Intronic
1099729686 12:86484614-86484636 TCTCAGTGTTCTGAGTGTGGGGG - Intronic
1100002241 12:89851156-89851178 TGCCAGAGTTCTCCTGGTGCTGG + Intergenic
1101891051 12:108715649-108715671 TGCCAGTGTTGTGAGTATGCGGG - Intronic
1106018103 13:25888081-25888103 TGCCAGTGTTCTCTGGGGGTGGG - Intronic
1107615229 13:42160085-42160107 TGGCAGTGTTCTCCGTCTACAGG + Exonic
1108775491 13:53760985-53761007 TGCCAGTCTTTCCAGTGTCCTGG - Intergenic
1109092046 13:58060333-58060355 TGCCAGTATTCTAATTGTGAGGG - Intergenic
1109999968 13:70184032-70184054 TACCATTGTTCTAAGTGTGGTGG - Intergenic
1110451048 13:75637156-75637178 AGCCAGTGTATTCAGTGTGGAGG + Intronic
1111031284 13:82602644-82602666 TGCCTGTGTTTTCAGCCTGCTGG - Intergenic
1111792718 13:92879004-92879026 TCCAAGTGTTCTCATTGTTCTGG + Intergenic
1112196213 13:97229219-97229241 TTTCAGTGTTCTCAGAGTTCAGG + Intronic
1114079767 14:19193740-19193762 TGCCTGTAATCTCAGTGTTCTGG - Intergenic
1118820652 14:69343450-69343472 TGCCAGTGCTCACATTGTTCTGG - Intronic
1120114422 14:80596752-80596774 TGGCTATGTTCTCAGTGAGCTGG + Intronic
1121256140 14:92531738-92531760 TGCCAGTGTCGTGAGGGTGCAGG - Intronic
1121652486 14:95569554-95569576 AGCCAGAGATCACAGTGTGCTGG + Intergenic
1123868920 15:24552040-24552062 TGCGAGTGTTTTCAGTGAGAAGG + Intergenic
1124244864 15:28060132-28060154 TGCCAGGCTCCTCAGGGTGCCGG + Intronic
1124374534 15:29121903-29121925 TGCCACTGTGGCCAGTGTGCTGG - Exonic
1126847360 15:52773274-52773296 TACCAGAGTTCCCACTGTGCAGG + Intronic
1127603701 15:60564558-60564580 TTCCTGTGTTCTAAGTCTGCTGG + Intronic
1128719308 15:69934664-69934686 TGCCAGTCTCCTCTGTGTTCTGG - Intergenic
1128875557 15:71198459-71198481 TGCAAGAATTCTCAGTGTCCTGG - Intronic
1129184937 15:73900196-73900218 TGCCTGGGTTCTCAGTGGCCCGG - Intergenic
1130507188 15:84556195-84556217 TGCCAGAGGTCAGAGTGTGCAGG - Intergenic
1130569011 15:85023812-85023834 TGACAGTGTTCCAAGTGTTCAGG + Intronic
1130682148 15:86006278-86006300 TCCAGGTGTTCTCAGTGTGGTGG + Intergenic
1132128230 15:99249384-99249406 TGCCAGTTTACCCAGTCTGCTGG + Exonic
1133403593 16:5506158-5506180 TGCCTGTCTTCACAGTGTTCCGG + Intergenic
1133448431 16:5882725-5882747 TGCCAGTGTTGTCCCTGGGCGGG + Intergenic
1134019916 16:10914348-10914370 GGCCAGTGTTCTCAGACTTCAGG + Intronic
1134096250 16:11420849-11420871 TGCCTGTGTACTGGGTGTGCGGG + Intronic
1137562450 16:49511394-49511416 TGCCTGTGTTCGCAGCCTGCGGG - Intronic
1138000004 16:53268275-53268297 TGCCAGTGTTATCAGTTTGGTGG + Intronic
1139836135 16:69840151-69840173 TGCCTTTGTTCTCCGTCTGCAGG - Exonic
1140973652 16:80038340-80038362 GGTCAGTTTTGTCAGTGTGCTGG + Intergenic
1141357251 16:83358985-83359007 TGCCATTTATGTCAGTGTGCTGG + Intronic
1141759785 16:86020530-86020552 TGTGAGTGTTCACTGTGTGCTGG + Intergenic
1142126422 16:88412894-88412916 TGCCACTGTGCTCCGTGTCCTGG + Intergenic
1142675104 17:1508669-1508691 AGCCAGTGTCGTCAGTGTTCTGG - Intronic
1144381674 17:14705114-14705136 GGCCAGTGGTCTTGGTGTGCTGG + Intergenic
1144751725 17:17653497-17653519 TGCCAGTGTGCTCTGCATGCCGG - Intergenic
1147557423 17:41488399-41488421 TGGCAGGGTTCTGTGTGTGCAGG - Exonic
1147570885 17:41570163-41570185 TGCGAGTGTTGTCAATGTCCAGG + Exonic
1149127475 17:53253870-53253892 TGCCAGTCTTCCCAGTGTCCTGG - Intergenic
1150133897 17:62684422-62684444 TCCAAGTGTTTTGAGTGTGCAGG + Intronic
1150321844 17:64221142-64221164 TCCAAGTGTTCTCATTGTTCAGG - Intronic
1159838407 18:73369146-73369168 TGCTTGTTTTCTCAGCGTGCAGG + Intergenic
1160403819 18:78630535-78630557 AGGCAGCGTGCTCAGTGTGCCGG - Intergenic
1163565544 19:18049034-18049056 GGCCAATGGTCTCGGTGTGCTGG - Intergenic
1164530681 19:29046108-29046130 TCCCAGTGCTCTCAGTGTGGGGG + Intergenic
1164731258 19:30506581-30506603 TGCCAATGTCCACAGTGTGGGGG - Intronic
1164840597 19:31389754-31389776 TGCCAGTGTTCTGTTTGTGGAGG + Intergenic
1165317229 19:35063950-35063972 TACCAGTGTTCACTATGTGCTGG - Intronic
1167851653 19:52206818-52206840 TTTCACTGTTCTCAGAGTGCTGG + Intronic
1168337936 19:55606785-55606807 ACACAGTGTTCTCACTGTGCGGG + Intronic
1202649540 1_KI270706v1_random:168110-168132 TGCCATTGTTTTTTGTGTGCTGG + Intergenic
925120788 2:1416066-1416088 TTCCAGTGTTCTCCATTTGCAGG - Intronic
929225422 2:39507235-39507257 TGCCAGGGTTCTCTATGAGCAGG + Intergenic
929751292 2:44716346-44716368 AGCCAGTGATCTTGGTGTGCTGG + Intronic
930930611 2:56877153-56877175 TGCCAGTCTTCCCAATGTCCTGG - Intergenic
932415485 2:71570981-71571003 TCCCAGTGTGATCTGTGTGCTGG - Intronic
934658747 2:96132029-96132051 TGCCAGTGGTGCCAGTGAGCAGG - Intronic
935414656 2:102802793-102802815 TGCCAGTGTCCTGAGTGTCCAGG - Intronic
937419700 2:121743496-121743518 TGCCAGTGGTCTTGGCGTGCTGG + Intronic
938593308 2:132761373-132761395 GACCAGTGGTCCCAGTGTGCTGG - Intronic
940154690 2:150643042-150643064 TGCCAGTATTGTCACTGTACTGG + Intergenic
943341912 2:186692405-186692427 TCCCAGTGTTTTCAATATGCTGG - Intergenic
944225634 2:197346272-197346294 TGTCCCTGGTCTCAGTGTGCAGG - Intergenic
945177300 2:207055385-207055407 TACCAGTGTCCTCTGTGTCCTGG - Intergenic
945581152 2:211596586-211596608 TCCCAGGGGTCTCAGGGTGCTGG - Intronic
946628097 2:221636614-221636636 TGTCCCTGTTCTCAGTGTGGTGG + Intergenic
948676577 2:239600549-239600571 TGCCTGTGGGCTCAGGGTGCTGG + Intergenic
1168856716 20:1013857-1013879 TGCCAGAGTTCCCAGTGGGAGGG + Intergenic
1170011397 20:11727894-11727916 TGCCAGTGTGCTCAGTGAGTGGG - Intergenic
1170414124 20:16121992-16122014 TGGCTGTGTTCTGTGTGTGCAGG + Intergenic
1171934148 20:31257650-31257672 TGGCAGCATTCTGAGTGTGCTGG - Exonic
1173292689 20:41728370-41728392 TGCCAGTGTTCCCCATGTCCTGG + Intergenic
1173843635 20:46174749-46174771 AGCCAGACTTCTCAGTGTTCAGG - Exonic
1174568019 20:51480962-51480984 TTGCAGTCTTCTCAGTGGGCTGG + Intronic
1179293669 21:40042070-40042092 TGGCTGTGTTCTCCCTGTGCTGG - Intronic
1179782353 21:43709787-43709809 ACCCAGTGTTGTCAGTGTTCTGG + Intergenic
1180501004 22:15928960-15928982 TGCCTGTAATCTCAGTGTTCTGG + Intergenic
1180926682 22:19559991-19560013 TTCCAGTGTTCTCTGTGTGGGGG + Intergenic
1182612408 22:31559879-31559901 GGCCAGTGGTCTTGGTGTGCTGG - Intronic
1183661219 22:39222572-39222594 CCCCAGTGTTCTCAGTTTCCAGG - Intergenic
1183844954 22:40535392-40535414 TGCCATTGTACTCAGTCTGGGGG - Intronic
1184483503 22:44762175-44762197 TGCCTGTGATCCCAGTGAGCCGG + Intronic
1184751400 22:46488458-46488480 TGCCAGTGAGCTCAGTGGGACGG + Intronic
1184786122 22:46672774-46672796 TGCCAGTCTACTCAGGGTGATGG - Intronic
1184987492 22:48145625-48145647 TGCCTGTTTTCTCACTGGGCTGG + Intergenic
949743250 3:7261022-7261044 TGCCAGTCTTCCCTGTGTCCCGG + Intronic
951334004 3:21399210-21399232 TGCCAGAGTTCACAGTTTGTGGG + Intergenic
954388115 3:50255008-50255030 TGCCAGAGTCCTCAATGTGGAGG - Intronic
954957343 3:54533255-54533277 TTGCATTGTTCTGAGTGTGCTGG + Intronic
955358710 3:58253745-58253767 GGCCAATGATTTCAGTGTGCTGG + Intronic
955744404 3:62125813-62125835 TGCCAATCTTCTCAAAGTGCAGG - Intronic
959056951 3:101576527-101576549 GGCCAGTGGTCTTGGTGTGCTGG + Intronic
959433497 3:106284504-106284526 TGCCAGTCTTCCCAATGTCCTGG - Intergenic
960875837 3:122294553-122294575 TGCCAGTGCTCCCCGGGTGCAGG - Intergenic
961769782 3:129240563-129240585 TGTCATTATTCTCAGTCTGCTGG + Intergenic
963851081 3:150211037-150211059 TGCCAGTGTTGTTAGTGTCAAGG - Intergenic
964869831 3:161301563-161301585 TGTCATTGTTCTCAATGTGAAGG - Intergenic
965663055 3:171062734-171062756 TGCCTGTGTTCTCCCTGTGTGGG - Exonic
966935761 3:184707816-184707838 CCCCAGTGTTCTCAGAGTGCTGG - Intergenic
967106555 3:186259288-186259310 TGCCAGTTTTGACAGTGGGCTGG + Intronic
969395901 4:6921111-6921133 TGCCAGTGTTCTCAGTGTGCTGG + Intronic
970584174 4:17499657-17499679 TGCCAGTAGTCTCAGTGCTCCGG + Intronic
974061761 4:57041990-57042012 TCCCAGCGTTCTCAGTGTCCAGG + Intronic
978804914 4:112789703-112789725 TGCCAGTGATCTCTGTGTTAGGG + Intergenic
978889114 4:113801213-113801235 TGCCAGTGGACTCAGTAAGCAGG - Intergenic
979158703 4:117430275-117430297 TGCCAGTCGTCTCAGTCTTCAGG + Intergenic
981511743 4:145565782-145565804 TGCCAGTCTTCCCAATGTCCTGG - Intergenic
981754604 4:148128547-148128569 TGCTTGTGTTCTCACTGTGGTGG - Intronic
982353612 4:154443444-154443466 TGACAGTCATCTCAGAGTGCAGG - Intronic
983064688 4:163194857-163194879 CTCCAGTGTCCTCAGGGTGCTGG - Intergenic
984234238 4:177137076-177137098 TGCCAGCTTTCTCAGTGGGGAGG + Intergenic
984509532 4:180661646-180661668 TGCCAACGTTTTCAGTGTGGAGG - Intergenic
986063710 5:4215659-4215681 TGCCAGTGTTACCTGTGTGATGG - Intergenic
986233744 5:5888513-5888535 TGCATGTGCTCTCTGTGTGCAGG + Intergenic
986387272 5:7247116-7247138 TCCCAGGTCTCTCAGTGTGCTGG + Intergenic
988240121 5:28597853-28597875 TCCAAGTGTTCTCATTGTTCAGG + Intergenic
988247467 5:28706048-28706070 TGCCAGAGTTTTCAGCCTGCTGG - Intergenic
989239019 5:39182227-39182249 TGCCAGTGTGAACAGAGTGCAGG + Intronic
990798749 5:59574796-59574818 AGCCATAGTTCTCAGTGTGATGG - Intronic
993741173 5:91541820-91541842 AGCCAGTATTCTCATTGTACTGG + Intergenic
994570848 5:101511873-101511895 TGCCTGTGCTGTCAGTGTGCTGG + Intergenic
996255337 5:121395135-121395157 TGCCTGTTTTCTCAGTGTCAAGG - Intergenic
996483437 5:124001820-124001842 TGCCAGCGTTTTCAGTATCCAGG + Intergenic
1002127833 5:177060085-177060107 TCCCAGTGCTCTCAGGGTGAAGG - Intronic
1002437100 5:179238408-179238430 TGCCAGTGCTCTGAGTATGCCGG + Intronic
1005367703 6:25095875-25095897 TGCCAGTGTCTTCAATCTGCTGG - Intergenic
1006313276 6:33276406-33276428 GGCCAGTGGTCTTGGTGTGCTGG - Exonic
1009579951 6:65519650-65519672 TGCAAGTGTTCTCAGTCACCTGG - Intronic
1013282767 6:108654184-108654206 TGCCAGGGTTCTCTGTGTGCCGG + Intronic
1013404293 6:109829557-109829579 TACCATTGTTCCCAGAGTGCAGG - Intergenic
1015788657 6:136944438-136944460 TGCTGGAGTTCTCAGTGGGCAGG + Intergenic
1016577452 6:145584845-145584867 TGCCAGTCTTCCCAATGTCCTGG + Intronic
1017728677 6:157295207-157295229 TGCCAGCCATCTCAGTGTTCTGG + Intronic
1018445286 6:163852764-163852786 TGCCAGTCCCCTCAGTGTTCTGG + Intergenic
1018630726 6:165819662-165819684 TGCCAAGGCTGTCAGTGTGCTGG + Intronic
1019280297 7:196397-196419 TGCCATTGTTCTCAGCTTGTAGG + Intronic
1019281868 7:204685-204707 TGCCGCTGTTCTCAGTGTTCAGG + Intronic
1019281885 7:204756-204778 TGCCACTGTTCTCTGTGCTCAGG + Intronic
1019281896 7:204827-204849 TGCCGCTGTTCTCAGTGTTCAGG + Intronic
1022039352 7:26565422-26565444 TGCCACCATCCTCAGTGTGCAGG - Intergenic
1023663158 7:42491347-42491369 TGCCAGTGACCTTGGTGTGCAGG + Intergenic
1024658286 7:51470812-51470834 GGCCAGACTTCTGAGTGTGCAGG + Intergenic
1025072500 7:55912752-55912774 TGCCAGTGTTCTCAGAATGTGGG + Intronic
1025320555 7:58088931-58088953 GGTCAGTGTGCCCAGTGTGCTGG + Intergenic
1025785960 7:64643500-64643522 TGTCAGTTATCTCAGTGGGCAGG - Intergenic
1026854412 7:73743483-73743505 AGCCAGTGTTCTCAAAGTGTTGG - Intergenic
1027266353 7:76497085-76497107 AGCCCGTGCCCTCAGTGTGCAGG - Intronic
1027317733 7:76995203-76995225 AGCCCGTGCCCTCAGTGTGCAGG - Intergenic
1027733675 7:81906442-81906464 TGCCAGTCTTTCCAGTGTCCTGG - Intergenic
1027934470 7:84585696-84585718 AGGCAGTGTTCTCAGTGTACAGG + Intergenic
1028639618 7:93028541-93028563 TGCCAGTCTTCCCAATGTTCTGG - Intergenic
1030179118 7:106686861-106686883 TGCCAGGCTTTTCAGGGTGCTGG + Intergenic
1031471228 7:122171739-122171761 TGTCAGTGGTCTCAGTGTTTTGG - Intergenic
1033915599 7:146321486-146321508 TGCTTTTGTTCTCAGTGTGGAGG - Intronic
1034529722 7:151688160-151688182 TGCCAGGGTGCCCAGTGAGCAGG + Intronic
1034833590 7:154331253-154331275 TGGCAGTGTTCTCAGTACGCAGG + Intronic
1035091542 7:156316962-156316984 TGCCAATCTCCTCAGTGTCCTGG + Intergenic
1037363059 8:18094461-18094483 TTCAGGTGTTGTCAGTGTGCTGG + Intergenic
1039431576 8:37529158-37529180 TGCCAGGGTTCTGGCTGTGCCGG - Intergenic
1040685086 8:49862021-49862043 GGCCAGTGTTTTCAGACTGCTGG - Intergenic
1041960642 8:63611661-63611683 TGCCAGTGTTATCTGTAAGCAGG - Intergenic
1042593798 8:70424163-70424185 GGCCAGTGGTCTTAATGTGCTGG + Intergenic
1044825917 8:96196918-96196940 TGCCAGTGCTATCACTGGGCAGG - Intergenic
1046525831 8:115381264-115381286 TGAAAGTATTGTCAGTGTGCTGG + Intergenic
1048290380 8:133176729-133176751 TGCTAGTATGCACAGTGTGCAGG - Intergenic
1049168137 8:141139754-141139776 TGCCACTGTTCCCAGTGTGCCGG + Intronic
1049536581 8:143185433-143185455 TGCCCCTGTCCTCAGTGTGAGGG - Intergenic
1050943353 9:11487501-11487523 TCTCAGTGTTGTCAGTGTGATGG + Intergenic
1053203884 9:36170626-36170648 GGACAGTGTACTCAGTGGGCGGG + Exonic
1053436863 9:38081508-38081530 TCCCCGTGTTCTAAGGGTGCCGG + Intergenic
1053896476 9:42746129-42746151 TTCCAGTGTTTTCAGAGAGCAGG - Intergenic
1054261426 9:62869236-62869258 TGACACTATTCTCAGTGTCCTGG + Intergenic
1056446373 9:86669997-86670019 TGCCAGTGGGCTCAGGGTCCTGG + Intergenic
1057921337 9:99100541-99100563 TCCCTGTGTTCTCATTGTTCAGG - Intergenic
1059242460 9:112818791-112818813 TGGCAGTTTTCTCAGTTTTCAGG + Intronic
1060138328 9:121180150-121180172 TCCCTGTGTTCACAGTGTGAGGG - Exonic
1060145770 9:121251084-121251106 TGCCTGTAATCTCAGTATGCTGG - Intronic
1061811516 9:133164840-133164862 GGCCTGTTTTCTCAGTCTGCAGG + Intergenic
1187509688 X:19906567-19906589 AGCCAGGGTTCTCACTGTGGAGG + Intergenic
1189219278 X:39357309-39357331 TGCGAGTGGTTTCAGTGTACGGG - Intergenic
1189994972 X:46629468-46629490 GCCCAGTGTTCCCAGTGCGCAGG + Intronic
1192693472 X:73390447-73390469 TGCCAGTCTTCTCAATGTCCCGG - Intergenic
1194519681 X:94902596-94902618 TGCCAGTCTTTTCAATGTCCTGG + Intergenic
1194774244 X:97943792-97943814 TGCCAGTCTTCCCAGTGTCCTGG - Intergenic
1196009721 X:110873832-110873854 TGCCAGAGTTTGCAGTGTACTGG + Intergenic
1200864923 Y:8033383-8033405 TCCCAGTGTTCCCAGTATGAAGG - Intergenic
1200902308 Y:8445080-8445102 TCCCAATGTTCCCAGTATGCAGG + Intergenic