ID: 969398470

View in Genome Browser
Species Human (GRCh38)
Location 4:6938335-6938357
Sequence CCTCACATGCTCCTCTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 171}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969398464_969398470 -1 Left 969398464 4:6938313-6938335 CCCTGCCCTTGGGTGGACATAAC 0: 1
1: 0
2: 1
3: 10
4: 92
Right 969398470 4:6938335-6938357 CCTCACATGCTCCTCTGGAGAGG 0: 1
1: 0
2: 3
3: 15
4: 171
969398463_969398470 2 Left 969398463 4:6938310-6938332 CCACCCTGCCCTTGGGTGGACAT 0: 1
1: 0
2: 0
3: 15
4: 192
Right 969398470 4:6938335-6938357 CCTCACATGCTCCTCTGGAGAGG 0: 1
1: 0
2: 3
3: 15
4: 171
969398459_969398470 12 Left 969398459 4:6938300-6938322 CCATGCTCGGCCACCCTGCCCTT 0: 1
1: 0
2: 2
3: 44
4: 387
Right 969398470 4:6938335-6938357 CCTCACATGCTCCTCTGGAGAGG 0: 1
1: 0
2: 3
3: 15
4: 171
969398467_969398470 -7 Left 969398467 4:6938319-6938341 CCTTGGGTGGACATAACCTCACA 0: 1
1: 0
2: 0
3: 12
4: 70
Right 969398470 4:6938335-6938357 CCTCACATGCTCCTCTGGAGAGG 0: 1
1: 0
2: 3
3: 15
4: 171
969398465_969398470 -2 Left 969398465 4:6938314-6938336 CCTGCCCTTGGGTGGACATAACC 0: 1
1: 0
2: 0
3: 6
4: 76
Right 969398470 4:6938335-6938357 CCTCACATGCTCCTCTGGAGAGG 0: 1
1: 0
2: 3
3: 15
4: 171
969398466_969398470 -6 Left 969398466 4:6938318-6938340 CCCTTGGGTGGACATAACCTCAC 0: 1
1: 0
2: 0
3: 4
4: 60
Right 969398470 4:6938335-6938357 CCTCACATGCTCCTCTGGAGAGG 0: 1
1: 0
2: 3
3: 15
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969398470 Original CRISPR CCTCACATGCTCCTCTGGAG AGG Intronic
900009989 1:97711-97733 TCTTACATGCTCAACTGGAGAGG - Intergenic
900026100 1:274295-274317 TCTTACATGCTCAACTGGAGAGG - Intergenic
900035884 1:408148-408170 TCTTACATGCTCAACTGGAGAGG - Intergenic
900057506 1:643899-643921 TCTTACATGCTCAACTGGAGAGG - Intergenic
900352670 1:2243334-2243356 CCTCTCGTGCTCCTCGGCAGGGG + Intronic
900656853 1:3762833-3762855 CCTCACCTGCTCCCCTGGAGTGG - Intronic
901667617 1:10835552-10835574 CCTCTTATGCTCCTATGGTGTGG + Intergenic
902641832 1:17771767-17771789 CCTGACATGCTGCAGTGGAGGGG + Intronic
903741837 1:25562895-25562917 CCTCACAAGCACCTTTGGGGAGG - Intronic
904355372 1:29935273-29935295 GCTCACATTCTCTTCTGGAAAGG - Intergenic
904466455 1:30710910-30710932 CCTCACAGGCGGCTCTGAAGAGG + Intergenic
905149354 1:35915024-35915046 CTTCACATGCTCCTCTGCAAAGG + Intronic
906648075 1:47490457-47490479 CCTCACATTCAACACTGGAGAGG - Intergenic
915018173 1:152756319-152756341 CCTCACATACTCCTTTATAGTGG - Intronic
915895982 1:159811321-159811343 CCCCACTTCCTCCTCTGCAGGGG + Intronic
922258419 1:223913716-223913738 TCTTACATGCTCAACTGGAGAGG - Intergenic
923263918 1:232294235-232294257 ACCCACATGCTCATCTGCAGTGG - Intergenic
924339616 1:243016478-243016500 TCTTACATGCTCAACTGGAGAGG - Intergenic
1062817014 10:508273-508295 CCGGAGATGCTGCTCTGGAGTGG - Intronic
1063667109 10:8069265-8069287 CCTGACATGCTCCAGTGGAGTGG + Intronic
1065456503 10:25911737-25911759 CGTCACATGCACATCTGGATGGG - Intergenic
1067624774 10:47917146-47917168 CCTCCCATGCTCTGCTGCAGAGG - Intergenic
1068771674 10:60828437-60828459 CCTCACTTGCACCCCTGTAGAGG - Intergenic
1069844120 10:71358842-71358864 TCTCACATGCTCAGCTGGAAGGG - Intronic
1070789429 10:79180618-79180640 CCTGAGCTGCCCCTCTGGAGTGG + Intronic
1070796365 10:79219233-79219255 TCTCTCCTGCTCCTCTGGGGAGG - Intronic
1076259792 10:129056119-129056141 CTGCACGTGCTCCGCTGGAGCGG + Intergenic
1076564253 10:131387281-131387303 TCTCTCTTGCTCCTCTGCAGCGG + Intergenic
1078985137 11:16586607-16586629 TCTCACCTTGTCCTCTGGAGTGG - Intronic
1079340217 11:19605592-19605614 CCTCACATGCTCCCTTGCACAGG - Intronic
1079391461 11:20025437-20025459 CCTTCAAGGCTCCTCTGGAGAGG - Intronic
1079591766 11:22191715-22191737 CCTCACAGGCCCCTCTGCATTGG - Intergenic
1081671037 11:44942873-44942895 CCTCACCTGCCCCACTGGCGAGG + Intronic
1084273877 11:68042248-68042270 CCCCACAGGCTCCTCCTGAGAGG - Intronic
1086095180 11:83043095-83043117 AGTCACATGCTCCTCTTGATGGG - Intronic
1089109281 11:116042271-116042293 CCTGACATGCTCCGCCTGAGAGG - Intergenic
1094840373 12:34340304-34340326 CCGCACATGCGCCGCAGGAGCGG - Intergenic
1095967167 12:47876755-47876777 CCTCACATGCTCCTGTCCTGAGG + Intronic
1096257806 12:50073608-50073630 CATGTCATTCTCCTCTGGAGAGG + Intronic
1097013233 12:55967546-55967568 CCTCACTGGCCCCTCTGGGGAGG + Intronic
1098723781 12:73936122-73936144 CCTCACATCCTCTTCTGGAGTGG + Intergenic
1101156515 12:101932903-101932925 CCTCAAATGATCCACCGGAGTGG - Intronic
1101968167 12:109294817-109294839 CTTCACATGCCACTGTGGAGAGG - Intronic
1102477351 12:113197101-113197123 CATCCCATACTCCTCTGGATGGG - Intronic
1104610524 12:130223645-130223667 CATCACATGCTCTTCTGGAGAGG - Intergenic
1105070778 12:133233162-133233184 CCTCCCAGCCTCCTCTGCAGTGG - Intronic
1114640380 14:24215731-24215753 CCTCACCTGCTCTTATGGAACGG + Exonic
1115464878 14:33704061-33704083 CCTCACATAGTCCTTTGAAGTGG - Intronic
1116784895 14:49276867-49276889 CCTCACATGCTTCTCTTGGGAGG - Intergenic
1117563982 14:56975023-56975045 CCTCAAATGTTGCTATGGAGTGG + Intergenic
1117994080 14:61462107-61462129 CCTCACTTGCTTCTTTGAAGTGG - Intronic
1119212804 14:72845491-72845513 CCTCACCTGTGCCTGTGGAGAGG - Intronic
1121144365 14:91570921-91570943 CCTCAAATGCTCCTCTTGCCTGG + Intergenic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1122379052 14:101288416-101288438 CCTCTTCTGCTCCCCTGGAGAGG + Intergenic
1122847878 14:104510557-104510579 GCTCACATCCTCATCTGGTGGGG - Intronic
1202922924 14_KI270724v1_random:2221-2243 CCACCCAGGCTCCTCTGGAAGGG - Intergenic
1123736224 15:23186686-23186708 GCTGTCATTCTCCTCTGGAGTGG - Intergenic
1124286930 15:28409659-28409681 GCTGTCATTCTCCTCTGGAGTGG - Intergenic
1124295771 15:28501968-28501990 GCTGTCATTCTCCTCTGGAGTGG + Intergenic
1124661525 15:31554185-31554207 CCTCAGAGGCTACTCTGGGGAGG - Intronic
1130653795 15:85777707-85777729 CCTGACCCGTTCCTCTGGAGTGG - Intronic
1131715085 15:95100688-95100710 GCTGACATCCTCCACTGGAGTGG - Intergenic
1134065545 16:11225820-11225842 CCTCACATCCTCATCTGAAGAGG + Intergenic
1134265708 16:12690918-12690940 CTTCACCTGCTCCTCTACAGGGG - Intronic
1136293554 16:29289760-29289782 CCTCACAGGCACCTCTGGGATGG - Intergenic
1136590320 16:31214587-31214609 CCTCACATCCTACACTGGATGGG - Intronic
1137354889 16:47751818-47751840 CCTCTTGTGCTCCTCTAGAGGGG + Intergenic
1138245032 16:55461023-55461045 CCTCAGCTTGTCCTCTGGAGTGG - Intronic
1139214766 16:65116495-65116517 CCTGACATGGTCCTCTGCACTGG - Intronic
1141420895 16:83914843-83914865 GCTCACATGCTGCTGTGTAGCGG - Intronic
1142454340 16:90209193-90209215 TCTTACATGCTCAACTGGAGAGG + Intergenic
1142510528 17:389834-389856 GCTGAGATGCGCCTCTGGAGAGG + Intergenic
1144504399 17:15817676-15817698 GCTCACGTGCTCCTCTGCATTGG - Intergenic
1145787722 17:27604852-27604874 CCTGACATGCACCTCTGCAATGG - Intronic
1151031214 17:70742230-70742252 CCTCATATGCTCCCCTCGTGGGG + Intergenic
1151215955 17:72576465-72576487 CTCCCCATTCTCCTCTGGAGAGG - Intergenic
1151274040 17:73020613-73020635 TCTCACATGGTCCCCTGGGGAGG - Intronic
1151416822 17:73972021-73972043 CCTCCTATGCTCCTCAGGATAGG + Intergenic
1154350611 18:13580250-13580272 CCTTCCCTGCTGCTCTGGAGAGG + Intronic
1155256698 18:24004115-24004137 CCTCACTTCTGCCTCTGGAGTGG - Intronic
1158749512 18:60242710-60242732 CCTCACTTGCTCCTCTCCAGAGG + Intergenic
1161031687 19:2060691-2060713 CCTCACAGGGTCCTCATGAGAGG + Intergenic
1161124359 19:2547479-2547501 CCTCACAGGATCCTCACGAGAGG - Intronic
1161326895 19:3668371-3668393 CCTCACAGGGTCCTCACGAGCGG + Intronic
1163130055 19:15266696-15266718 CCTCCCATGCTGTTCTGAAGTGG - Intronic
1165045143 19:33098661-33098683 CCTCACAACCACCTCTGGAGTGG - Intronic
1167561341 19:50227644-50227666 CCTGAGATGCTCCCCTGGAAAGG - Intronic
1167799362 19:51730211-51730233 CCTCTCTTGCTTCCCTGGAGAGG - Intergenic
925231151 2:2235152-2235174 CCTCACATCCTCCCTTAGAGGGG + Intronic
925293692 2:2764321-2764343 CCATGCTTGCTCCTCTGGAGTGG - Intergenic
925877672 2:8326949-8326971 CCTCACCAGCTTCTGTGGAGGGG - Intergenic
926853745 2:17229366-17229388 CCACACATGCTCTCCTGGAAAGG + Intergenic
928639080 2:33278731-33278753 CATTACATTCTCCTCTGGATGGG - Intronic
929000717 2:37344835-37344857 CCTCACCTTCTCCTCTGGCCAGG - Exonic
929920516 2:46168131-46168153 CCTCACACTCTTCCCTGGAGTGG - Intronic
930857269 2:56032235-56032257 CAGCACATGCCCGTCTGGAGAGG - Intergenic
934503822 2:94877206-94877228 GCTCACATACTCCTGTGGACAGG + Intergenic
936428343 2:112437305-112437327 CCTCCCATGCACCCCTGGAAAGG + Intergenic
939846019 2:147247012-147247034 CCACACTTGCTCCTCTGCTGAGG + Intergenic
940035492 2:149308635-149308657 CCTCTCTTGCTCTTCTGCAGAGG + Intergenic
940188094 2:151009164-151009186 CTTCAGATGCTCCTCTGGCCAGG + Intronic
944141837 2:196465077-196465099 CCTAATATGCTCTCCTGGAGAGG + Intronic
944293918 2:198040558-198040580 CCTCAGATCCTCCTCTAGAACGG - Intronic
947971492 2:234328849-234328871 CCTCACCTGCGTCTCTGCAGCGG + Intergenic
948608236 2:239149702-239149724 GCTCACGTGCTCCTGGGGAGGGG + Intronic
949085799 2:242153848-242153870 TCTTACATGCTCAACTGGAGAGG + Intergenic
1172667119 20:36607979-36608001 CCTGAGATGCTCCTGAGGAGTGG - Intronic
1173164280 20:40675632-40675654 CCTCACATAATCTTCTGAAGGGG - Intergenic
1175942347 20:62543293-62543315 CCTCACAGGGTCCTTAGGAGAGG - Intergenic
1176373906 21:6077906-6077928 CCTCCCATGCACCCCTGGAAAGG - Intergenic
1178775733 21:35548599-35548621 TCTCACACTGTCCTCTGGAGAGG + Intronic
1179623846 21:42636368-42636390 CCTCACATCATCCCCTGGGGCGG + Intergenic
1179749571 21:43460337-43460359 CCTCCCATGCACCCCTGGAAAGG + Intergenic
1179784904 21:43724061-43724083 CCTCACAGGGTCTTCTGGTGGGG - Intronic
1179824673 21:43957411-43957433 CCTGACTTGGTCCTCTGGAAGGG - Intronic
1181424540 22:22825005-22825027 CCTCAGATTCTCCTCTAGAGGGG + Intronic
1182129397 22:27839989-27840011 ACCCAAATGCTCCTCTGCAGGGG - Intergenic
1182738604 22:32549103-32549125 ACCCACATGCTCCTCAGCAGGGG + Intronic
1184651969 22:45923527-45923549 CCTCACAACCTCCTATGCAGTGG - Intronic
1184961759 22:47934248-47934270 CCTCTGAAGCTCCTCTGGTGGGG - Intergenic
949587293 3:5454378-5454400 CCTCACATGCGCCTTTGCTGGGG - Intergenic
952990651 3:38828270-38828292 CCTCTCATTCTCATCTGGCGTGG + Intergenic
955191868 3:56769303-56769325 CCTCATGCGCTCCTCTGGTGTGG - Intronic
956224311 3:66938565-66938587 GCTCAAATGCTCCTGTGGAAAGG - Intergenic
960639313 3:119811295-119811317 CCTCACAAACTCCACTGCAGAGG + Intronic
963860604 3:150306013-150306035 CCTTTCATGGTCCTCTGGACTGG + Intergenic
965976550 3:174630982-174631004 CATAACAGGCTCTTCTGGAGTGG - Intronic
968887581 4:3343154-3343176 CCTCCCCTCCTCCTCTGTAGTGG + Intronic
969398470 4:6938335-6938357 CCTCACATGCTCCTCTGGAGAGG + Intronic
969406244 4:6994221-6994243 CCTCACATTCTGCTTTGGAGAGG - Exonic
972802205 4:42488739-42488761 CAGCAGATGATCCTCTGGAGAGG - Intronic
973945463 4:55949907-55949929 CCTCACATCCTGCTTTGGAGGGG - Intronic
978371240 4:108031385-108031407 CCTCACAGGCTCCTCAGGCTTGG - Intronic
979237498 4:118418749-118418771 TCTTACATGCTCAACTGGAGAGG + Intergenic
983035885 4:162865153-162865175 CCTCAGATTCTCCTTTGGTGGGG - Intergenic
984712531 4:182897788-182897810 CCTCAGGTGCTCCTCTGGGTTGG - Intronic
985124593 4:186680479-186680501 CCTCCCCTGCCCCTCTGGAAGGG + Intronic
985941299 5:3138525-3138547 CCTCACATCCGCCTCTGTGGGGG - Intergenic
986430827 5:7679464-7679486 CCTCACCTTCTCTTCTGCAGTGG - Intronic
988827439 5:34952059-34952081 CCTCTGTTGCTTCTCTGGAGTGG + Intronic
992508509 5:77410543-77410565 CCTCACAGCATTCTCTGGAGAGG - Intronic
994605330 5:101960142-101960164 CCTCACAAGCTGCTTTGCAGAGG + Intergenic
997582033 5:135024256-135024278 CCTGACCTGCTCCTCAGCAGTGG + Intergenic
1000933426 5:167280346-167280368 CCTCCCCTTCTCCACTGGAGTGG - Intergenic
1001235777 5:170028102-170028124 CCTCACATTTCTCTCTGGAGTGG + Intronic
1001881313 5:175246635-175246657 CCTCAGATGCTTTTCTTGAGAGG - Intergenic
1002081083 5:176737867-176737889 CTTCACTTGGTCCTTTGGAGTGG - Intergenic
1002737937 5:181410716-181410738 TCTTACATGCTCAACTGGAGAGG + Intergenic
1003620110 6:7692016-7692038 CCTCCCATGGTCCTCAGGTGTGG + Intergenic
1006788637 6:36684391-36684413 CCTCACCTGCTCTGCTGCAGGGG + Exonic
1007839182 6:44701674-44701696 TCTGACAAGCCCCTCTGGAGGGG + Intergenic
1019170185 6:170129438-170129460 ACTCACATCCTGCTCTGCAGAGG + Intergenic
1019243037 6:170686274-170686296 TCTTACATGCTCAACTGGAGAGG + Intergenic
1019269733 7:140198-140220 CCTCCCAGGCTGCTCAGGAGTGG + Intergenic
1020556522 7:9677270-9677292 GTTCACATGCTCATCTGCAGGGG + Intergenic
1021400402 7:20203611-20203633 CCTCACCTACCCCTCTGGATTGG + Intronic
1023254939 7:38303948-38303970 CCTCACAAGCGTCACTGGAGTGG + Intergenic
1024265334 7:47602002-47602024 CCCCACCTGCTCCTGTGCAGAGG + Intergenic
1029280544 7:99432762-99432784 CCGCATCTGCTCCTCTGAAGGGG - Intronic
1029283812 7:99452913-99452935 CCGCCCCTGCTCCTGTGGAGTGG + Intronic
1029576570 7:101407357-101407379 CCTCACCTGTTCTTCTAGAGAGG + Intronic
1030111403 7:106030128-106030150 CCTCACATGCTGCCCTCTAGAGG - Intronic
1033806496 7:144960077-144960099 ACTCAGATGCTCCTCTGTTGTGG + Intergenic
1034831081 7:154308014-154308036 CCTCACATCCTCATCTTGTGAGG + Intronic
1035505084 8:121888-121910 TCTTACATGCTCAACTGGAGAGG - Intergenic
1036645679 8:10610494-10610516 GCCCACATCCTCCTCTGGTGTGG - Exonic
1038257417 8:25962974-25962996 CCTCATGTGCTCTTCTGGAGGGG + Intronic
1038290039 8:26241102-26241124 CCACACAGCCTCCTCTGGAGAGG - Intergenic
1039620491 8:38992703-38992725 GCTCCCATCCTCCTCTGTAGAGG + Intronic
1044212264 8:89563462-89563484 CCTCACAAGCTTCTCTACAGAGG - Intergenic
1047928182 8:129701411-129701433 CCTCACAAGAACCTGTGGAGAGG + Intergenic
1048319930 8:133390711-133390733 CCTCACATGATCTCATGGAGAGG - Intergenic
1048390492 8:133959083-133959105 TCTCACATGCTTCTCTGGCCTGG - Intergenic
1052792519 9:32889275-32889297 CCTCATATGCCCTTCTGGAGTGG - Intergenic
1057126563 9:92620407-92620429 CCTCACATTCTGCTCTGTAGAGG - Exonic
1058435728 9:104961315-104961337 TCTCACATGGTCCTCTGGGAAGG + Intergenic
1058823661 9:108755540-108755562 CCTCCCATGGTGCTCTGGAGGGG - Intergenic
1058980217 9:110161993-110162015 CCTCCCATCCTCTTCTGGTGTGG + Intronic
1062607828 9:137355924-137355946 CCTCCCAGGCCCCTCTGGACAGG - Intronic
1203603226 Un_KI270748v1:35498-35520 TCTTACATGCTCAACTGGAGAGG + Intergenic
1188366619 X:29323642-29323664 CATCAGATACTTCTCTGGAGTGG + Intronic
1189256477 X:39643702-39643724 CCTCACATGCTTCTGTGTAGAGG - Intergenic
1189713886 X:43844694-43844716 CCTCACTCTCTCTTCTGGAGCGG + Intronic
1193199773 X:78674789-78674811 AATCACATGCTCCTCTGAAATGG - Intergenic
1198522928 X:137471050-137471072 CAGCAAATGCTCCTTTGGAGTGG + Intergenic
1201175770 Y:11307641-11307663 CCTCCCCGGCTCCTCTGGAAGGG + Intergenic
1201989942 Y:20012526-20012548 CCTCACATGATTCTATGGTGAGG - Intergenic
1202385294 Y:24320552-24320574 TCTTACATGCTCAACTGGAGAGG + Intergenic
1202485491 Y:25349576-25349598 TCTTACATGCTCAACTGGAGAGG - Intergenic