ID: 969398254

View in Genome Browser
Species Human (GRCh38)
Location 4:6937367-6937389
Sequence GGCACTAATCCCACTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1174
Summary {0: 1, 1: 3, 2: 16, 3: 160, 4: 994}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969398247_969398254 25 Left 969398247 4:6937319-6937341 CCAGCACGTTCAGTGTCTGGTGA 0: 1
1: 36
2: 295
3: 788
4: 1470
Right 969398254 4:6937367-6937389 GGCACTAATCCCACTGGGGAGGG 0: 1
1: 3
2: 16
3: 160
4: 994

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969398254 Original CRISPR GGCACTAATCCCACTGGGGA GGG Intronic
900383891 1:2400409-2400431 GGCACCCATCCCAGTGGGGGAGG + Intronic
900681484 1:3919263-3919285 GCCACAAATAGCACTGGGGAGGG - Intergenic
900728466 1:4234980-4235002 GGCACTAATCCCATTAATGAGGG - Intergenic
900874181 1:5329851-5329873 GGCACTAATCCCATTCACGAGGG + Intergenic
901038117 1:6348539-6348561 GACACTAATCCCATTTGTGAGGG - Intronic
901941227 1:12663457-12663479 GGCACTAATCCCATTCATGAGGG + Intronic
902390240 1:16099625-16099647 GGCACTAATCCCATTCCTGAGGG - Intergenic
902652897 1:17848228-17848250 GGCACTAATCCCATTCATGAGGG + Intergenic
902799806 1:18822148-18822170 GGCACTAATCCCATTTGTGAGGG - Intergenic
903558866 1:24212791-24212813 GGCACTAATCCCATTCATGAGGG - Intergenic
903794256 1:25916736-25916758 GGCACTAATCCCATTCATGAGGG + Intergenic
904406165 1:30289711-30289733 CTCACCAATCCCAGTGGGGATGG + Intergenic
904868165 1:33599004-33599026 GGCACTAATCCCATTCATGAGGG + Intronic
904869867 1:33609949-33609971 GGAACTAATCCCATTTAGGAGGG - Intronic
905017669 1:34788635-34788657 GGCACTAATCCCATTCAGGAGGG - Intronic
905122727 1:35694234-35694256 GGCACTAATCCCATTTGTGAGGG - Intergenic
905235992 1:36548672-36548694 GGCACTAATCCCACTCACGAGGG - Intergenic
905403415 1:37718420-37718442 GGCGCTGATCCCGCTGAGGAGGG + Exonic
905426881 1:37892839-37892861 GGCACTAATCCCAATCATGAGGG - Intronic
905452964 1:38068701-38068723 GGCACTTCTGCCTCTGGGGAGGG - Intergenic
905474704 1:38217822-38217844 GGCAGTGATCTCACTGGGGAGGG + Intergenic
905994154 1:42366448-42366470 GGCACTAATCCCAATCGTGAGGG - Intergenic
906096702 1:43228944-43228966 GGCACAAATCCCATTTGTGAGGG + Intronic
906359569 1:45141830-45141852 GGCAGTAATCCCACGGTGGCTGG + Intronic
906370142 1:45247091-45247113 GGCACTGATCCCATTCGTGAGGG - Intronic
906651848 1:47518325-47518347 GGCACTAATCCCATTCATGAGGG - Intergenic
906830059 1:49021464-49021486 GGCACTAATCCCATTCATGAGGG - Intronic
907446641 1:54512367-54512389 GGCACTAATCCCATTTATGAGGG + Intergenic
907506979 1:54926260-54926282 GGCACTAATCCCACTTATGAGGG - Intergenic
907600998 1:55769336-55769358 GGCACTAATCTCACTCATGAGGG - Intergenic
907617044 1:55936197-55936219 GGCACTAATCCCATTCATGAGGG + Intergenic
907665344 1:56429474-56429496 GGCACTAATCCCACTTACGAGGG - Intergenic
907698963 1:56764930-56764952 GACACTAATCCCATTTGAGAGGG + Intronic
907869437 1:58430037-58430059 GGCACTAATCCCATTCAAGAGGG + Intronic
907934727 1:59032064-59032086 GGCACTAATCCCAGTTGTGAGGG - Intergenic
908429333 1:64040732-64040754 GGGACTAATCCCATTCGTGAAGG + Intronic
908506762 1:64810470-64810492 AGCACTAATCCCACTCTTGAGGG + Intronic
908540875 1:65120856-65120878 GGCACTAATCCCACTCGAAAGGG - Intergenic
908584809 1:65556084-65556106 GGCACTAATCCCATTCATGAGGG - Intronic
908719409 1:67108353-67108375 GTCACTAATCCCATTCGTGAGGG + Intronic
908810250 1:67974962-67974984 GGCACTAATCCCATTCATGAAGG + Intergenic
908900529 1:68951273-68951295 GGCACTAATCCCATTCATGAGGG - Intergenic
908949740 1:69545750-69545772 GGCACTAATCCCATTCATGAGGG + Intergenic
909366415 1:74828541-74828563 GGCACTAATCCCATTCATGAGGG + Intergenic
909395184 1:75163845-75163867 GGCACTAATCCCATTTGCAAGGG - Intergenic
909694730 1:78454181-78454203 AACACTGATCACACTGGGGAGGG - Intronic
910399087 1:86820749-86820771 GGCACTGATCCCACTCATGAGGG + Intergenic
911062652 1:93761398-93761420 GGTATTAATCTCAGTGGGGAAGG - Intronic
911377544 1:97069578-97069600 GGCACTAATCCCATTCACGAGGG + Intergenic
911792676 1:102038518-102038540 GGCACTAATCCGATTTGTGAGGG + Intergenic
911829221 1:102529735-102529757 GGCACTAATCCCACTATTGAGGG + Intergenic
911885443 1:103291811-103291833 GGCACTAATCCCATTCACGAGGG + Intergenic
912397621 1:109359256-109359278 GGGACTAATCCCACTGGTGAAGG + Intronic
912508734 1:110174239-110174261 GAGACCATTCCCACTGGGGAAGG - Intronic
912585716 1:110762987-110763009 GGCACTAATCCCACTCATTAGGG + Intergenic
913090221 1:115471702-115471724 GGCACTAATCCCATTCTTGATGG - Intergenic
913183107 1:116341910-116341932 GGCACTGATCCCATTTGTGAGGG - Intergenic
914077501 1:144369122-144369144 GGCACTAATCCCATTCATGAGGG + Intergenic
914101678 1:144597383-144597405 GGCACTAATCCCATTCATGAGGG - Intergenic
914172408 1:145237662-145237684 GGCACTAATCCCATTCATGAGGG + Intergenic
914297286 1:146340128-146340150 GGCACTAATCCCATTCATGAGGG + Intergenic
914355957 1:146884838-146884860 GGCACTGGTAGCACTGGGGATGG - Intergenic
914639345 1:149588470-149588492 GGCACTAATCCCATTCATGAGGG - Intergenic
914747691 1:150511756-150511778 GGCACTGATCCAGCTGGAGAGGG + Exonic
915012780 1:152704638-152704660 GGCACTAATCCCATTCATGAAGG + Intergenic
915595198 1:156893193-156893215 GCCCCTAATCGCACTGCGGAAGG - Intergenic
915718668 1:157967414-157967436 GGCACTAATCCCATTCATGAGGG - Intergenic
916145787 1:161738095-161738117 GGCAATAAGCCCAATGGGGCTGG - Intergenic
916406886 1:164506711-164506733 GGCACTAATCCCACTCATGAGGG - Intergenic
917159897 1:172045467-172045489 GGCACTAATCCCATTCATGAGGG + Intronic
917481211 1:175413808-175413830 GGCACTAATCCCATTCATGAGGG - Intronic
917685942 1:177416214-177416236 GGCACTACTCCCATTCAGGAGGG - Intergenic
917724558 1:177816359-177816381 GGCACTAATCCCATTCATGAGGG - Intergenic
917794825 1:178525778-178525800 GGCACTAATTCCATTCGTGAGGG + Intronic
918041957 1:180919029-180919051 GGCACTAATCCCATTCATGAGGG + Intronic
918759649 1:188386723-188386745 GGCAGTAATCCCATTCGTGAAGG - Intergenic
918798173 1:188933095-188933117 GGCACTAATCCCATTCATGAGGG + Intergenic
918977702 1:191512378-191512400 GACACTAATCCCATTTGTGAGGG - Intergenic
919024143 1:192146618-192146640 GGCACTAATCCCATTCGTGAGGG - Intergenic
919481359 1:198093886-198093908 GGCACTAATCCCATTCATGAAGG + Intergenic
919569133 1:199223814-199223836 GGCACTAATCCCATTCATGAGGG + Intergenic
919630650 1:199957181-199957203 GGCACTAATCCCATTCATGAGGG - Intergenic
920582572 1:207125520-207125542 GGCACTAATCCCATTCATGAGGG - Intronic
920867090 1:209762279-209762301 GGCACTAATCCCATTCATGAGGG + Intronic
921033131 1:211351348-211351370 GGCACTAATCCCATTCATGAGGG + Intronic
921410346 1:214829755-214829777 GGCACTAATCCCATTTGTAAGGG + Intergenic
921681791 1:218042175-218042197 GGCACTAATCCCATTCACGAGGG - Intergenic
921730706 1:218575154-218575176 GGCACTAATCCCATTTTTGAGGG + Intergenic
921918530 1:220641325-220641347 GGCACTAATCCCATTCGTGAGGG - Intronic
921941196 1:220841671-220841693 GGCACTAATCCCATTAATGAGGG - Intergenic
922031541 1:221805161-221805183 GGCACTAATTCCACTTATGAAGG + Intergenic
922199715 1:223391807-223391829 GGCACTAATCCCATTGATGAGGG + Intergenic
922224656 1:223634738-223634760 GGCACTAATCCCATTGATGAGGG + Intronic
922348574 1:224717357-224717379 GGCACTAATCCCATTCATGAGGG + Intronic
922616086 1:226961953-226961975 GGCACCAATCCCATTGAGGAGGG + Intronic
922618969 1:226979187-226979209 GACACTCATCCCACTGAGGTTGG + Intronic
923003144 1:230024073-230024095 GGCACTAATCCCACTCATGAGGG + Intergenic
923492022 1:234492538-234492560 GGCACTAATCCCATTTATGAGGG + Intergenic
923767015 1:236901752-236901774 GGCACTAATCCCATTCATGAGGG + Exonic
923775790 1:236977451-236977473 GGCACTAATCCCACTAGTCACGG + Intergenic
924163355 1:241256737-241256759 GGCACTAATCCCAACCAGGAGGG + Intronic
924209334 1:241748541-241748563 GGCACTAATCCCATTCATGAGGG + Intronic
924415639 1:243853428-243853450 GGCACTAATCCCATTCTTGAGGG + Intergenic
924721652 1:246628669-246628691 GGCACTAATCCCATTCATGAGGG + Intronic
1063345027 10:5303696-5303718 GGCACTAATCCCATTCATGAGGG - Intergenic
1063361746 10:5465076-5465098 GGCTCTAATCCCACCTGTGAGGG - Intergenic
1063728881 10:8672552-8672574 GGCACTAATCCCATTCATGAGGG + Intergenic
1063909402 10:10814138-10814160 GGCACTTATCCCTTTGGGGAAGG + Intergenic
1063960210 10:11300431-11300453 GGCACCAATGTCTCTGGGGAAGG + Intronic
1063971456 10:11384079-11384101 GGCACTAATCCCATTGATCAGGG + Intergenic
1064177924 10:13091339-13091361 GGCACTAATCTCATTTGTGAGGG - Intronic
1064352205 10:14586518-14586540 GGCACTAATCCCATTCATGAGGG - Intronic
1064496177 10:15912617-15912639 GGCACTAATCCCACTCATTAGGG - Intergenic
1064541206 10:16406792-16406814 GGCACTAATCCCATTCATGAAGG - Intergenic
1064742120 10:18444201-18444223 GGCACTAATCCCATTCATGAGGG - Intronic
1064829874 10:19450904-19450926 GGCACTAATCCCATTCATGAGGG + Intronic
1064856471 10:19773813-19773835 GGCACTAATCCCATTCATGAGGG + Intronic
1065350940 10:24795168-24795190 GGCACTAATCCCAATCATGAAGG - Intergenic
1065792287 10:29271879-29271901 GGCACCAATCCCATTCGTGAAGG - Intergenic
1065881878 10:30044019-30044041 GGCACCAATCCCACCTAGGAGGG - Intronic
1066008078 10:31166272-31166294 GGCACAAATCCCACTCCTGAGGG - Intergenic
1066273484 10:33846001-33846023 GGCACTAAACAGACTTGGGATGG - Intergenic
1066533675 10:36366935-36366957 GGCACTAATCCCATTCATGAAGG - Intergenic
1066680110 10:37929993-37930015 AGCACTAATCCCATTTGTGAGGG + Intergenic
1067560083 10:47299347-47299369 GTCACTAATACCACTGTGGTTGG + Intergenic
1068345344 10:55770619-55770641 GACACTAATTCCACTGATGAGGG - Intergenic
1068886611 10:62104413-62104435 GGCACTCATCCCACTCACGAGGG + Intergenic
1069730264 10:70606957-70606979 GGCACTAATCCCATTCATGAAGG - Intergenic
1069730710 10:70610246-70610268 GGCACTAATCCCACTCATGAGGG - Intergenic
1069747562 10:70725616-70725638 GACACTAATCCCATTCAGGAGGG + Intronic
1070104771 10:73421082-73421104 GACACTAATCCCACTCATGAGGG - Intergenic
1070199844 10:74193412-74193434 AACACTAATCACACTGGGGTGGG - Intronic
1070387244 10:75936756-75936778 GGCACTAATCCCATTCAGGGGGG + Intronic
1070578908 10:77704019-77704041 GGCACTAATCCCATTTGGAAGGG - Intergenic
1070944116 10:80374631-80374653 GGCACTAATCCCATTCATGAGGG + Intergenic
1071379553 10:85044562-85044584 GGCACTAATCCCAATTATGAGGG + Intergenic
1071966932 10:90860777-90860799 GGTACTAATCCCATTCAGGAGGG + Intergenic
1072254440 10:93607725-93607747 GGCACTAATACCACTTGTGAGGG + Intergenic
1072528337 10:96294805-96294827 GGCACTAATCCCGTTCAGGAGGG - Intergenic
1072716387 10:97755553-97755575 GGCACTAATCCCATTCACGAGGG + Intronic
1072806153 10:98425085-98425107 GGCCCTAAGCTCACTGGGGGTGG + Intronic
1073168518 10:101480566-101480588 GGCACTAATCCCACTTACAAGGG + Intronic
1073640731 10:105250171-105250193 GGCACTAATCCCATTCATGAGGG + Intronic
1074146260 10:110720069-110720091 GGCACTAATCCCAGTTATGAGGG + Intronic
1074423602 10:113331083-113331105 GACACTAATCCCACTCATGAGGG + Intergenic
1074489553 10:113926978-113927000 GGCACTAATTCCATTCGTGAGGG - Intergenic
1074614078 10:115048840-115048862 GGCACTAATCCCATTCATGAGGG - Intergenic
1075196392 10:120362954-120362976 GGCACTAATCCCATTCACGAGGG - Intergenic
1075272763 10:121067711-121067733 GGCACTAATCCCATTCATGAGGG + Intergenic
1075580725 10:123616145-123616167 GGCACTAATCCCACTCATGAGGG - Intergenic
1076130965 10:128013646-128013668 GGCACTAATCCCATTCAAGAGGG - Intronic
1076295527 10:129380914-129380936 GGCATTAATCCCACTCCCGAGGG - Intergenic
1076919124 10:133442154-133442176 GGCACTGAGCCGGCTGGGGAGGG - Intergenic
1076935206 10:133564172-133564194 GGCACTAATCCCATTGCTGAGGG - Intronic
1077964896 11:7119222-7119244 GGTACTAATCCCACTCTTGAGGG - Intergenic
1077993587 11:7433638-7433660 GGCACTAATCCCATTCATGAAGG - Intronic
1078739247 11:14051211-14051233 GGCACTAATCCCATTTTTGAGGG - Intronic
1080062857 11:27975362-27975384 GGCACTAATCCCATTCATGAGGG - Intergenic
1080231540 11:30021787-30021809 GGCACTAATCCCATTCGTAAGGG + Intergenic
1080260533 11:30344985-30345007 GGCACTAATCCCATTCATGAAGG + Intergenic
1080406123 11:31980920-31980942 GGCACTAATCCCACTCAAGAGGG + Intronic
1080412100 11:32035366-32035388 GGCACTAATCCCATTCATGAGGG + Intronic
1080823937 11:35832246-35832268 GGCACTAATCCCATTCATGAGGG - Intergenic
1080878062 11:36294720-36294742 GGCACTAATCCCATTCATGAGGG + Intergenic
1080970347 11:37266879-37266901 GACACTAATCCCATTTGTGAGGG + Intergenic
1081301971 11:41463558-41463580 GGCACTAATCCTACTTAAGAGGG - Intergenic
1081418259 11:42841252-42841274 GGCACTAATCCCATTCATGAGGG - Intergenic
1082095550 11:48126638-48126660 GGCACTAATACCATTCAGGAGGG + Intronic
1082990620 11:59204796-59204818 GGCTCTAATCTCACTGGCCATGG + Exonic
1083541962 11:63517721-63517743 GGCACTAATCCCATTCATGAAGG - Intergenic
1084058283 11:66651856-66651878 GGCACAAATCCCATTGATGAGGG + Intronic
1084080923 11:66824213-66824235 GGCACTAATCCCATTCATGAAGG - Intronic
1084654962 11:70509749-70509771 GGCACTAATCCCATTCACGAAGG - Intronic
1085308869 11:75504278-75504300 TGCAGCAATCCCACTGGGCACGG + Intronic
1085459439 11:76684653-76684675 GGCACTAATCCCATTTGTGAGGG + Intergenic
1086307198 11:85494084-85494106 GATACTAATCCCACTTGTGACGG + Intronic
1086769015 11:90737512-90737534 GGCCCTAATCCCACTGCTCATGG - Intergenic
1086937510 11:92761307-92761329 GGCACTAATCCCATTCATGAGGG + Intronic
1086975344 11:93125949-93125971 GGCACTAATCCCATTCATGAGGG + Intergenic
1087500814 11:98951407-98951429 GGCACTAATCCCACTCATGAGGG + Intergenic
1087629834 11:100637029-100637051 GGCACTAATCCCATTCATGAAGG - Intergenic
1087676543 11:101169123-101169145 GGCACTAATCCCATTCTTGAGGG - Intergenic
1087924059 11:103899163-103899185 GGCACAAATGACACTGGGCAGGG + Intergenic
1087962482 11:104369009-104369031 GGCACTAATCTCATTAGTGAAGG - Intergenic
1088131731 11:106499616-106499638 GGCACTAATCCCATCTGTGAGGG + Intergenic
1088427748 11:109723497-109723519 GGCACTAATCCCATTCATGAAGG + Intergenic
1088969462 11:114760201-114760223 GGCACTAATCCCATTTATGAGGG - Intergenic
1089071948 11:115707423-115707445 GGCACTAATCCCACTCATCAGGG + Intergenic
1089287134 11:117414864-117414886 GGCACTAATCCCAGTCATGAGGG + Intergenic
1089658786 11:119972132-119972154 GGCACTAATCCCATTCAGGAGGG - Intergenic
1089663238 11:119999376-119999398 GGCTCTAATCCCATTTAGGAGGG - Intergenic
1090302948 11:125662333-125662355 GGCACTAATTCCATTCAGGAAGG + Intronic
1090742832 11:129681825-129681847 GGCACGACTCCCACTCGTGAGGG - Intergenic
1090965351 11:131593210-131593232 GGAACTAATGGCACTGGGGAAGG - Intronic
1091848355 12:3675470-3675492 GGCACTAGTCCCATTTGTGAGGG - Intronic
1091994805 12:4985023-4985045 GGCAGTAAGGCCCCTGGGGAGGG + Intergenic
1092311122 12:7354810-7354832 GGCACTAATCCCATTCATGAGGG + Intronic
1092696343 12:11175816-11175838 GGCACTAATCCCATTCACGAGGG - Intergenic
1092928642 12:13294730-13294752 GGCACTAATCCCACTGGTGAAGG - Intergenic
1092932724 12:13332105-13332127 GGCACTAATCCCATTCATGAAGG + Intergenic
1093211498 12:16314313-16314335 GGCACTAATCCCACTTATCAAGG + Intergenic
1093241948 12:16687479-16687501 GGTACTAATCCCATTCAGGAGGG + Intergenic
1093747175 12:22755340-22755362 GGCACTAATCCCATTCTTGAGGG - Intergenic
1094031089 12:26011646-26011668 GGCACTAATCCCATTTATGATGG - Intronic
1094628565 12:32149844-32149866 GGCACTAATCCCATTCATGAAGG + Intronic
1095343138 12:41116496-41116518 GGCACTAATCTCACCTAGGATGG - Intergenic
1095552131 12:43455515-43455537 GGCATTAAACCCACCGGTGAGGG + Intronic
1095563408 12:43592056-43592078 GGCACTAATCCCATTCATGAGGG + Intergenic
1095903095 12:47348768-47348790 GGCACTAATCCCACTCATGAGGG - Intergenic
1095938688 12:47711763-47711785 GGTAAGAATCCCACTGTGGAGGG + Exonic
1096027182 12:48376772-48376794 GCCACAAATCCCCATGGGGAAGG - Intergenic
1096055360 12:48646255-48646277 GGCACTAATCCCATTCATGAAGG - Intergenic
1097724781 12:63063051-63063073 GGCACTAATCCCATTCATGAGGG + Intergenic
1097833017 12:64245481-64245503 GGCACTAATCCCACTTTTGAGGG - Intergenic
1098136879 12:67412522-67412544 GGCACTAATCCCAATCATGAGGG + Intergenic
1098300440 12:69048586-69048608 GGCACTAATCCCATTCATGAGGG + Intergenic
1098536381 12:71597912-71597934 AGCACTAATCCCATTGATGAGGG - Intergenic
1098857137 12:75665614-75665636 GGCACTTATCCCATTAGGGAGGG + Intergenic
1099231808 12:80035386-80035408 GGCACTAATCCTATTCGTGAGGG + Intergenic
1099274955 12:80563353-80563375 TGCCCTAATCCCACTCGTGAGGG + Intronic
1099274967 12:80563408-80563430 GGCCCTAATCCCACTCGTGAGGG + Intronic
1099672676 12:85715140-85715162 AACACTAATCCCATTTGGGAGGG + Intergenic
1100062625 12:90600057-90600079 GGCACTAATCCCACTCATGAGGG - Intergenic
1100147531 12:91696554-91696576 GTCACAAATCCCACGGAGGAAGG - Intergenic
1101039859 12:100744488-100744510 GGCACTAATCCCATTTATGAGGG + Intronic
1101235715 12:102787346-102787368 GGCACTAATTCAACTCGTGAGGG - Intergenic
1101363257 12:104047626-104047648 GGCACTAATCCCATTGGTGATGG + Intronic
1101412029 12:104477566-104477588 GGCACTAATCCCATTCATGAGGG - Intronic
1101512666 12:105407012-105407034 GGCATTAATCCCACTCATGAGGG - Intergenic
1101733653 12:107446659-107446681 GGCATTAGTCACTCTGGGGATGG - Intronic
1101774582 12:107781959-107781981 GGCACTAATCCCACTCATGAGGG - Intergenic
1102414315 12:112747256-112747278 AGCACTAATCCCACTCATGAGGG - Intronic
1102553443 12:113709967-113709989 GGCACTAATCCCATTCCTGAGGG - Intergenic
1102817678 12:115880916-115880938 GGCACTAATCTCATTCGTGAGGG - Intergenic
1103093314 12:118113057-118113079 GGCACTAATCCCATTCATGAGGG - Intronic
1103222134 12:119254781-119254803 GGCACTAATCCCATTCATGAAGG + Intergenic
1103426773 12:120842700-120842722 GGCACTAATCCCATTAACGAGGG + Intronic
1103843484 12:123884589-123884611 GGCACTAATCCCATTCGTGAGGG + Intronic
1104402242 12:128485678-128485700 GGCACTACTGACATTGGGGATGG - Intronic
1104532615 12:129586620-129586642 GGCACTAATCCCATTCCTGAGGG + Intronic
1104695700 12:130862161-130862183 GGCACTAATCCTATTCGTGAGGG + Intergenic
1104890886 12:132139594-132139616 GGCATGAAACCCTCTGGGGAGGG - Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1105716845 13:23074950-23074972 GGCACTAATCCCATTCATGAGGG + Intergenic
1105832627 13:24177763-24177785 GGCTCTAATCCCATTCAGGAGGG + Intronic
1106427990 13:29651573-29651595 GGTGCTAATCCCACTTGTGACGG + Intergenic
1106550763 13:30768995-30769017 GGCACTAATACCACTCATGAGGG + Intergenic
1107076455 13:36326099-36326121 GGGACTAATCCCATTGATGAGGG + Intronic
1107095162 13:36527891-36527913 GGCACTAATCCCATTCATGAGGG + Intergenic
1107301778 13:38973550-38973572 GCCACTAATTCCACTCGTGAGGG + Intronic
1107455411 13:40550229-40550251 GGCACTAATCCCATTCATGAGGG + Intergenic
1107555367 13:41513103-41513125 GGCACTAATCCCATTCATGAGGG + Intergenic
1107603523 13:42037702-42037724 GGCACTAATCCCATTTATGAGGG + Intergenic
1107930354 13:45301957-45301979 GGCACTAATCCCATTCATGAGGG + Intergenic
1108056170 13:46487581-46487603 GGCACTAATCCCATTAATGAGGG + Intergenic
1108057041 13:46495355-46495377 GGCACTAATCCCATTAATGAGGG + Intergenic
1108531692 13:51332674-51332696 GGCACTAATCCCATTCATGAGGG - Intergenic
1108601682 13:52000372-52000394 GGCACTAATCCCATTCGAGAAGG + Intronic
1108606065 13:52039941-52039963 GGCACTGATCCCACTCATGAGGG - Intronic
1109278628 13:60330287-60330309 GGCACTAATCCCACTCATGAGGG + Intergenic
1109778368 13:67074249-67074271 GGCACTAATTCCATTGACGAGGG - Intronic
1110272285 13:73604376-73604398 GGCACTAATCCCATTCGGGAGGG + Intergenic
1110539254 13:76689376-76689398 GGCACTAATCCCATTTATGAGGG + Intergenic
1110844234 13:80175684-80175706 GGCACTAATCCCATTCATGAGGG + Intergenic
1110925330 13:81143506-81143528 TGCACTAATCCCACTCATGAAGG + Intergenic
1111008811 13:82285450-82285472 GGCACTAATCCTACTCATGAGGG - Intergenic
1111151324 13:84257041-84257063 GGCACTAATCCCATTCATGAGGG + Intergenic
1111473321 13:88715083-88715105 GGCACTAATCCCATTCATGAGGG - Intergenic
1112169909 13:96960533-96960555 GGCACTAATCCCATTCAAGAGGG - Intergenic
1112217193 13:97445061-97445083 GGCACTAATCCCATTCATGAGGG + Intronic
1112724724 13:102290210-102290232 GGCACTAATCCCATTTGTGAGGG - Intronic
1113298924 13:108995290-108995312 GGCACTAATCTCACTCGGGATGG + Intronic
1113395906 13:109947363-109947385 GCCACTAATCCCATTTGTGAGGG + Intergenic
1114168451 14:20246380-20246402 GGCACTAATCCCATTCAGGAGGG - Intergenic
1115052763 14:29084612-29084634 AGCCCTAATGACACTGGGGAAGG - Intergenic
1115106655 14:29769994-29770016 GGCACTAATCCCATTCATGAGGG - Intronic
1115649438 14:35392311-35392333 GGAACTAATCCCATTCAGGAGGG - Intergenic
1115673654 14:35645194-35645216 GGCACTAATCCCATTGATGAGGG + Intronic
1115790396 14:36871209-36871231 GGCACTAATCCCATTCCTGAGGG - Intronic
1116168527 14:41366534-41366556 GGCACCAGTCTCACTAGGGAGGG + Intergenic
1116435163 14:44887823-44887845 GACACTAATCCCATTTGTGAGGG + Intergenic
1116438042 14:44915884-44915906 GGCACTAATCCCATCCAGGAGGG - Intergenic
1116753141 14:48911696-48911718 GACACTAATCCCATTGAAGAGGG + Intergenic
1116786045 14:49289790-49289812 GGCACTAATCCCATTCATGAAGG - Intergenic
1117224371 14:53639453-53639475 GGCACTAATCCCATTCACGAGGG - Intergenic
1117435147 14:55708772-55708794 GGCATTAATCCCATTCGTGATGG + Intergenic
1117532996 14:56677044-56677066 GGCACTAATCCCATTGATGAGGG + Intronic
1117816714 14:59606440-59606462 GGCACTAATCCCATTTGTGAGGG - Intronic
1117831675 14:59757598-59757620 GGCACTAATCCCATTTATGAGGG - Intronic
1118053332 14:62052707-62052729 GGCACTAATCCCACTCATGAGGG - Intronic
1118074580 14:62284064-62284086 GGCACTAATCCCACCCACGAGGG - Intergenic
1118148044 14:63162048-63162070 GGCACTAATCCCATTCATGAGGG - Intergenic
1118515303 14:66521679-66521701 GGCACTAATCCCATTTATGAGGG + Intronic
1119036387 14:71233081-71233103 GGCACTAATCCCATTTACGAGGG - Intergenic
1119140578 14:72263613-72263635 GGCACTAATCCCAATCATGAGGG - Intronic
1119161783 14:72458826-72458848 GGCACTAATCTCACCTGTGAGGG + Intronic
1119680097 14:76585663-76585685 GGCACTAATCCCACTCATGAGGG + Intergenic
1119866353 14:77978382-77978404 GGCACTAATCCCATTCATGAAGG + Intergenic
1119882546 14:78112457-78112479 GGCATTAATCCCACTCATGATGG - Intergenic
1119894724 14:78210324-78210346 GGCACTAATCCCATTCATGAAGG + Intergenic
1119942443 14:78655971-78655993 GGCACCAATCCCACTCATGAGGG + Intronic
1119944102 14:78673729-78673751 GGCGCTAATCCCACTCATGAGGG + Intronic
1120073984 14:80135008-80135030 GGCACTAATCCCATTAATGAGGG + Intergenic
1120394655 14:83953986-83954008 GGCACTAATCCCATTTTGGGGGG - Intergenic
1120415913 14:84217581-84217603 GGCACTAATCCCATTCATGAAGG - Intergenic
1121144279 14:91570179-91570201 AGCACTAATCCCATTCTGGAGGG + Intergenic
1121264186 14:92588547-92588569 GGCACTAATCCCATTCATGAGGG + Intronic
1121277954 14:92680517-92680539 GGCACTAATCCCATTTATGAGGG + Intronic
1121356072 14:93216147-93216169 GGCACTAATCCCATTCACGAGGG - Intronic
1121379973 14:93456497-93456519 GGCTCTAATCCAACAGAGGAAGG + Intronic
1121835087 14:97085111-97085133 GGCACTAATCCCATTCATGAGGG + Intergenic
1121884712 14:97532868-97532890 GGCACTAATCCCACTGATGGAGG + Intergenic
1121946129 14:98124219-98124241 GGCACTAATCCCATTCATGAGGG - Intergenic
1122171217 14:99877232-99877254 GGCACTAATTCCACTCATGAGGG + Intronic
1122281518 14:100625589-100625611 GGCACTAATCCCATTTGTGAAGG + Intergenic
1122369544 14:101221745-101221767 GGCACTAATCTCATTCGTGAGGG - Intergenic
1122438518 14:101714592-101714614 GGCACTAATCCCATTCATGAGGG + Intergenic
1122517821 14:102320748-102320770 GGAAATAAACCCACTGGGAAAGG - Intronic
1122709081 14:103642248-103642270 GGCACTAATCCCACCGTGAGGGG + Intronic
1122965236 14:105120679-105120701 GGCACTAAACCCACTCATGAAGG - Intergenic
1202848894 14_GL000225v1_random:3340-3362 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202850118 14_GL000225v1_random:11134-11156 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202850622 14_GL000225v1_random:15778-15800 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202853004 14_GL000225v1_random:32807-32829 TGCACTGATCACCCTGGGGAGGG - Intergenic
1202857770 14_GL000225v1_random:62170-62192 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202859078 14_GL000225v1_random:70459-70481 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202863367 14_GL000225v1_random:99307-99329 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202864488 14_GL000225v1_random:106268-106290 TGCACTGATCACCCTGGGGATGG - Intergenic
1202866517 14_GL000225v1_random:122697-122719 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202866969 14_GL000225v1_random:127028-127050 TGCACTGATCACCCTGGGGAGGG + Intergenic
1202889267 14_KI270722v1_random:140450-140472 TGCACTAATCCCAATCAGGATGG + Intergenic
1124060885 15:26292833-26292855 GGCACTAATCCCATTCATGAGGG - Intergenic
1124095992 15:26649235-26649257 GGCACTAATCCCTTTTGTGAGGG - Intronic
1124177068 15:27436277-27436299 GGCACTAATCCCACTTGTGGGGG + Intronic
1124465912 15:29939732-29939754 GGCACTAATCCCATTCATGAGGG - Intronic
1124508730 15:30304137-30304159 GGCACTGCTCCCTCTGGTGATGG - Intergenic
1124649258 15:31462951-31462973 GGCAGGACTCCCTCTGGGGAGGG - Intergenic
1124734828 15:32234525-32234547 GGCACTGCTCCCTCTGGTGATGG + Intergenic
1125408800 15:39383371-39383393 GGCACTAATCCCATTCATGAGGG + Intergenic
1125549489 15:40534737-40534759 GGCACTAATCCCATTGATAAAGG + Intronic
1126461787 15:48922560-48922582 ATCACTAATCCCACTCGTGAGGG + Intronic
1126471873 15:49021090-49021112 GTCACTAATCCCATTTGTGATGG - Intronic
1126573893 15:50179657-50179679 GGCACTAATCCCATTCATGAGGG - Intronic
1126591757 15:50347106-50347128 AGCACTAATCCCACTCCTGAGGG + Intronic
1126644638 15:50862639-50862661 GGCACTAATCCCATTCCTGAAGG - Intergenic
1127174573 15:56339769-56339791 GGCACTAATCCCATTCATGAAGG - Intronic
1127340792 15:58041641-58041663 GACACTAATCCCACTCATGAGGG + Intronic
1127399240 15:58569646-58569668 GGCACTAATCCCACTTATGAGGG - Exonic
1127517648 15:59711877-59711899 AGCACTACTCCCACTGGAGAGGG - Intergenic
1127733796 15:61823222-61823244 GACACTAATCCCACTTAAGAAGG - Intergenic
1128643643 15:69359160-69359182 AGCACTAATCCCACTCGTAAGGG + Intronic
1129110602 15:73334950-73334972 GGCACTCATCCCACTCATGAGGG - Intronic
1129163522 15:73761529-73761551 GGCACTAATCCCATTTGTGAAGG - Intergenic
1129666757 15:77583492-77583514 GGCACTAATCTCACTTGTGAGGG - Intergenic
1129751995 15:78072023-78072045 GGCACTAATCCCATTCGTGAAGG + Intronic
1129946589 15:79543744-79543766 GGCACTACTCCCACTCATGAGGG + Intergenic
1130186369 15:81687544-81687566 GGCACTAATCCCATTTATGAGGG - Intergenic
1130230543 15:82093527-82093549 GGCACTAATCCTATTTGTGAGGG + Intergenic
1130554629 15:84914256-84914278 GGCACTAATCCCATTCATGAGGG + Intronic
1130921149 15:88345735-88345757 GTTACTAATCCCACTGAAGAGGG + Intergenic
1130971541 15:88737558-88737580 GGCACTAATCCCACTTGTGAGGG - Intergenic
1131161526 15:90108051-90108073 GGCACTAATCCCATTTATGAAGG - Intergenic
1131372372 15:91893534-91893556 GGCACTAATCCCATTCATGAGGG + Intronic
1131454043 15:92569540-92569562 GGCACTAATCCCATTCATGAGGG - Intergenic
1131977082 15:97957736-97957758 GGCACTAGTCCCACTCATGAGGG + Intergenic
1132063491 15:98711989-98712011 GGCACTAATCCCATTTGTGAGGG + Intronic
1132066159 15:98732874-98732896 GGGAGTTATCCCAGTGGGGAAGG + Intronic
1132783632 16:1642286-1642308 GGCACTGCTCCCACTGGGGCAGG - Intronic
1133451614 16:5908847-5908869 GACACTAATCCCACTCATGAAGG - Intergenic
1133537608 16:6716959-6716981 GGCACTAATCCCATTTGTGAGGG - Intronic
1133549518 16:6840567-6840589 GGCACTAATCCCATTCATGAGGG - Intronic
1133563438 16:6970630-6970652 GGCACTAATCCCATTTGTGAGGG + Intronic
1133760023 16:8791164-8791186 GGCACTAATCCCATTCATGAGGG - Intronic
1134186881 16:12091462-12091484 GGCACTAATCCCACTCATGAGGG - Intronic
1134503939 16:14790449-14790471 GGCACTAATCCCATTCATGAAGG - Intronic
1134557475 16:15177891-15177913 GGCACTAATCCCATTCATGAGGG + Intergenic
1134576633 16:15338459-15338481 GGCACTAATCCCATTCATGAAGG + Intergenic
1134725806 16:16418040-16418062 GGCACTAATCCCATTCATGAAGG - Intergenic
1134782728 16:16913313-16913335 AGCACTAATCCCACTCATGAGGG - Intergenic
1134903495 16:17959668-17959690 GGCACTAATCCCATTCATGAGGG + Intergenic
1134918044 16:18089570-18089592 GGCACTAATCCCATTCATGAGGG + Intergenic
1134921365 16:18119664-18119686 GACACTAATCCCATTGATGAGGG + Intergenic
1134941627 16:18293819-18293841 GGCACTAATCCCATTCATGAAGG + Intergenic
1135060089 16:19264015-19264037 GGCACTAATCCCAATTATGAGGG - Intronic
1135097624 16:19577732-19577754 GGCACTAATCCCATTCATGAGGG - Intronic
1135281391 16:21156539-21156561 GGCACTAATCCCATTTAGGAGGG + Intronic
1135352891 16:21744695-21744717 GGCACTAATCCCACTCATGAGGG + Intronic
1135451377 16:22560818-22560840 GGCACTAATCCCACTCATGAGGG + Intergenic
1138694358 16:58797914-58797936 GGCACTAATCCCATTCATGAGGG + Intergenic
1139154760 16:64427241-64427263 GGCACTAATCCCAATTATGAGGG + Intergenic
1139194652 16:64905123-64905145 GGCACTAATCCTATTCAGGAGGG - Intergenic
1139401833 16:66688167-66688189 GGCACTAATCCCATTCATGAGGG + Intronic
1139978059 16:70830623-70830645 GGCACTGGTAGCACTGGGGATGG + Intronic
1140231083 16:73117775-73117797 GGCACTAATCCTATTTGTGAGGG - Intergenic
1140752569 16:78039309-78039331 GGCACTAATTCCACTCATGAGGG + Intronic
1141162348 16:81637957-81637979 GGCACTGATCCCATTGGTGAGGG + Intronic
1141585975 16:85033897-85033919 GGCAGTAATGCCACTGGGGAGGG - Intronic
1141719278 16:85746685-85746707 GGCTCCAATCCCAGTGGGGCAGG + Intronic
1141906605 16:87030837-87030859 GGCACTAATCCCATTCTTGAGGG + Intergenic
1142422477 16:89980634-89980656 GGCACCAATCCCATTCGGGAAGG + Intergenic
1142645865 17:1313354-1313376 GGGAACATTCCCACTGGGGAGGG - Intergenic
1143578784 17:7811689-7811711 GGCACTAATCCCATTCCTGAGGG + Intronic
1143816927 17:9524465-9524487 GGCACTAATCCCATTCTTGAGGG + Intronic
1144611618 17:16723705-16723727 GGCACTAATCCCACTAATGAGGG + Intronic
1144720772 17:17468405-17468427 GGCACTAATCCCATTCATGAGGG + Intergenic
1144901120 17:18591638-18591660 GGCACTAATCCCACTAATGAGGG - Intergenic
1145131385 17:20354429-20354451 GGCACTAATCCCACTAATGAGGG + Intergenic
1145849333 17:28076414-28076436 GGCACTAATCCCATTCATGAGGG + Intronic
1146468311 17:33104539-33104561 GGCTCTGATCCCACTGGAGATGG - Intronic
1146625528 17:34432219-34432241 GGCACTAATCCCATTCATGAGGG - Intergenic
1146737706 17:35253188-35253210 GGCACTAATCTCACTTATGAGGG + Intronic
1146993456 17:37296623-37296645 GGCACTAATCCCATTCATGAGGG + Intronic
1147359313 17:39921270-39921292 GCCCCTAGTCCAACTGGGGAGGG + Intronic
1149216847 17:54366182-54366204 GGCACTAATCCCACCCATGAGGG - Intergenic
1149357397 17:55855573-55855595 GGCACTAATCCCATTTATGAGGG + Intergenic
1149373619 17:56021622-56021644 GGCACTAATCCAATTTGTGATGG - Intergenic
1149888432 17:60364204-60364226 GGCACTAATCCCATTCATGAGGG + Intronic
1150159499 17:62883826-62883848 GGCACTCATCCCACTTGTGAAGG - Intergenic
1150478131 17:65489251-65489273 GGCACTGATCCCATTCTGGAGGG + Intergenic
1150560368 17:66289167-66289189 GGCACTAATCCCATTCAGGATGG - Intergenic
1150609066 17:66718643-66718665 GGCACTAATCCCATTCGTGAGGG + Intronic
1150835494 17:68560068-68560090 GGCACTAATCCCACCCATGAGGG - Intronic
1150841441 17:68610736-68610758 GGCACTAATCCCATTTATGAGGG + Intergenic
1151239212 17:72744737-72744759 GGCATTAATCCCACTCATGAGGG + Intronic
1151265191 17:72949622-72949644 GGCATTAATCCCACTCATGAGGG + Intronic
1151290020 17:73142950-73142972 GGCACTAATCCCATTCATGAGGG - Intergenic
1151901661 17:77020017-77020039 GGCACTAATCCCATTCATGACGG + Intergenic
1151998925 17:77632538-77632560 AGCACTAATCCCACTGATGAAGG - Intergenic
1152256282 17:79241859-79241881 GGCACTAATCCCATTGCCCAAGG + Intronic
1152476992 17:80525027-80525049 GGCACTAATCCCTTTATGGAGGG - Intergenic
1152965493 18:110737-110759 TGCACTGATCACCCTGGGGAGGG + Intergenic
1152965504 18:110805-110827 TGCACTGATCACCCTGGGGAGGG + Intergenic
1153273031 18:3341986-3342008 GGCACTAATCCCATTCATGAGGG + Intergenic
1153275903 18:3367583-3367605 GGCACTAATCCCATTCATGAGGG + Intergenic
1153470318 18:5437224-5437246 GGCACTAATCCCATTCATGAGGG - Intronic
1153517759 18:5920067-5920089 GGCACTAATCCCATTCATGAGGG - Intergenic
1153658853 18:7308735-7308757 GGCACTAATCCCATTCATGAGGG - Intergenic
1153679949 18:7491192-7491214 GGCACTAATCCCATTCATGAAGG - Intergenic
1154013322 18:10594232-10594254 GGCACTAATCCCATTTGTAAGGG - Intergenic
1154152495 18:11917495-11917517 GGCACTAATCCCATTTGTAAGGG - Intergenic
1154305821 18:13230086-13230108 GGCACTAATCCCACACATGAGGG - Intronic
1155159586 18:23184889-23184911 GGCACTAATCCCATTCATGAGGG + Intronic
1155293665 18:24365974-24365996 AGCATTAATCCCACAGGTGAGGG + Intronic
1155374400 18:25139866-25139888 GGCATTAATCCCATTTGTGAGGG - Intronic
1155798192 18:30066387-30066409 GGCACTAATCCCATTCACGAGGG + Intergenic
1157023334 18:43813376-43813398 GGCACTAATCCTACTCATGAGGG + Intergenic
1157035103 18:43962211-43962233 GGCACTAATCCCATTCATGAGGG - Intergenic
1157463188 18:47920214-47920236 GGCACTAATCCCATTCATGAGGG + Intronic
1157813592 18:50715575-50715597 GGCACTAATCCCATTCATGAGGG - Intronic
1157888766 18:51394473-51394495 GGCACTTATCCCACTCAAGAGGG - Intergenic
1158494966 18:57946783-57946805 GGCACTAATCCCATTCATGAGGG + Intergenic
1158513599 18:58112925-58112947 GGCACTAATCCCATTCATGAGGG - Intronic
1158553139 18:58453993-58454015 GGCAGTAATCATCCTGGGGAGGG - Intergenic
1158703162 18:59767248-59767270 GGCACTAATCCCATTCATGAGGG - Intergenic
1158887872 18:61845947-61845969 GGCACTAACCCCACTCAGGAGGG - Intronic
1158951443 18:62499157-62499179 GGCAGTGATCCCGTTGGGGAAGG - Intergenic
1159031099 18:63233125-63233147 GGCACTAAACCCACTCATGAGGG + Intronic
1159502769 18:69295072-69295094 GGCACTAACCCCACTCCTGAGGG + Intergenic
1159949973 18:74475765-74475787 GGCACTAATCCCATTCATGAAGG - Intergenic
1160052414 18:75447306-75447328 GGCACTAATCCCATTCATGAGGG - Intergenic
1161813481 19:6484521-6484543 GGCATTAATCCCACTGTTGAGGG - Intergenic
1162163579 19:8737595-8737617 GGCACTAATCCCATTTACGAGGG - Intergenic
1162165044 19:8746808-8746830 GGCACTAATCCCATTTACGAGGG - Intergenic
1162166110 19:8754259-8754281 GGCACTAATCCCATTTACGAGGG - Intergenic
1162167176 19:8761715-8761737 GGCACTAATCCCATTTACGAGGG - Intergenic
1162169185 19:8775471-8775493 GGCACTAATCCCATTTACGAGGG - Intergenic
1162169865 19:8780782-8780804 GGCACTAATCCCATTTACGAGGG - Intergenic
1162170927 19:8788241-8788263 GGCACTAATCCCATTTACGAGGG - Intergenic
1162389086 19:10378354-10378376 GGCAGTAAGCCCGTTGGGGATGG - Exonic
1162868164 19:13564749-13564771 GGCACTATTCCCATTCGTGAAGG - Intronic
1163291985 19:16384916-16384938 GGCACCTATGCCACTGGGAAGGG + Intronic
1163408756 19:17140401-17140423 GGCACTAATCCCATTCATGAGGG + Intronic
1163848219 19:19649445-19649467 GGCACTAATTCCTGTGAGGATGG - Intronic
1164127789 19:22334255-22334277 GTCACAATTCCCACTGTGGATGG + Intergenic
1164171722 19:22731147-22731169 GTCACAATTCCCACTGTGGACGG - Intergenic
1164760847 19:30727237-30727259 GGCACTAATCCCATTCATGAGGG + Intergenic
1165740808 19:38204074-38204096 GGCCCTAAAGCCCCTGGGGAAGG - Intronic
1165872848 19:38985456-38985478 GGCACTAATCCCATTAATGAGGG - Intergenic
1166007950 19:39919929-39919951 GGCACTAATCCCATTCATGAGGG - Intronic
1166902470 19:46076156-46076178 GGCACTAATCCCACTCATGAGGG + Intronic
1167754897 19:51406362-51406384 GGCACTAATCCCATTTATGAGGG + Intergenic
1168413193 19:56152818-56152840 GGCACTAATCCCATTCATGAGGG + Intronic
1168490741 19:56806762-56806784 GGCACTAATCCCATTCATGAGGG - Intronic
1202664662 1_KI270708v1_random:107219-107241 TGCACTAATCCCAATCAGGATGG + Intergenic
925468993 2:4138752-4138774 GGCACTAATCCCAGTCAGGAAGG - Intergenic
925833804 2:7923166-7923188 GGCACTAATCCCATTCATGAGGG + Intergenic
926365245 2:12127173-12127195 GGCACTAATCCCATTCATGAGGG - Intergenic
926379857 2:12276130-12276152 GGCATTAATCCCACTCATGAGGG - Intergenic
926582849 2:14649873-14649895 GGAACTAATCCCATTTGTGAGGG - Intronic
926626873 2:15097673-15097695 GACACTAATCCCACTCAGGAGGG + Intergenic
926834771 2:17006316-17006338 GGCACTAATCCCATTCATGAGGG + Intergenic
926886478 2:17603390-17603412 GGCACTAATCCCATTCATGAGGG + Intronic
927130937 2:20059890-20059912 GGCACTAATCCCATTCATGAGGG + Intergenic
927405966 2:22767138-22767160 GGCACTAATCCCATTCATGAGGG + Intergenic
927504980 2:23607041-23607063 GGCACTAATCCCATTGGTGAGGG + Intronic
927904363 2:26846829-26846851 GGCCCTAAGCTCTCTGGGGAAGG + Intergenic
928131416 2:28654196-28654218 GGCACTAATTCCACTAGTGATGG + Intergenic
928270784 2:29852781-29852803 GGCACTAATCCCATTCATGAGGG - Intronic
928302750 2:30141103-30141125 GGCACTCATCCCATTTGTGAAGG - Intergenic
928719188 2:34099588-34099610 GGCACTAATCCCATTCATGAAGG - Intergenic
929129026 2:38547915-38547937 GGCACTAATCCCATTCATGAGGG - Intergenic
929390810 2:41466399-41466421 GGCACTAATCCCATTTATGAGGG + Intergenic
930505723 2:52281046-52281068 GGCACTAATCCCATTTATGAGGG + Intergenic
930547112 2:52782348-52782370 GGGACTAATTCCACTGATGAAGG - Intergenic
930774558 2:55159320-55159342 GGCCCTGAGCCTACTGGGGAAGG + Intergenic
930831661 2:55750109-55750131 GGCGCTAATCCCATTTGTGAGGG - Intergenic
931443392 2:62307040-62307062 GGCAATAATGCCAGTGGGCACGG - Intergenic
931446465 2:62331285-62331307 GGCTCTAATCCCACTCATGAGGG + Intergenic
931627639 2:64271219-64271241 GGCACTAATCCCATTCATGAGGG - Intergenic
932261950 2:70334372-70334394 GGCACTAATCCCATTCATGAGGG - Intergenic
932504269 2:72213732-72213754 GGCACTAATTCCATTGATGAGGG - Intronic
932652316 2:73571520-73571542 GGCACTAATCCCATTCATGAAGG + Intronic
932772096 2:74506180-74506202 GTCACCCAGCCCACTGGGGAAGG - Exonic
933038560 2:77431348-77431370 GGCACTAATCCCATTTATGAGGG + Intronic
933238376 2:79890939-79890961 GGCACTAATCCCATTGATAAGGG + Intronic
933301773 2:80548580-80548602 GGCACTTGTACCACTGGGGTTGG - Intronic
933472419 2:82742814-82742836 GGCACTAATCCCATTCATGAGGG - Intergenic
933609716 2:84421583-84421605 GGCATTAATCCCATTCAGGAGGG - Intergenic
933863533 2:86495061-86495083 GGCCCTAATCCCACTCATGAAGG - Intergenic
935262658 2:101368721-101368743 GACACTAATCCCATTCAGGAGGG - Intronic
935349850 2:102143399-102143421 GGCCTTAACCACACTGGGGAGGG + Intronic
935448434 2:103181431-103181453 GGCACTAATCCCACACAGGAAGG + Intergenic
935537157 2:104308160-104308182 GGCACTAATCCCATTAATGAGGG + Intergenic
935601528 2:104927181-104927203 GGCACTAATCCCACTCATGAGGG + Intergenic
935895547 2:107733711-107733733 AGCACTAATCCAGCTGGGCATGG - Intergenic
936047478 2:109198701-109198723 GGGACTAATCCCATTCGTGAAGG + Intronic
936291841 2:111231752-111231774 GGCACTAATCCCATTTGTAAAGG + Intergenic
936396712 2:112137308-112137330 GGCACTAATCCCAATTTTGAGGG - Intergenic
936406817 2:112212218-112212240 GGCACTAATCCCATTCATGAGGG + Exonic
936707131 2:115088139-115088161 GGCACTAATCCCATTCATGAGGG + Intronic
936896382 2:117432562-117432584 GGCACTAATCCCATTCATGAGGG + Intergenic
937253132 2:120536575-120536597 GGCACTAATCCCATTCCTGAGGG - Intergenic
937339535 2:121082352-121082374 GACACAAATCCCACTCAGGAGGG + Intergenic
937441004 2:121916045-121916067 GGCACTAATCCCATTCATGAGGG + Intergenic
937651575 2:124325124-124325146 GGCACTAATCCCATTCATGAAGG - Intronic
937933932 2:127227342-127227364 GGCACTAATCCCACTCATAAGGG + Intergenic
937933966 2:127227522-127227544 GGCACTAATCCCACTCATAAGGG + Intergenic
938228309 2:129636557-129636579 GGTACTAATCCCACTCAAGAGGG + Intergenic
938388160 2:130882492-130882514 GGCACTAATCCCACTCATGAGGG + Intronic
939392973 2:141592438-141592460 GGCACTAATCCCATTCATGAAGG + Intronic
939552002 2:143626962-143626984 GCCACTAATCCCACTCATGAGGG - Intronic
939982911 2:148802179-148802201 GGCACTAATCCCATTCATGAGGG + Intergenic
940038862 2:149338500-149338522 GGCACTAATCCCACTCATGAGGG - Intronic
940039150 2:149341816-149341838 GGCCCTAATCCCATTTGCGAGGG + Intronic
940413425 2:153392871-153392893 GGCACTAATCCCATTTAGGGGGG - Intergenic
941066963 2:160914309-160914331 GGCACTAATCCCATTCATGAGGG + Intergenic
941262374 2:163313897-163313919 GGCACTAATCCCATTCAGGAGGG - Intergenic
941277869 2:163513595-163513617 GGCACTAATCCCATTCATGAGGG + Intergenic
941469989 2:165872583-165872605 GGCACTAATCGCACTCGCAAGGG + Intronic
941666747 2:168249972-168249994 GGCACTAATCTAACTCAGGAGGG - Intergenic
941686565 2:168454681-168454703 GGCACTAATCCCATTCATGAAGG - Intergenic
942426873 2:175869384-175869406 GGCACTAATCTCAATCAGGAGGG - Intergenic
942447695 2:176088883-176088905 AGCACTAATCTCACTGTGAAAGG - Intergenic
942752766 2:179306621-179306643 GGCACTAATCCCATTCATGAAGG - Intergenic
943643825 2:190387048-190387070 GGCACTAATCCCACTCATGAGGG - Intergenic
943759079 2:191588891-191588913 GGCACTAATCCCACTCATGAGGG - Intergenic
943800936 2:192056780-192056802 GGCACTAATCCCATTCATGAAGG - Intronic
943812915 2:192211963-192211985 GGCACTAATGCCATTTGTGAAGG + Intergenic
944005754 2:194903254-194903276 GGCACTAATCCCATTTATGAGGG - Intergenic
944057975 2:195543482-195543504 GGCACTAATCCCATTCATGAGGG + Intergenic
944577773 2:201106192-201106214 GGCACTAATCCCATTCATGAGGG - Intergenic
944636491 2:201680448-201680470 GGCACTAATCCCATTCATGAGGG + Intronic
944814278 2:203359745-203359767 GGCACTAATCCCATTCATGAAGG + Intronic
945368907 2:208991676-208991698 GGCACTAATCCCATTTATGAGGG + Intergenic
945371988 2:209030239-209030261 GGTAACAATCCCACTGGGGGAGG + Intergenic
945930733 2:215852600-215852622 GGCACTAATCCCGCTCATGAGGG + Intergenic
946120511 2:217508946-217508968 GGCACTAATCCCACTTATAAGGG - Intronic
946331525 2:219011962-219011984 GGCACTAATCCCACTTGTGAGGG - Intronic
946962730 2:225001868-225001890 GGCACTAATCCCACTCCTGAGGG + Intronic
947069828 2:226276238-226276260 GGCACTAATCCCATTCACGAAGG + Intergenic
947352382 2:229259808-229259830 GGCACTAATCCCATTCATGAAGG - Intronic
947700935 2:232233394-232233416 GGCACTAATCCTATTTGTGAGGG + Intronic
947912171 2:233808635-233808657 GCCACCAAACCCACTGTGGATGG - Intronic
948017224 2:234700644-234700666 GGCACTAATCCCATTTGTGAGGG + Intergenic
948286859 2:236792861-236792883 GGCACTAATCCCATTCACGAGGG + Intergenic
948545530 2:238725960-238725982 GGCACTAATGCCACTCATGAGGG - Intergenic
948704615 2:239781155-239781177 GGCACTGATCCCATTCGGGATGG + Intronic
948782001 2:240327573-240327595 GGCACTAATCCCATTCATGAGGG - Intergenic
948890621 2:240905419-240905441 GGCAGGAGTCCCTCTGGGGAAGG - Intergenic
948966851 2:241388957-241388979 GGCACTAATCCCACTCGTGAGGG - Intronic
1168788407 20:559271-559293 GGCACTAATCCCACTCATGAGGG - Intergenic
1169446980 20:5680488-5680510 AGCACTAATGGCACTGTGGAGGG - Intergenic
1169679536 20:8195371-8195393 GGCACTAATCCCATTTATGAGGG - Intronic
1169701963 20:8456863-8456885 GGCACTAATGCCATTCAGGAGGG + Intronic
1170503100 20:16995228-16995250 GGCATTAATCCCATTCGTGAGGG - Intergenic
1171295050 20:24010073-24010095 GGCACTAATCCCATTCTCGAGGG - Intergenic
1171353874 20:24528633-24528655 GGCACTAATCCTATGGGCGAGGG + Intronic
1171421102 20:25018178-25018200 GGCACCAATCCCACTCATGAGGG - Intronic
1172168409 20:32913364-32913386 GGCACTAATCCCATTCATGAGGG + Intronic
1172626566 20:36350813-36350835 GGCCCACAGCCCACTGGGGAAGG - Intronic
1172890684 20:38261539-38261561 GGCACTAATCCCATTCGTGAGGG - Intronic
1172925893 20:38534914-38534936 GGCACTCAACCCAGTGGGGTGGG + Intronic
1173044098 20:39492879-39492901 GGCACTAATCCCATTCAAGAGGG - Intergenic
1173574574 20:44103887-44103909 GGCACTAATCCCATTAATGAGGG - Intergenic
1173708326 20:45131505-45131527 GGCACTATTGACATTGGGGATGG - Intergenic
1173991481 20:47307119-47307141 GGCACTAATCCCATTCATGAGGG - Intronic
1174662333 20:52224391-52224413 GGCACTAATCCCATTCATGAGGG + Intergenic
1174686980 20:52465493-52465515 GGCACTAATCTCATTGATGAGGG + Intergenic
1174825809 20:53767271-53767293 GGCACTAATCCCACGCATGAGGG - Intergenic
1174847415 20:53956228-53956250 GACACTAATCCTATTGGGGCAGG - Intronic
1174866312 20:54139449-54139471 GGCACTAATCCCATTCATGAGGG + Intergenic
1175546352 20:59780523-59780545 GGTACCAATCCCATTGGTGAGGG + Intronic
1175973588 20:62699258-62699280 GGCACTAATCCCATTCATGAGGG - Intergenic
1176006907 20:62870316-62870338 GGCACTAATCCCATTCATGATGG + Intergenic
1176049339 20:63108379-63108401 GGCACTAATCCCATTCAGGAGGG - Intergenic
1176246820 20:64101504-64101526 GGCACTCATCCCATTCAGGAGGG + Intergenic
1176377150 21:6092391-6092413 GGCATTCATCTCACTGGGCAGGG - Intergenic
1176962024 21:15169814-15169836 GGCACTAATCCCAATCATGAGGG + Intergenic
1177036297 21:16047240-16047262 GGCACTAATCCCAGTCATGAGGG + Intergenic
1177059211 21:16350426-16350448 AGCACTAATCCCACTCGTGAAGG + Intergenic
1177111373 21:17033307-17033329 GGCACTAATCCCATTTGTGAAGG + Intergenic
1177506701 21:22028516-22028538 GGCACTAATCCCATTCATGAAGG - Intergenic
1177530488 21:22352384-22352406 GGCACTAATCCCACTCAAGAGGG + Intergenic
1177762201 21:25414727-25414749 GGCACTAATCCCATTTGTGAGGG + Intergenic
1177802368 21:25840427-25840449 GGCACTAATCCCATTCCTGAGGG + Intergenic
1178047210 21:28709105-28709127 GGCACTAATCCCACTTATGAGGG + Intergenic
1178352701 21:31884235-31884257 GGCACTAATCCCATTCATGAGGG - Intronic
1178374086 21:32052007-32052029 GGCACTAATCCCACTGATGAGGG + Intergenic
1178395612 21:32240294-32240316 GACACTAATCCCATTCGTGAGGG - Intergenic
1178482070 21:32988110-32988132 GGCACTAATCCCATTCACGAGGG + Intergenic
1178483985 21:33005487-33005509 GGCACTAATCCCATTCAAGAGGG - Intergenic
1178508191 21:33180222-33180244 GGCACTAATCCCATTCCTGAGGG - Intergenic
1178966739 21:37127174-37127196 GGCACTAATCCCATTCATGAGGG + Intronic
1179058828 21:37960612-37960634 GGCACTAATCCCACTCAGGAGGG + Intronic
1179067477 21:38039457-38039479 GGCACTAATCCCATTCGTGAAGG - Intronic
1179161150 21:38900464-38900486 GGCACTAATCCCATTCATGAGGG - Intergenic
1179236015 21:39546965-39546987 GGCACTAATCCCATTCATGAGGG + Intergenic
1179284869 21:39968612-39968634 GGCACTAATCCCATTCATGAGGG + Intergenic
1179746325 21:43445853-43445875 GGCATTCATCTCACTGGGCAGGG + Intergenic
1180331392 22:11484139-11484161 TGCACTAATCCCAATCAGGATGG + Intergenic
1181643290 22:24216080-24216102 GGCACTAATCCCATTCATGAGGG - Intergenic
1182693836 22:32182937-32182959 GGCACTAATCCCATTCAAGAGGG + Intergenic
1182890700 22:33816485-33816507 GGCACTAATCCCACTCATGTAGG + Intronic
1182915325 22:34024124-34024146 GGCACTAATCCCATTCATGAAGG + Intergenic
1183388675 22:37530461-37530483 GACACTAATCCCACTCGTGAGGG + Intergenic
1183498001 22:38161387-38161409 GGCACTAATCCCATTCATGAGGG + Intronic
1183504163 22:38199876-38199898 GGCACTTACTCCACTGTGGAGGG - Intronic
1183611897 22:38914261-38914283 GGCACTAATCCCATTCATGAGGG - Intergenic
1183740761 22:39667277-39667299 GGCACCATTCCCACCTGGGAAGG + Intronic
1184622593 22:45693524-45693546 GGCACTAATCCCATTCACGAGGG + Intronic
1184645323 22:45891989-45892011 GGCACTGATCCCCCAGGGCACGG - Intergenic
1184849976 22:47114493-47114515 GGCACTGAACCCAATGGGAAAGG + Intronic
1185019793 22:48367504-48367526 GGCACTAATCCCATTCATGAGGG + Intergenic
1185285370 22:49997540-49997562 GGCGCCAGGCCCACTGGGGAAGG - Intronic
949591153 3:5495771-5495793 GGCACTAATCCCATTCATGAGGG - Intergenic
949697622 3:6717496-6717518 GGCACTAATCCCACTCATGAGGG - Intergenic
949931477 3:9081954-9081976 GGCACTAATCCCATTCCTGAGGG - Intronic
949957069 3:9277915-9277937 GGCACTAATCCCATTCATGAGGG - Intronic
950230997 3:11275684-11275706 GGCCTTAATCGCACTGGAGAAGG - Intronic
950629016 3:14268897-14268919 GGCACTAATCCCATTCATGAGGG - Intergenic
950704425 3:14771109-14771131 GGCACTAATCCCATTCATGAGGG - Intronic
950726378 3:14919843-14919865 GGCACTAATCTCATTCGTGAGGG + Intronic
950832455 3:15888158-15888180 GGCACTAATCCCATTCATGAGGG - Intergenic
950944606 3:16931925-16931947 GGCACTAATCCCATTCATGAGGG - Intronic
951467568 3:23018886-23018908 GGCACTAATCCCATTCATGAGGG - Intergenic
951681083 3:25295308-25295330 GGCACTAATGCCATTGATGAAGG - Intronic
951856793 3:27206048-27206070 GGCACTAATCCCATTGGTGAGGG + Intronic
951942188 3:28091788-28091810 GGCACTAATCCCATTCATGAGGG - Intergenic
952004044 3:28821901-28821923 GACACTAATCCCATTGATGAAGG + Intergenic
952411492 3:33053757-33053779 GGCACTAATCCCATTCATGAAGG - Intronic
952585658 3:34889026-34889048 GGCACTAATCCCATTCAGGAAGG + Intergenic
953549580 3:43891054-43891076 GGCACTAATCCCATTCATGAGGG - Intergenic
953552727 3:43916919-43916941 GGCACTAATCCCATTCAGGAGGG - Intergenic
954504770 3:51059242-51059264 GGCACTAATCCCATTCACGAGGG + Intronic
955527321 3:59834660-59834682 GGCACTAATCCCATTCCTGAGGG + Intronic
955671512 3:61407829-61407851 GGCACTAATCCCATTCATGAGGG + Intergenic
955847504 3:63181531-63181553 GGCACTAATCCCATTCATGAGGG + Intergenic
956023540 3:64957938-64957960 GGGACTAATCCTTCTGTGGAGGG - Intergenic
956146074 3:66191990-66192012 GGCACTAAACCCATTCAGGAAGG - Intronic
956366905 3:68514102-68514124 AGCACTAATCCCATTTGCGAGGG + Intronic
957159733 3:76595010-76595032 GGCACTAATCCCATTCATGAGGG - Intronic
957244110 3:77696536-77696558 GGCACTAATCCCATTGATGAGGG + Intergenic
957263148 3:77926007-77926029 GACACTAATCCCACTCATGAGGG - Intergenic
957310314 3:78510393-78510415 GGCACTAATCCCATTTATGAGGG + Intergenic
957549403 3:81684529-81684551 GGCACTAATCCCATTCATGAGGG + Intronic
957663897 3:83198135-83198157 GGCTCTCATCCCACTTGTGAGGG + Intergenic
957688303 3:83533654-83533676 GGCACTAATCTCATTCGTGAGGG - Intergenic
957896941 3:86433248-86433270 GGCACTAATCCCAATAATGAGGG + Intergenic
958150363 3:89685346-89685368 GGCACTAATCCCATTCATGAGGG + Intergenic
958167111 3:89890250-89890272 GGCACTAATCCCATTTATGAGGG + Intergenic
959019519 3:101173235-101173257 GGCACTAATCCCATTAGTGAAGG + Intergenic
959061444 3:101619930-101619952 GGCACTAATCCCATTCGTGAGGG + Intergenic
959110640 3:102118239-102118261 GGCACTAATCCCATTCATGAGGG + Intronic
959264873 3:104124521-104124543 GGCACTAATCCCATTCATGAGGG - Intergenic
959351630 3:105272233-105272255 GGAACTAATCCCATTGGTGAAGG - Intergenic
959633480 3:108535436-108535458 GGCACTAATCCCATTTATGAGGG + Intergenic
960103215 3:113766614-113766636 GGCACTAATCCCATTCATGAGGG + Intronic
960306351 3:116066225-116066247 GGCACTAATCCCATAAGTGAGGG + Intronic
960461152 3:117937531-117937553 GGCACTAATCCCATTCATGAGGG - Intergenic
960694847 3:120386089-120386111 GGCACTAATCCCATTCATGAGGG - Intergenic
960848928 3:122031597-122031619 GGCACTAATCCCATTCATGAGGG - Intergenic
960905521 3:122597207-122597229 GGCACTAATCCCATTCATGAGGG + Intronic
961074867 3:123973041-123973063 GGCACTAATCCCATTCATGAGGG + Intronic
961251792 3:125513161-125513183 GGCACTAACCCCACTTATGAGGG - Intronic
961308811 3:125979440-125979462 GGCACTAATCCCATTCATGAGGG - Intronic
961506980 3:127376551-127376573 GGCACTAATTCCATTTGTGAGGG + Intergenic
962353081 3:134669955-134669977 GGCACTAATCCCATTCAGAAGGG - Intronic
962850308 3:139303505-139303527 GGCACTAATCCCATTCATGAGGG + Intronic
962952316 3:140230527-140230549 GGCACTAATCCCATTTATGAGGG - Intronic
963014970 3:140814590-140814612 GGCACTAATCCCACTTCTGAAGG + Intergenic
963231703 3:142914917-142914939 GGCACTAATCCCATTCATGAGGG + Intergenic
963278143 3:143353372-143353394 GGCACTAATCCCATTCATGAGGG - Intronic
963292647 3:143507931-143507953 GGCATGAATCCCACTAGTGAGGG + Intronic
963435871 3:145265546-145265568 GGCACTAATCCCATTTGTGAGGG + Intergenic
963892372 3:150650152-150650174 GGCACTAATCCCATTCATGAAGG - Intergenic
964224626 3:154383810-154383832 GGCACTAATCCTACTCATGAGGG - Intronic
964240063 3:154582117-154582139 GGCACTAATTCCACTCATGAGGG + Intergenic
964492400 3:157250751-157250773 GGCACTAATCCCATTCATGAGGG + Intergenic
964802412 3:160570169-160570191 GGCACTGATCCCACTCATGAGGG + Intergenic
965378812 3:167961871-167961893 AGCACTAATCCCATTCAGGAGGG + Intergenic
965385328 3:168038882-168038904 GGCACTAATCCCATTCTGTAGGG - Intronic
965409546 3:168313088-168313110 GGCAGAAAGCACACTGGGGAAGG - Intergenic
966226688 3:177605459-177605481 GGCACTAATCCCATTCAAGAGGG - Intergenic
966380630 3:179341420-179341442 GGCACTAATCCCATTCATGAGGG - Intergenic
966583359 3:181593321-181593343 GGCACTAATCCCATTTGTAAGGG + Intergenic
966763350 3:183436552-183436574 GGCACTAATCCCATTCATGAGGG - Intergenic
967579424 3:191135133-191135155 CGCACTAATCCCACTCAGGAGGG - Intergenic
967604763 3:191432362-191432384 GGCACTAATCCTACTTAAGAGGG + Intergenic
967726000 3:192862977-192862999 GGCACTAATCCCACTGACAAGGG + Intronic
969093332 4:4713279-4713301 GACACTAATCCCATTCAGGAGGG + Intergenic
969328481 4:6458468-6458490 GGCACTAATCCCACCCATGAGGG + Intronic
969351805 4:6602447-6602469 GGCACTAATCCCATTCTTGAGGG + Intronic
969398254 4:6937367-6937389 GGCACTAATCCCACTGGGGAGGG + Intronic
969654525 4:8488754-8488776 GGCACTGATGCAACTGTGGAAGG - Intronic
970035843 4:11735034-11735056 AGTACTAATCCCACTGATGAGGG + Intergenic
970113831 4:12670383-12670405 GGCACTAATCCCATTCATGAGGG - Intergenic
970128740 4:12843306-12843328 AGCACTAATCCCACTCATGAGGG + Intergenic
970205479 4:13651412-13651434 GGCATTAATCCCATTTGTGAGGG - Intergenic
970340068 4:15096914-15096936 GGCACTAATCCCATTCATGAGGG - Intergenic
970447196 4:16134189-16134211 GGCACTAATCCCATTCATGATGG - Intergenic
970501981 4:16687291-16687313 GGCACTAATCCCATTCATGAGGG - Intronic
970675762 4:18448596-18448618 GGCACTAATCCCATTCATGAGGG - Intergenic
970703396 4:18770407-18770429 AGCACTAATCCCATTTGTGAGGG + Intergenic
970994716 4:22252138-22252160 GGCACTAATCCTAATCGCGAGGG - Intergenic
971246676 4:24935533-24935555 GGCACGAATCCCACTCATGAGGG - Intronic
971353876 4:25876992-25877014 GGTACTAATCCCACTCATGAGGG - Intronic
971450785 4:26799608-26799630 GGCACTAATCCCATTCATGAGGG - Intergenic
971502918 4:27335673-27335695 GGCACTAATCCCATTCCTGAGGG + Intergenic
971504054 4:27347468-27347490 GGCACTAACCCCACTGATGATGG + Intergenic
971974977 4:33673037-33673059 GGCACTAATCCCATTCAAGAGGG + Intergenic
972383044 4:38536701-38536723 GGCACTAATCCCATTCATGAGGG - Intergenic
972612497 4:40668654-40668676 AGCACAGACCCCACTGGGGAAGG + Intergenic
972624012 4:40778470-40778492 GGCACTAATCCCATTCATGAGGG - Intronic
972709907 4:41585026-41585048 GGCACTAATCCCATTTATGAGGG + Intronic
972822399 4:42716759-42716781 GGCACTAATCCCATTCATGAGGG - Intergenic
973208502 4:47587737-47587759 GGCATTAATCTCACTCAGGAGGG + Intronic
973571202 4:52241477-52241499 GGCACTAATCCCATTCATGAGGG + Intergenic
973576141 4:52291237-52291259 GGCACTAATCCCATTCATGAGGG + Intergenic
973582063 4:52353871-52353893 GGCACTAATCCCATTCATGAGGG + Intergenic
973594520 4:52473175-52473197 GGCACTAATCCCACTCATGAGGG - Intergenic
973755349 4:54068320-54068342 GGCACTAATCCCATTCATGAGGG - Intronic
973855054 4:55002871-55002893 GGCACTAATCCCATTCATGAGGG - Intergenic
974660401 4:64880932-64880954 GGCACTAATCCCATTCTGAAGGG - Intergenic
974931074 4:68361671-68361693 GGCACTAATCCCATTTATGAGGG + Intergenic
975169176 4:71213738-71213760 GGCACTAATCCCATTGATGAGGG - Intronic
975536082 4:75452526-75452548 GGCACTAATCTCACTCATGAGGG + Intergenic
975745307 4:77469403-77469425 GGCACTAATCCGATTCGTGAGGG - Intergenic
975931204 4:79525328-79525350 GGCACTAATCCCATTGATGAGGG + Intergenic
976179239 4:82383483-82383505 GGCACTAATCCCATTCATGAGGG + Intergenic
976224840 4:82787697-82787719 GGCACTAATCCCATTCCTGATGG - Intronic
976305183 4:83552859-83552881 GGCACTAATCCCACTCATTATGG - Intronic
976416840 4:84786088-84786110 GGTACTAATGACACAGGGGATGG + Exonic
976598707 4:86918127-86918149 GGCACTAATCCCATTCATGAGGG + Intronic
976605887 4:86982537-86982559 GGCACTAATCCCATTCATGAAGG - Intronic
976668778 4:87628730-87628752 GGCACTAATCCCATTCATGAGGG - Intergenic
976704156 4:88004559-88004581 GGCACTAATCCCATTTGTGAGGG - Intergenic
976745019 4:88393895-88393917 GGCACTAATCCCATTGATGAGGG + Intronic
976823867 4:89237471-89237493 GGCACTAATCTCACTCATGAGGG - Exonic
977437862 4:97022830-97022852 GACACTAATCCCATTGATGAGGG - Intergenic
977891458 4:102316867-102316889 TGCACTAATCCCACTGGACCAGG - Intronic
977997072 4:103507600-103507622 GGCACTACTGTCACTGAGGAAGG + Intergenic
978048729 4:104168174-104168196 GGCACTAATCCCATTTATGAAGG - Intergenic
978156001 4:105489808-105489830 GGCACTAATCCCATTCATGAAGG - Intergenic
978317221 4:107451809-107451831 GGCCATATTCCCACTGGGCAGGG + Intergenic
979447716 4:120834329-120834351 GGCACTAATCCCATTGATGAGGG - Intronic
980082978 4:128363856-128363878 GGCACTAATTCCATTGAGGAGGG + Intergenic
980145570 4:128979365-128979387 GGCACTAATCCCATTTTCGAGGG - Intronic
980196840 4:129600334-129600356 GGCACTAATCCCATTCATGAGGG - Intergenic
980310965 4:131128365-131128387 GGCACTAATCCCATTCTTGAAGG - Intergenic
980882935 4:138731926-138731948 GGCACTAGTCCCATTTGTGAGGG - Intergenic
981251888 4:142612716-142612738 GGCACTAATCTCATTTGTGAAGG + Intronic
981344349 4:143658265-143658287 GGGACTAATCCCATTTGTGAGGG - Intronic
981572753 4:146170385-146170407 GGCACTAATCCCATTCATGAGGG - Intergenic
981628103 4:146784536-146784558 GGCACTAATCCCATTTATGAGGG - Intronic
981642756 4:146964102-146964124 GGCACTAATCCCATTCATGAGGG + Intergenic
981806782 4:148725131-148725153 GGCACTAATCCCATTCATGAGGG + Intergenic
982079777 4:151778152-151778174 GGCACTAATCCCATTCATGAGGG + Intergenic
982099599 4:151955043-151955065 GGCACTAATCCCATTCATGAGGG - Intergenic
982125958 4:152184112-152184134 GGCACTAATCCCATTCATGAGGG + Intergenic
982165198 4:152607858-152607880 GGCACTAATCCCATTCATGATGG - Intergenic
982403386 4:154993597-154993619 GGCACTAATCCCATTTATGAGGG + Intergenic
982502499 4:156174243-156174265 GGCACTACTTCCACTGAAGAGGG + Intergenic
982510304 4:156274636-156274658 GGCACTAATACCATTTGTGAGGG + Intergenic
982699111 4:158639548-158639570 GGCACTAATCCCACTCATGAGGG - Intronic
983796175 4:171866808-171866830 GGCATTAATCCCATTTAGGAGGG + Intronic
983947037 4:173598089-173598111 GGCACTAATCCCATTCCTGAAGG - Intergenic
983956594 4:173705407-173705429 GGCACTAATCCCATTCATGAGGG - Intergenic
984337454 4:178410980-178411002 GGCACTAATCCCATTAAAGAGGG - Intergenic
984546319 4:181108424-181108446 GGCACTAATCCCATTCATGAAGG + Intergenic
984600373 4:181719578-181719600 GGCACTAATCCCATTCATGAAGG + Intergenic
985005015 4:185525726-185525748 GGCACTAATCCCATTCATGAGGG - Intronic
985287812 4:188354738-188354760 GGCACTGTGCCCATTGGGGAGGG + Intergenic
985818640 5:2145251-2145273 GGCACTAATCCCATTCAGGAGGG + Intergenic
985964331 5:3328453-3328475 GGCACTAATCCCATTCATGAGGG - Intergenic
986348463 5:6855757-6855779 GGCACTAATCCCATTCATGAGGG + Intergenic
986862180 5:11939557-11939579 GGCACTAATCCCATTCATGAGGG + Intergenic
986901862 5:12445103-12445125 GCCACCATTCCCACTGGGCATGG - Intergenic
987143551 5:14969247-14969269 GGCACTAATCCCATTCATGAGGG + Intergenic
987275422 5:16356988-16357010 GGCACTAATCCCACCCGTGAGGG + Intergenic
987299766 5:16586976-16586998 GGCACTAATCCCATTCATGAGGG + Intronic
987333435 5:16876961-16876983 GGCACTAATCCCATTCATGAAGG - Intronic
987376488 5:17240075-17240097 AGCACTAATCCCATTAGTGAAGG - Intronic
987884048 5:23789630-23789652 GGCACTAATCCCACTCAATAAGG + Intergenic
987965554 5:24867691-24867713 GGCACTAATCCCACTCATGAGGG + Intergenic
988335047 5:29896645-29896667 GGCACTAATCCCATTCCTGAGGG - Intergenic
988464409 5:31474742-31474764 GGCACTAATCCCATTTATGAGGG - Intronic
988515384 5:31899761-31899783 GGCACTAATCCCATTCATGAGGG - Intronic
988639459 5:33025525-33025547 GGCACTAATTCCACTCATGAGGG + Intergenic
988704922 5:33716138-33716160 GGCACTAATCCCATTTACGAGGG - Intronic
988739854 5:34059594-34059616 GGCACTAATCCCATTTATGAGGG + Intronic
988777914 5:34493774-34493796 GGCACTAATCCCATTCATGAGGG - Intergenic
988821222 5:34888073-34888095 GGCACTAATCCCATTCATGAAGG - Intronic
989225714 5:39025734-39025756 GGCACTAATTCCACTTGTGAGGG + Intronic
989381339 5:40812409-40812431 GGCACTGATCCCACTCATGAAGG + Intergenic
989399634 5:40994823-40994845 GGCACTAATCCCATTCATGAGGG - Intergenic
989450432 5:41580919-41580941 GGCACTAATCCCATTCATGAGGG + Intergenic
989908992 5:49600018-49600040 TGCACTTATCACTCTGGGGAGGG - Intergenic
990160166 5:52929275-52929297 GGTACTAATCCCACTCATGAGGG + Intronic
990377225 5:55183612-55183634 GGCACTAATCCCATTCATGAGGG + Intergenic
990775471 5:59301157-59301179 GGCAGTACTCTCTCTGGGGAAGG + Intronic
990949655 5:61286155-61286177 GGCACTAATCCCATTCATGAGGG + Intergenic
991322092 5:65385035-65385057 GGCACTAATCCCATTCATGAAGG + Intronic
991402872 5:66272462-66272484 GGCACTAATTCCACTCATGAGGG + Intergenic
991917981 5:71624157-71624179 GGCACTAATCCCATGGGGAGGGG + Intronic
991953720 5:71971781-71971803 GGCACTAATCCCACTCATGAAGG + Intergenic
992154638 5:73943001-73943023 GGCACTAATCCCATTCATGAGGG - Intergenic
992332752 5:75733943-75733965 GGCACTAATCCCATTCTTGAGGG + Intergenic
992365846 5:76088537-76088559 GGCACTAATCCCATTCATGAGGG + Intronic
993701429 5:91123492-91123514 AGCACTAATCCCATTGATGAGGG + Intronic
993825784 5:92684934-92684956 GGCACTAATCCCATTCATGAGGG + Intergenic
994090442 5:95805316-95805338 GGCACTAATCCCATTCATGAGGG + Intronic
994223744 5:97228009-97228031 GGCACTAATCCCATTCATGAGGG + Intergenic
994280326 5:97894072-97894094 GGCACTAATCCCAATTATGATGG + Intergenic
994367217 5:98929317-98929339 GGCGCTAATGTCACTTGGGATGG + Intergenic
994397617 5:99238714-99238736 GGCACTAATCCCATTAATGAGGG + Intergenic
995058269 5:107786557-107786579 GGCACTAATCTCAATGATGAGGG - Intergenic
995153843 5:108885647-108885669 GGCACTAATCCCATTGATAAGGG + Intronic
995280641 5:110331711-110331733 GGCACTAATCCCATTCATGAGGG - Intronic
995349718 5:111161036-111161058 GGCACTAATTCCATTGATGAGGG - Intergenic
995367381 5:111378124-111378146 GGCACTAATCTCATTCTGGAGGG - Intronic
995543937 5:113211156-113211178 GGCACTAATCCCATTCGTGAGGG - Intronic
995755493 5:115499246-115499268 GGCACTAATCCCATTCATGAGGG + Intergenic
995933489 5:117480766-117480788 GGCACTAATCCCATTAATGAGGG - Intergenic
996178683 5:120391857-120391879 GGCACTAATCCCATTCATGAGGG - Intergenic
996214016 5:120845824-120845846 GGCACTAATCCCATTCATGAAGG - Intergenic
996571875 5:124940511-124940533 GGCACTAATCCCATTCAGGAGGG + Intergenic
996645905 5:125816758-125816780 GGCACTAATCCCATTCATGAGGG + Intergenic
996764316 5:127020527-127020549 GGCACTAATCCCATTCAGGAGGG - Intronic
996933823 5:128924836-128924858 GGCACTAGTCCCATTTGTGAGGG + Intronic
997223505 5:132191135-132191157 GGCACTAATCCCACTCACGTGGG + Intergenic
997847032 5:137296030-137296052 GGCACTAATCCCATTCATGAGGG - Intronic
997869668 5:137496784-137496806 GGCAGGAATCTCACTGGGGTAGG + Intronic
997901001 5:137764233-137764255 GGCACTAATCCCATTCATGAGGG - Intergenic
998585513 5:143422549-143422571 GGCACTAATCCCATTCATGAGGG - Intronic
998766280 5:145491340-145491362 GGCACTAGTCCCAGTCAGGAGGG + Intronic
998908741 5:146935212-146935234 GGCACTAATTCCATTTGTGAGGG - Intronic
999297219 5:150467249-150467271 AGCACTAATCCCACTTATGAGGG - Intergenic
999441009 5:151600848-151600870 GGCACTAATCCCATTCATGAGGG - Intergenic
999509400 5:152232613-152232635 GGCACTAATTCCATTCTGGAGGG + Intergenic
999698858 5:154209662-154209684 GGCACTAATCCCATTCACGATGG + Intronic
999850890 5:155537287-155537309 GGCACTAATCTCACTCATGAGGG + Intergenic
1000025588 5:157356298-157356320 GGCACTGATCCCACTCATGAGGG + Intronic
1001446845 5:171791943-171791965 GGCACTAATCTCACTAATGAGGG - Intronic
1001630405 5:173170831-173170853 GGCACTAATCCCATTCATGAGGG - Intergenic
1001787476 5:174426032-174426054 GGCAAAAATCAGACTGGGGAAGG + Intergenic
1001836823 5:174839640-174839662 GGCACTAATCCCATTCATGAGGG - Intergenic
1001966481 5:175913492-175913514 GGCACTAATTCCATTTGTGAGGG + Intergenic
1002250466 5:177925712-177925734 GGCACTAATTCCATTTGTGAGGG - Intergenic
1002462900 5:179384913-179384935 GGCACTCGTCCCATTCGGGAGGG + Intergenic
1002579925 5:180201767-180201789 GGCACTAATCTCATTGATGAGGG - Intronic
1002667266 5:180834129-180834151 GCCACTAATCCCACTCATGAGGG - Intergenic
1002682000 5:180972822-180972844 GGCACTAATCCCATTTTTGAGGG - Intergenic
1003613017 6:7630283-7630305 GGCACTAATCCCATTCATGAGGG - Intergenic
1003787842 6:9506994-9507016 GGCACTAATCCCATTCAAGAGGG + Intergenic
1003846886 6:10183049-10183071 GGCACTAATCCCATTCATGAGGG - Intronic
1003946210 6:11078230-11078252 GACACTAATCCCATTGATGAGGG - Intergenic
1004008310 6:11657209-11657231 GACACAAGTACCACTGGGGAAGG + Intergenic
1004072099 6:12309167-12309189 GGCACTAATCCCATTCATGAGGG - Intergenic
1004183101 6:13397579-13397601 GGCACTGATACCACCTGGGAGGG + Intronic
1004271574 6:14200779-14200801 GGCACTAATCCCATTTACGAAGG + Intergenic
1004310473 6:14540751-14540773 GCCACTAAGCCCACTGAGGCAGG + Intergenic
1004339227 6:14793775-14793797 GGCACTAATCCCATTCCTGAGGG + Intergenic
1004371819 6:15059398-15059420 GGCACTAATCTCACTCATGAGGG + Intergenic
1004667310 6:17760672-17760694 GCCGCTTCTCCCACTGGGGAGGG + Intronic
1004751797 6:18569211-18569233 GGCATTAATCCCACTCATGAGGG - Intergenic
1005264580 6:24098312-24098334 AGCACTAATCCCATTGGTGAAGG - Intergenic
1005467541 6:26130175-26130197 GGCCCTAATCCCATTGGGGCTGG - Intronic
1007076133 6:39067523-39067545 GGTACTAATCCCATTCGTGAGGG + Intronic
1007944995 6:45818131-45818153 GGCACTAATCCCATTCATGAGGG - Intergenic
1008679062 6:53853129-53853151 GGCACTAATCCCATTCATGAGGG + Intronic
1008869978 6:56261457-56261479 GGCACTAATCCCATTCATGAGGG - Intronic
1009041778 6:58188932-58188954 GGCACTAATCCCATTCATGAGGG + Intergenic
1009217628 6:60943195-60943217 GGCACTAATCCCATTCATGAGGG + Intergenic
1009341630 6:62561881-62561903 GGTACTTATCCCACTGGTAAGGG - Intergenic
1009409647 6:63351086-63351108 GACACTAATCCCATTTGTGAGGG - Intergenic
1009532033 6:64830097-64830119 GGCACTAATTCCATTGATGAGGG - Intronic
1009790431 6:68394561-68394583 GGCACTAATCCCATTCATGAGGG + Intergenic
1010091441 6:71987447-71987469 GGCACTAATCCCATTTATGAGGG + Intronic
1010278335 6:73994696-73994718 GGCACTAATCCCATTCATGAGGG + Intergenic
1010554845 6:77266219-77266241 GGCACTAATCCCATTCATGAGGG + Intergenic
1010671258 6:78689448-78689470 GGCACTAATCCCACTCATGAGGG - Intergenic
1010726304 6:79337591-79337613 GGCACTAATCCCAATCTTGAGGG - Intergenic
1010731033 6:79391561-79391583 GGCACTAATCCCATTCATGAGGG + Intergenic
1010903596 6:81457898-81457920 GGCAGTAATCCCACTCTTGAGGG - Intergenic
1010930902 6:81801744-81801766 GACACTAATCCCATTCAGGAGGG - Intergenic
1011003949 6:82622825-82622847 GGCACTAATCCCATTCATGAGGG - Intergenic
1011156860 6:84342903-84342925 GGCACTAATCCCACTCATGCAGG + Intergenic
1011627986 6:89298847-89298869 AGCACTAATCCCACTGGTGAGGG - Intronic
1012519474 6:100103642-100103664 GGCACTAATCCCATTCCTGAGGG + Intergenic
1013250383 6:108327578-108327600 GGCACTAATCCAACTGAGGAGGG + Intronic
1013374993 6:109506022-109506044 GGCACTAATCCCATTCATGAGGG + Intronic
1013632062 6:111995577-111995599 GGCACTAATCCCATTCATGAAGG + Intergenic
1013715355 6:112954570-112954592 GGCACTAATCCCATTCATGAGGG - Intergenic
1014121951 6:117736145-117736167 GGCACTAATCCCATTCATGAGGG - Intergenic
1014168132 6:118248928-118248950 GGCACTAATACCATTCAGGATGG - Intronic
1014302657 6:119701777-119701799 GGCACTAATCCCAATCATGAGGG - Intergenic
1014665114 6:124228248-124228270 AGCACTAAGCCCATTTGGGAAGG - Intronic
1014666954 6:124250068-124250090 GGCACTAATTCCATTCAGGAGGG - Intronic
1015091867 6:129368123-129368145 GGCACTAATCCCAATCATGAAGG + Intronic
1015234361 6:130953718-130953740 GGCACTAATCCCAGTCATGAAGG - Intronic
1015268754 6:131317164-131317186 GGCACTAATCCCACTCATAAGGG - Intergenic
1015298993 6:131631640-131631662 GAAACTAATCGCACTGAGGAGGG - Intronic
1015770157 6:136760649-136760671 GGCACTAATCCCATTCATGAGGG - Intronic
1015797239 6:137025267-137025289 GGCACTAATCCCACTCATGAGGG - Intronic
1016019426 6:139220102-139220124 GGCACTAATCCCATTCATGAGGG - Intergenic
1016133411 6:140506724-140506746 GGCACTAATCCCATTCATGAGGG - Intergenic
1016210291 6:141524063-141524085 GTCCCTAATCCCACTGATGAAGG - Intergenic
1016265407 6:142227446-142227468 GGCACTAATCCCATTCATGAAGG + Intergenic
1016371851 6:143382966-143382988 GGCACTAATCCCATTCATGAGGG + Intergenic
1016431276 6:143988819-143988841 GGCACTAATCCCATTCCTGAGGG + Intronic
1016587529 6:145706936-145706958 GACACTAATCCCACTAATGAGGG - Intronic
1017459224 6:154633494-154633516 GGCACTAATCCCATTCATGAGGG - Intergenic
1017721130 6:157243917-157243939 GGCACTAATCCCATTCATGAAGG - Intergenic
1017937281 6:159016877-159016899 GGCACTAATCCCACTCATGAGGG + Intergenic
1018198899 6:161377702-161377724 GGCACTAATCCCATTCCCGAGGG - Intronic
1018230299 6:161669052-161669074 GGCACTAATCCCATTGATGAGGG - Intronic
1018288693 6:162268297-162268319 GGCACTAATCCCATTCATGAAGG - Intronic
1018615458 6:165682522-165682544 GGCACTAATCCCATTTATGAGGG - Intronic
1018746174 6:166764136-166764158 GACTCCACTCCCACTGGGGAGGG + Intronic
1018908744 6:168089876-168089898 GGCACGAATCCCGCTGGCGCTGG + Intergenic
1019911002 7:4100553-4100575 GGCACTCATCGCATTGGTGAGGG - Intronic
1020033378 7:4948629-4948651 GGCACTAATCCCATTTGTGAGGG - Intronic
1020814741 7:12891551-12891573 GGCACTAATCCCATTCATGAGGG - Intergenic
1021062455 7:16130884-16130906 GGCACTAATCCCAGTAATGATGG - Intronic
1021608349 7:22432071-22432093 GACACCAATCCCACTGATGAAGG - Intronic
1021767306 7:23962906-23962928 GGCACTAATCCCATTCACGAGGG - Intergenic
1021845800 7:24761489-24761511 GGCACTAATCCCATTGATGAGGG + Intergenic
1021910445 7:25380693-25380715 GGCACTAATCCCATTCATGATGG - Intergenic
1022024931 7:26439265-26439287 GGGACTAAACCAACAGGGGATGG + Intergenic
1022796785 7:33738067-33738089 GGCACTAATCCCATTCATGATGG - Intergenic
1022842811 7:34180819-34180841 GGCACTAATCCCATTCATGAGGG - Intergenic
1023197270 7:37655213-37655235 GGCACTAATCCCATTCTTGAGGG + Intergenic
1023867528 7:44245306-44245328 TGCTCTCACCCCACTGGGGAGGG - Intronic
1024135210 7:46399778-46399800 GGCACTAATCCCATTCACGAGGG - Intergenic
1024296195 7:47844119-47844141 GGCATTGATACCACTGGGGCTGG - Intronic
1024325420 7:48105766-48105788 GGCACTAATCCCACTCATGCAGG + Intronic
1024457116 7:49621392-49621414 GGCACTAATCCTATTCGGAAGGG + Intergenic
1024498360 7:50072208-50072230 GGCAATAATCCCACTGGCCTGGG + Intronic
1024507530 7:50174912-50174934 GGCACTGATCCCACTGACAAGGG + Intergenic
1024509039 7:50188358-50188380 GGCACTAATCCCATTCATGAGGG - Intergenic
1024548540 7:50541530-50541552 GGCACTAATCCCACTGTTGGGGG - Intronic
1024561187 7:50646882-50646904 GGCACCAATCCCACCTGGTAAGG + Intronic
1024834683 7:53502585-53502607 GGCATTAACTCCACTGAGGAGGG + Intergenic
1026105431 7:67417190-67417212 GGCATTAATCCCATTTGTGAGGG - Intergenic
1026111791 7:67464263-67464285 GGCACTAATCCCATTCATGAGGG + Intergenic
1026658310 7:72276469-72276491 GGCACTAATCCCATTCATGAGGG - Intronic
1026764849 7:73154186-73154208 GCCATTTATCCCACTGGAGAGGG - Intergenic
1026995663 7:74614384-74614406 GGCACTAATCCCATTCATGAAGG - Intergenic
1027041322 7:74963956-74963978 GCCATTTATCCCACTGGAGAGGG - Intergenic
1027082318 7:75238420-75238442 GCCATTTATCCCACTGGAGAGGG + Intergenic
1027594120 7:80151595-80151617 GGCATTTATTCCACTGGGGGTGG - Intronic
1027819209 7:83022111-83022133 GGCACTAATCCCATTCATGAGGG - Intronic
1028175921 7:87657904-87657926 GACACTGCTCCCACAGGGGAAGG - Intronic
1028310235 7:89323044-89323066 GGCACTAATCCCACTCACGAAGG - Intronic
1028416784 7:90589164-90589186 GGCACTAATCCCATTCATGAGGG - Intronic
1028624068 7:92857932-92857954 GGCATCAATCCCACTGATGAGGG - Intergenic
1029003477 7:97182024-97182046 GGCACTAATCCCATTCATGAGGG - Intergenic
1029420228 7:100468233-100468255 GGCACCAATCCCAGAGTGGAGGG + Intronic
1029502318 7:100939534-100939556 GGCACTAATCCCATTCATGAGGG - Intergenic
1029804438 7:102981746-102981768 GGCACTAATCCCATTCATGAGGG + Intronic
1029923445 7:104290765-104290787 GGCACTAATCCTATTTGTGAGGG - Intergenic
1029944964 7:104522746-104522768 GAAGCTAAGCCCACTGGGGAAGG + Intronic
1030126971 7:106163042-106163064 GGCACTAATCCCATCTGTGAGGG + Intergenic
1030276803 7:107729911-107729933 GGCACTAATCCCATTCATGAGGG - Intergenic
1030618950 7:111768963-111768985 GGCACTAATGCCATTCGTGAGGG - Intronic
1030740487 7:113103392-113103414 GGCACTAATCCCATTCATGAGGG + Intergenic
1030865993 7:114702392-114702414 GGCACTAATCCCATTCATGAGGG - Intergenic
1031285642 7:119863838-119863860 AGCACTAATCCCATTCAGGAGGG - Intergenic
1031840145 7:126728152-126728174 AGCACTAATGGCAGTGGGGAGGG - Intronic
1032715671 7:134507124-134507146 GGCACTAATCCCATTCATGAAGG - Intergenic
1032881324 7:136093498-136093520 GGCACTAATCCCATTTAAGAGGG + Intergenic
1033138916 7:138807955-138807977 GGCACTAATCCCAATCGTGAGGG + Intronic
1033838702 7:145347497-145347519 GGCAATAATCCCATTGATGAGGG - Intergenic
1033846909 7:145444504-145444526 GGCACTAATCCCATTCATGAAGG + Intergenic
1033944811 7:146703712-146703734 GGCACTAATCCCATTCATGAAGG + Intronic
1034010286 7:147522140-147522162 GGCACTAATTCCACCTGTGAGGG + Intronic
1034032497 7:147783716-147783738 GGCACTAATCCCATTTATGAGGG - Intronic
1034053178 7:148005276-148005298 GGCATTAATCCCACTCATGAGGG + Intronic
1034100823 7:148448976-148448998 GGCACTAATCCCATTCAGGAGGG - Intergenic
1034842460 7:154412128-154412150 GGCACTCATCCCATTCAGGAGGG + Intronic
1034882033 7:154770098-154770120 GGCACTAATCCCAATCATGAAGG - Intronic
1035398670 7:158551181-158551203 GGCCCTATTCCCACTGCGGATGG + Intronic
1035837552 8:2770732-2770754 GGCACTGATCCCATTCAGGAAGG + Intergenic
1036119401 8:5999466-5999488 GGCACTAATACTATTTGGGAGGG - Intergenic
1036161486 8:6392990-6393012 GGCACTAATCCCACTCATGAGGG - Intergenic
1036204271 8:6793930-6793952 GGCACTAATGCCACTGAGGAGGG + Intergenic
1036439213 8:8765527-8765549 GGCACTAATCCCATTCATGAGGG + Intergenic
1036586873 8:10132639-10132661 GGCACTAATCCCATTCATGATGG + Intronic
1036717187 8:11136610-11136632 GGTACTAATCCCACTCATGAGGG - Intronic
1036771319 8:11580139-11580161 GGCAGTAATCCCATTTGTGAGGG + Intergenic
1037002025 8:13731690-13731712 GGCACTAATCCCAATCAGAAGGG - Intergenic
1037174931 8:15935859-15935881 GGCACTAATCCCATTCATGAGGG + Intergenic
1037446715 8:18972649-18972671 GGCACTGATCCCATTGATGAGGG - Intronic
1037625735 8:20605336-20605358 GGCACTAATCCTATTCAGGAGGG - Intergenic
1037669336 8:21000897-21000919 GGCACTAATCTCAATCAGGAGGG - Intergenic
1037944918 8:22982956-22982978 GGCACTAATCCCATTCCTGACGG + Intronic
1038110075 8:24486740-24486762 GGCATTAATCCCACTTATGAGGG + Intronic
1038159740 8:25025200-25025222 GGCACTAATCCCATTCATGAGGG + Intergenic
1038161765 8:25046387-25046409 GGCACTAATCCCATTCATGAGGG - Intergenic
1038394297 8:27235719-27235741 GGCACTAATCCCATTCATGAAGG - Exonic
1039148092 8:34472285-34472307 GGCACTAACCCCAATCAGGAGGG - Intergenic
1040406067 8:47104197-47104219 GGCACTAATCCCATTCATGAGGG - Intergenic
1040488562 8:47897950-47897972 GGCACTCACCCTACTGGAGAAGG + Intronic
1040605538 8:48927763-48927785 GGCACTAATCCCATTTATGAGGG - Intergenic
1041128950 8:54676037-54676059 GGCACTCATCCCACTCATGAGGG + Intergenic
1041242671 8:55861668-55861690 GGCACAAATCCCATTGATGAGGG + Intergenic
1041258220 8:55997541-55997563 GGCACTAATCCCATTCGTGAGGG + Intronic
1041290750 8:56306184-56306206 GGCACTAATCCCATTCATGAGGG - Intronic
1041350517 8:56943518-56943540 GGCACTAACCCCACTCATGAGGG - Intergenic
1041373151 8:57185452-57185474 GGCACTAATTCCACTCGTGAGGG + Intergenic
1041737741 8:61129712-61129734 GGCACTAATCCCATCAGTGAAGG + Intronic
1041742801 8:61175257-61175279 GGCACTAATCCCATTCATGAGGG - Intronic
1041862394 8:62529496-62529518 GGCACTAATCCCATTCAGGAGGG - Intronic
1041909316 8:63071693-63071715 GGCACTAATCCCATTCATGAGGG - Intronic
1042202988 8:66299785-66299807 GGCACTAATCCCATTGATGAGGG - Intergenic
1042605859 8:70545875-70545897 GCCACTAATCCCATTCGTGAGGG + Intergenic
1042659681 8:71140898-71140920 GGCACTAATCCCATTCATGAGGG + Intergenic
1042691860 8:71508582-71508604 GCCACTAATCCCATTCAGGAGGG - Intronic
1042938750 8:74086752-74086774 GGCACTAATCCCATTCGGCAGGG - Intergenic
1042941476 8:74113034-74113056 GGCACTAATCCCACTGAGGAAGG - Intergenic
1043602568 8:81958385-81958407 GGCACTAATCCCATTCATGAGGG - Intergenic
1043715626 8:83481904-83481926 GGCACTAATCCCATTCATGAGGG - Intergenic
1043808111 8:84699575-84699597 GGCACTAATCACATTTGTGAGGG + Intronic
1044174012 8:89094231-89094253 GGCACTATTCCTACTCGTGAGGG + Intergenic
1044415567 8:91935392-91935414 GGCACTAATCCCATTTATGAGGG + Intergenic
1044483925 8:92727348-92727370 GGCTCTAAACCTACTGGGAAAGG + Intergenic
1044538541 8:93384605-93384627 GGCACTAATCCCATTCTTGAGGG + Intergenic
1044695258 8:94916292-94916314 GGCACTAATCCCATGGGACAAGG - Intronic
1044725659 8:95192394-95192416 GGCACTAATCCCATTCAGGAGGG - Intergenic
1044926278 8:97211490-97211512 GGCACTAATCCCACTCATGCGGG + Intergenic
1046418669 8:113949083-113949105 GACACTAATCCCATTTAGGAGGG - Intergenic
1046622001 8:116538054-116538076 GACACTAATCCCATTCAGGAGGG - Intergenic
1046674200 8:117090599-117090621 GGCACTAATCCCATTAATGAGGG + Intronic
1046902349 8:119536832-119536854 GGCACTAATCCCATTCATGAGGG - Intergenic
1046953372 8:120039136-120039158 GGCACTAATCCCATTCATGAGGG - Intronic
1047046907 8:121064027-121064049 GGCACTAATCCCATTCATGAGGG + Intergenic
1047183421 8:122610928-122610950 GGCACTCATCCCATTTGTGAGGG - Intergenic
1047415068 8:124657962-124657984 TGCACTAATCCCATTTGTGAAGG - Intronic
1047604001 8:126456175-126456197 GGCACTCATCCCCATTGGGATGG - Intergenic
1047820673 8:128516732-128516754 GGCACTAATCCCATTCATGAGGG - Intergenic
1047896184 8:129368959-129368981 GGCACTAATCCCATTCATGAGGG - Intergenic
1048519391 8:135139756-135139778 GGCACTACTCCCATTCAGGAGGG + Intergenic
1048602742 8:135935572-135935594 CGCACTAATCCCATTTGTGAGGG - Intergenic
1048713331 8:137238764-137238786 GGCACTAATCCCACTCAGGAGGG + Intergenic
1048841805 8:138573096-138573118 GGCACTAATCCCATTCATGAGGG + Intergenic
1049135471 8:140894149-140894171 GGCACTAATCCCATTCATGAGGG - Intronic
1049266274 8:141669510-141669532 GTCACTGATCCTACTGGTGAGGG - Intergenic
1049391984 8:142376432-142376454 GGCACTCATCCCACTGATGAGGG - Intronic
1049478326 8:142807136-142807158 GGAGCCAATCCCAGTGGGGAGGG - Intergenic
1049756324 8:144312715-144312737 AGCGCTGACCCCACTGGGGAGGG + Intronic
1049950565 9:639915-639937 GGCACTAATCCCATTTGTGAGGG + Intronic
1050005792 9:1128933-1128955 GGCACTAATCCCACTGGTGAGGG - Intergenic
1050017171 9:1246270-1246292 GGCACTAATCCCACTTATGAGGG - Intergenic
1050095173 9:2057318-2057340 GGCACTAATCCCATTCGTAAGGG + Intronic
1050327507 9:4511379-4511401 GGCACTAATCCCATTCAGGAGGG + Intronic
1050352194 9:4750901-4750923 GGCACTAAACCCACTCAGGAGGG + Intergenic
1050694477 9:8263287-8263309 GGCAGTAAACACCCTGGGGAGGG - Intergenic
1051351888 9:16205064-16205086 AGGACTAAGCACACTGGGGACGG + Intronic
1051446603 9:17146502-17146524 GGCACTAATCCCATTTATGAGGG - Intronic
1051550993 9:18329106-18329128 GGCACTAATCCCATTCATGAGGG - Intergenic
1051653143 9:19350639-19350661 GGGTATAATCCCACTGGAGAAGG + Intronic
1051960339 9:22753029-22753051 AGTACTCATTCCACTGGGGAAGG - Intergenic
1052143436 9:25018374-25018396 GCCATAAACCCCACTGGGGAAGG - Intergenic
1053272255 9:36758518-36758540 GGCACTAATCCCATTCAGGAGGG - Intergenic
1054704543 9:68449142-68449164 GGCACTAATCCCATTTATGAGGG + Intronic
1054910297 9:70449105-70449127 GGCACTAATCCCATTTATGAGGG - Intergenic
1054919492 9:70527799-70527821 GACACTAATCCCAGTCGTGATGG - Intergenic
1055466424 9:76571030-76571052 GGCACTAATCCCATTTGTGAGGG + Intergenic
1055618200 9:78095056-78095078 GGCACTAATCCCATTCATGAGGG - Intergenic
1055728697 9:79258681-79258703 GGCACTAATCCCATTCATGAGGG - Intergenic
1056219290 9:84435544-84435566 GGCACTAATCCCATTCATGAGGG + Intergenic
1056236182 9:84597030-84597052 GGCAATAATCCCACTCATGAGGG - Intergenic
1056335315 9:85562920-85562942 GGCACTAATCCCATTCAAGAGGG - Intronic
1056418872 9:86404213-86404235 GGCACTAATCCCATTCAAGAGGG - Intergenic
1056693348 9:88826427-88826449 GGCACTAATCCCATTCATGAGGG - Intergenic
1057056270 9:91963642-91963664 GGAACTAATCCCATTCAGGAGGG - Intergenic
1057522139 9:95768594-95768616 GGTACTAATCCCATTTGTGAGGG - Intergenic
1057565985 9:96166716-96166738 GGCACTAACCCCATTTGTGAGGG - Intergenic
1057706341 9:97397740-97397762 GGCACTAATCCCATTCATGAGGG + Intergenic
1058054472 9:100435757-100435779 GGCACTAACCCCACTGGACCAGG + Intronic
1058322866 9:103656590-103656612 GGCACTAATCCCATTTATGAAGG + Intergenic
1058335855 9:103828187-103828209 GGCACTAATCCCATTCATGAGGG - Intergenic
1058541275 9:106014930-106014952 GGCACTAATCCCATTCATGAGGG + Intergenic
1058794804 9:108487884-108487906 GGCACTAATCCCATTCATGAGGG + Intergenic
1059370193 9:113824428-113824450 GGCACTAATCCCATTCATGAAGG - Intergenic
1059489463 9:114655198-114655220 GGCACTAATCTCAATCGTGAGGG - Intergenic
1059613393 9:115923250-115923272 GGCACTAATCCCATTCATGAGGG + Intergenic
1059700216 9:116768656-116768678 GGCACTAAACCCATTTAGGAGGG - Intronic
1059903373 9:118953699-118953721 GGCACAAATCCCATTCGTGAGGG + Intergenic
1059999034 9:119941769-119941791 GGCACTAATCCCATTCATGAGGG - Intergenic
1060146025 9:121253117-121253139 GGCACTAATCCCATTCATGAGGG + Intronic
1060853926 9:126899936-126899958 GACACTAATCCCATTGGTGAGGG + Intergenic
1061283053 9:129608451-129608473 GGCAGGAATCCCACTTGTGAGGG + Intergenic
1062221214 9:135416591-135416613 GGCACTAATCCCATCCGTGAGGG - Intergenic
1203737602 Un_GL000216v2:151547-151569 TGCACTGATCACCCTGGGGAGGG - Intergenic
1203737825 Un_GL000216v2:153597-153619 TGCACTGATCACCCTGGGGAGGG - Intergenic
1203738114 Un_GL000216v2:156332-156354 TGCACTGATCACCCTGGGGAGGG - Intergenic
1185913024 X:4003288-4003310 AGCACTAATCCCATTTGTGAGGG - Intergenic
1186281564 X:7998747-7998769 GGCACTAATCCCATTCATGAGGG - Intergenic
1186387181 X:9121703-9121725 GACACTAATCCCACTCATGAAGG - Intronic
1186690103 X:11966282-11966304 GGCACTAATCCCATTCATGAGGG - Intergenic
1186745529 X:12564143-12564165 GGCACTAATCCTATTTGTGAGGG + Intronic
1187221768 X:17334150-17334172 GGCACTAATTCCACTCATGAGGG + Intergenic
1187420640 X:19130702-19130724 GGCACTAATCCCATTCATGAGGG - Intergenic
1188315446 X:28667859-28667881 GGCACTAATCCCATTCATGAGGG + Intronic
1188386930 X:29573158-29573180 GGCATTAATCCCATTCAGGAGGG + Intronic
1188691645 X:33136600-33136622 GGCACTAATCCCATTCATGAGGG - Intronic
1189068367 X:37836304-37836326 GGCACTAATCCCAATCATGAGGG - Intronic
1189256852 X:39646586-39646608 GGCACTAATCCCATTTATGAGGG - Intergenic
1189367135 X:40397525-40397547 GGCACTAATCCCACTCATGAGGG + Intergenic
1189449169 X:41111189-41111211 GGCACTAATCCCATTTGTGAAGG - Intronic
1189797428 X:44658919-44658941 GGCACTAATCCCACTCACGAGGG + Intergenic
1190762338 X:53446945-53446967 AGCACTAATCCCACTCATGAAGG - Intergenic
1190959323 X:55229518-55229540 GGCACTAATCCCATTCATGAGGG - Intronic
1192200618 X:69064356-69064378 GGCACTAATCCCATTCATGAGGG + Intergenic
1192533001 X:71905412-71905434 GGCACTAATCCCATTCATGAGGG - Intergenic
1193723972 X:85019296-85019318 GGCACTAATCCCATTTGTGAGGG - Intronic
1194957355 X:100196609-100196631 GGCACTAATCCCATTCATGAGGG - Intergenic
1195086929 X:101421752-101421774 GGCATTAATCCCACCTGTGAGGG + Intronic
1195462156 X:105139678-105139700 GGCACTAATCCCATTCATGAGGG + Intronic
1196129608 X:112140634-112140656 GGCACTAATCCCATTCATGAGGG + Intergenic
1196251105 X:113460867-113460889 GGCACTAATCCCATTCATGAAGG + Intergenic
1196327274 X:114421576-114421598 GGCACTAATCCCATTCATGAGGG + Intergenic
1196404061 X:115346174-115346196 GGCACTAATCCCATTCATGAGGG - Intergenic
1196931299 X:120684445-120684467 GGCACTAATCCCATTCATGAGGG + Intergenic
1197596029 X:128465104-128465126 GGCACTAATCCCATTCATGAGGG - Intergenic
1197828086 X:130612315-130612337 GGCACTAATCCCAATCGTGAGGG + Intergenic
1198463969 X:136888290-136888312 GGCACTAATCCCATTCATGATGG - Intergenic
1198588368 X:138148097-138148119 GGCACTAATCCCATTTATGAAGG + Intergenic
1198591906 X:138192878-138192900 GGCACTAATCCAATTCAGGAGGG - Intergenic
1198749280 X:139922577-139922599 GGCACTAATCCCATTTATGAGGG - Intronic
1199156675 X:144557469-144557491 GGCACTAATCCCATTCATGAGGG + Intergenic
1199829986 X:151539893-151539915 GGCTCTACTTCCACTGGGGAGGG - Intergenic
1200039770 X:153356357-153356379 GGCACCAAGCCCACTTTGGAAGG + Intronic
1200148494 X:153939832-153939854 GGGAATAATACCACTGGAGAGGG - Intronic
1200180870 X:154150018-154150040 GGCACTAATCCCATTCATGAGGG + Intronic
1200186513 X:154187132-154187154 GGCACTAATCCCATTCATGAGGG + Intergenic
1200192165 X:154224270-154224292 GGCACTAATCCCATTCATGAGGG + Intronic
1200197920 X:154262074-154262096 GGCACTAATCCCATTCATGAGGG + Intronic
1201176179 Y:11309591-11309613 TGCACTGATCACCCTGGGGAGGG - Intergenic
1201177433 Y:11317669-11317691 TGCACTGATCACCCTGGGGAGGG - Intergenic
1201178521 Y:11324030-11324052 TGCACTGATCACCCTGGGGAGGG - Intergenic
1201451641 Y:14121870-14121892 GGCACTAATCCCATTCATGAAGG - Intergenic
1201632822 Y:16088147-16088169 GGCACAAATCCCATTCAGGAGGG + Intergenic