ID: 969403315

View in Genome Browser
Species Human (GRCh38)
Location 4:6971664-6971686
Sequence GATGCTGATGTGACTACTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 181}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969403315_969403321 10 Left 969403315 4:6971664-6971686 CCCGGAGTAGTCACATCAGCATC 0: 1
1: 0
2: 0
3: 21
4: 181
Right 969403321 4:6971697-6971719 TTGCTAGAAATGCACGTTCTCGG 0: 1
1: 6
2: 57
3: 288
4: 851
969403315_969403322 11 Left 969403315 4:6971664-6971686 CCCGGAGTAGTCACATCAGCATC 0: 1
1: 0
2: 0
3: 21
4: 181
Right 969403322 4:6971698-6971720 TGCTAGAAATGCACGTTCTCGGG 0: 2
1: 15
2: 108
3: 420
4: 1425

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969403315 Original CRISPR GATGCTGATGTGACTACTCC GGG (reversed) Intronic
900558107 1:3290122-3290144 CATGCTGATGTGACAAACCCGGG + Intronic
902178622 1:14670449-14670471 GATGCTGCTGCCACTGCTCCAGG + Intronic
902240668 1:15087000-15087022 GCTGCTGATGCTACTAGTCCAGG + Intronic
902951519 1:19886841-19886863 GATGCTGATGCTCCTAGTCCGGG + Intronic
903579053 1:24357466-24357488 AATGCTGATTTAACTCCTCCAGG - Exonic
904539182 1:31221328-31221350 GATGCTGATGCTGCTAGTCCAGG - Intronic
907265028 1:53253689-53253711 GATGGTGAGGTGATTATTCCAGG - Intronic
911639912 1:100277036-100277058 GAATCTGGTGTGACTTCTCCTGG + Intronic
913226011 1:116698950-116698972 GATTCTGATGTGACTGGTTCAGG - Intronic
917674981 1:177310319-177310341 GATGCTGCTTTGGCTACCCCTGG + Intergenic
919310460 1:195900302-195900324 AATACTGTTGTGGCTACTCCTGG + Intergenic
919620823 1:199862836-199862858 CATTCTGCTGTGGCTACTCCTGG - Intergenic
920077122 1:203345489-203345511 ATTTCTGATGTGACTGCTCCTGG + Intronic
920215616 1:204359887-204359909 GATGCTGTTGTGGTTACTGCAGG + Exonic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922565652 1:226600025-226600047 GATGCTGATGTGCCCCATCCTGG - Intronic
922843925 1:228667976-228667998 TATGCTGATGAGATAACTCCTGG + Intergenic
922929223 1:229375850-229375872 GATGCTGTTGGGACTAGCCCTGG - Intergenic
923638770 1:235729004-235729026 GATGCTGATGCTACTAATTCAGG + Intronic
1063076915 10:2726245-2726267 GATGCTGATTTGACTAGAGCAGG - Intergenic
1063154713 10:3368658-3368680 AAAGCTGATGTGACTAATCCAGG - Intergenic
1064880843 10:20051768-20051790 GATGCTCATGCCACTAATCCAGG + Intronic
1065747833 10:28858139-28858161 CATGCTGATGGGAATAATCCAGG - Intronic
1065770380 10:29072620-29072642 GATGCTGATGCTACTGCTCTGGG - Intergenic
1067011810 10:42721219-42721241 GATGCTGATGTTGCTGCTCTGGG - Intergenic
1068826970 10:61451673-61451695 GATGGGAATGTGACTACCCCTGG - Intronic
1069443423 10:68450394-68450416 GATGCTGATGCTACTGGTCCAGG - Intronic
1069767496 10:70874030-70874052 GATACTGATGCTACTGCTCCAGG + Intronic
1070522837 10:77269530-77269552 GATGCTGATGTAATTGCTCTGGG - Intronic
1071402019 10:85282590-85282612 GATGCTGATGCTGCTGCTCCAGG - Intergenic
1071444419 10:85732303-85732325 AATGATGATGTGACCATTCCAGG + Intronic
1071831765 10:89379240-89379262 GATGCTGATGTTGCTAGTCAGGG - Intronic
1073045725 10:100637179-100637201 GATGCTGATGCGACAGGTCCAGG - Intergenic
1073792324 10:106953057-106953079 TATACTGGTGTGACTACTTCAGG - Intronic
1074471706 10:113733125-113733147 GATGCTGATGTGGCCAGTCCAGG - Intergenic
1075950543 10:126473896-126473918 GATGCTGATGCTACTGCTCCAGG + Intronic
1076998202 11:309393-309415 GGTGCTGCTGTGACTTCACCTGG + Intronic
1078647684 11:13157115-13157137 GATGCTGATGTTACTCATCTAGG - Intergenic
1083065539 11:59919945-59919967 GATGCTGATTTTACTACTGATGG + Intergenic
1083097310 11:60264860-60264882 GATACTGATGCTACTACTCTGGG + Intergenic
1083530490 11:63417510-63417532 GATACTGTTGTGATTCCTCCTGG - Intergenic
1086046599 11:82539884-82539906 GATGATGATGTGACTGGTCTGGG + Intergenic
1087217181 11:95506725-95506747 GATGCTGCTGTTACTGCTTCTGG + Intergenic
1088844148 11:113650815-113650837 GATGCTGATGTGTCTGGTCCAGG + Intergenic
1089378917 11:118013823-118013845 GCTGCTGATGTGACCACTGATGG + Intergenic
1089533291 11:119145670-119145692 GATGCTGATGCTGCTAGTCCAGG - Intergenic
1091349375 11:134880926-134880948 AATGCTGATGCCACCACTCCAGG - Intergenic
1095752318 12:45727261-45727283 AAAGCTGAGGTGACTGCTCCGGG - Intergenic
1100527963 12:95437839-95437861 GATGCTGATGTTGCTGGTCCAGG - Intergenic
1101622999 12:106408397-106408419 GATGCAGATGCTACTAGTCCAGG - Intronic
1102577660 12:113866603-113866625 GATGCTGATGCTACCAGTCCAGG - Intronic
1102718986 12:115000381-115000403 TATGCTCATGTGACTACTACAGG + Intergenic
1104546040 12:129713868-129713890 GATGCCGATGTGGCTGGTCCAGG + Intronic
1107318053 13:39155393-39155415 GGTCCAGATGTGACTTCTCCTGG + Intergenic
1107893361 13:44933580-44933602 GATGCTGATGTGGCTGGTCCTGG - Intergenic
1108439729 13:50438704-50438726 TATGCTGATGAGAATAATCCAGG + Intronic
1113061772 13:106330118-106330140 GCTCCTGCTGTGACGACTCCAGG - Intergenic
1115301915 14:31894239-31894261 TATGCTGATGGGAATAATCCAGG - Intergenic
1117258671 14:54006469-54006491 GATGCTGATGCTACTGGTCCAGG - Intergenic
1128399699 15:67265463-67265485 GATGCTCATGCCACTCCTCCAGG - Intronic
1130368481 15:83262659-83262681 GATGCTGATGTTACTATTCTGGG - Intronic
1130368487 15:83262752-83262774 GATGCTGATGTTACTATTCTGGG - Intronic
1130402813 15:83573402-83573424 GATGCTGATGTTGCTGGTCCAGG - Intronic
1132028595 15:98422364-98422386 GATGCTGATGTTGCTGGTCCGGG + Intergenic
1132653388 16:1031499-1031521 GATGCTGCTGAGACAACTTCAGG + Intergenic
1135838972 16:25856240-25856262 TATGCTAATGAGATTACTCCAGG + Intronic
1137024083 16:35456015-35456037 GATGCTGCTGTTGCTGCTCCAGG + Intergenic
1140923575 16:79561937-79561959 GATACTGTTGTGTCTACTCTTGG - Intergenic
1141016288 16:80453355-80453377 GATGCTGAAGTGGCTACACACGG + Intergenic
1141134529 16:81456963-81456985 GAGGCTGAGGTGACCACCCCAGG - Intronic
1142141008 16:88472871-88472893 GAGGCTGATGTGTTAACTCCTGG + Intronic
1145206918 17:20989551-20989573 GGTTCTGTTGTGACGACTCCAGG + Intergenic
1146605369 17:34253065-34253087 GATGCTGATATGACTAAGCCAGG + Intergenic
1149077555 17:52614742-52614764 GTTGCTGATGTGAATGGTCCAGG + Intergenic
1151287063 17:73119806-73119828 GATGCTGATGTTGCTGGTCCAGG - Intergenic
1151713438 17:75819425-75819447 GATGGGGATGTGATTTCTCCTGG + Intronic
1151737512 17:75953697-75953719 GATGCTGATGCTGCTATTCCAGG - Intronic
1152773427 17:82185045-82185067 GATGGTGATGTGACTCTGCCTGG + Intronic
1157201430 18:45663221-45663243 GATGCTGATGCTACTGGTCCAGG + Intronic
1157740702 18:50090208-50090230 GATGGTGATTTGATTCCTCCTGG - Intronic
1163080876 19:14941245-14941267 GATGCTGATGGGGCTGTTCCAGG + Intergenic
1163746220 19:19049696-19049718 GCTGCAAATTTGACTACTCCAGG + Intronic
1164007424 19:21163412-21163434 AATGCTGATGTTGCTACCCCTGG - Intronic
1164044741 19:21527160-21527182 GGTGCTGATGTAACTCCCCCTGG - Intronic
926075255 2:9937816-9937838 AATGCTGATGTCACTGGTCCAGG - Intergenic
929392164 2:41482198-41482220 GATGCTGATGAGAGTAATCTTGG - Intergenic
934968758 2:98746007-98746029 GAAGCAGATGCGACTACTCTGGG - Intergenic
938738284 2:134206348-134206370 GATGCTGATGTGAATAGTAGGGG + Intronic
939080097 2:137649697-137649719 CATGCTGATTTGCCTACTACAGG + Intronic
941316472 2:163999368-163999390 GATGCTGATGTTGCTAGTCCAGG + Intergenic
941689439 2:168483952-168483974 TATGCTGATGTTGCTAGTCCAGG + Intronic
946854417 2:223939119-223939141 GATGCTGATGCTGCTAGTCCAGG - Intronic
947500382 2:230666963-230666985 GATGTTGATGAGATCACTCCAGG - Intergenic
948080766 2:235203360-235203382 GATGCTTTTGTGAGTTCTCCTGG + Intergenic
948160497 2:235819442-235819464 GATGCTGATGCTGCTAATCCAGG + Intronic
1169134528 20:3189260-3189282 GATTCTGATTTGACTGGTCCTGG + Intergenic
1169564329 20:6837012-6837034 GATGCTGACGTGGCTTCTACAGG + Intergenic
1172699601 20:36845113-36845135 GATGCTGATGTTACTGGTCCAGG - Intronic
1173030782 20:39357575-39357597 GATGCTGATGAGAATGCTACTGG + Intergenic
1173349522 20:42232464-42232486 GATGCTGATGCTACTGGTCCAGG + Intronic
1174733873 20:52945378-52945400 GCTGCTGATGCCACTGCTCCTGG + Intergenic
1175692954 20:61079192-61079214 GATGCTGATGGGGCTACATCAGG - Intergenic
1176260715 20:64178057-64178079 GATCCTGAGGTGCCTCCTCCGGG - Intronic
1176697803 21:10001845-10001867 TGAGCTGATTTGACTACTCCAGG + Intergenic
1184093178 22:42302893-42302915 GATGCTGGGGTGACTATTCATGG + Intronic
951594676 3:24305177-24305199 GATGCTGATGTTGCTGATCCAGG - Intronic
953704879 3:45223696-45223718 GATGCTGATGTTGCTGGTCCAGG + Intergenic
953757030 3:45655569-45655591 GATGCTGATGGTGCTAGTCCAGG - Intronic
956133696 3:66078168-66078190 TATGCTGCAGTGACAACTCCTGG + Intergenic
961925672 3:130477603-130477625 GATGCTGATGTGGCTGGTCCAGG - Intronic
962130387 3:132667140-132667162 GATACTGATGTTACTACTTCAGG - Intronic
962663820 3:137633592-137633614 AATGCTGCTGTGAATACTCAAGG - Intergenic
963083757 3:141418060-141418082 GATTCTGATGTGTTTAGTCCTGG - Intronic
964960743 3:162421568-162421590 AATTATGATGTGACTATTCCAGG - Intergenic
966483965 3:180446978-180447000 GATGCTGAAGTTACTTCTACTGG - Intergenic
966636036 3:182134920-182134942 CAAGCTGATGTAAATACTCCTGG + Intergenic
966927526 3:184655098-184655120 GATGCTGATGTTGCTGGTCCAGG + Intronic
967701328 3:192595645-192595667 GATGCTGATGTTGCTAGTGCAGG + Intronic
967778153 3:193406043-193406065 GATTCTGATGAGACTAGTTCAGG - Intronic
968701140 4:2058901-2058923 GACGCTGCCGTGACTGCTCCGGG + Intergenic
969380179 4:6790523-6790545 CATGCTCATGTTACCACTCCTGG + Intronic
969403315 4:6971664-6971686 GATGCTGATGTGACTACTCCGGG - Intronic
969952089 4:10848093-10848115 GATGCTGCTGCCACTAGTCCAGG - Intergenic
969973689 4:11074682-11074704 GATGCTGATGTTTCTGCTCCAGG - Intergenic
971748857 4:30620030-30620052 GACGCTGATGTGGCTGATCCTGG + Intergenic
973739131 4:53902137-53902159 GATGCTGATGTGCCTAGAACTGG - Intronic
974515209 4:62898606-62898628 GAGTCTGATGTGACCATTCCTGG + Intergenic
975358274 4:73433904-73433926 GATGTCGATGCGACTACACCAGG - Intronic
977525319 4:98138958-98138980 TTTACTAATGTGACTACTCCTGG - Intronic
978398158 4:108304403-108304425 GATGCTGATGAGGCTAGTCTGGG + Intergenic
978840079 4:113201384-113201406 GATGCTAATGCTACTAGTCCAGG + Intronic
979426142 4:120570380-120570402 GATACTGTTGTGGCTGCTCCAGG - Intergenic
979552519 4:122007136-122007158 GATGCTGATGCTATTGCTCCAGG - Intergenic
983701481 4:170600714-170600736 GATGCTGATGTTGCTGGTCCAGG - Intergenic
984957830 4:185063354-185063376 CATGCTGATGTGGCGGCTCCAGG - Intergenic
985320910 4:188709849-188709871 TATGCTGATGAGAATAATCCAGG + Intergenic
986136318 5:4982417-4982439 GATGCTGATGTCACTGGTCTGGG - Intergenic
986734887 5:10661318-10661340 GGTGCTGATGTTACTGGTCCGGG - Intergenic
990202225 5:53389181-53389203 GATGCTGATATGTCTACTCTTGG - Intergenic
990517482 5:56543865-56543887 GATGCTGATGTTACTGGTCCTGG - Intronic
993737743 5:91498107-91498129 GGTGCTGATGTGACTTGTCAGGG + Intergenic
997614284 5:135235934-135235956 GATGCTGATGTTGCTGGTCCAGG + Intronic
1001716583 5:173821306-173821328 GATGCTGCTGTTACTATTCTGGG + Intergenic
1003808142 6:9749719-9749741 GATGCTTCTGTGACTTTTCCAGG - Intronic
1003989190 6:11469083-11469105 GATGCTGATGTTGCTGCTTCTGG + Intergenic
1005630922 6:27707141-27707163 GATGCTGATGTTGCTGGTCCAGG - Intergenic
1007041787 6:38728739-38728761 GATGCTGATGCAACTGGTCCTGG - Intronic
1007311730 6:40952086-40952108 GATGCTGATGCTGCTAGTCCAGG - Intergenic
1008448319 6:51619394-51619416 GAGGCTGCTGTGCCTGCTCCTGG - Exonic
1010962792 6:82165732-82165754 GATGTTGATGTTGCTACTCTAGG + Intergenic
1011204266 6:84874629-84874651 GATGCTGATGCTACCAGTCCAGG + Intergenic
1013669453 6:112383366-112383388 GATGCTGATGTTACTGGTCTAGG - Intergenic
1015892206 6:137980197-137980219 TATGCTGATGGGACTGATCCAGG - Intergenic
1018882957 6:167903611-167903633 GATGCTGATGAGAACACTCCAGG - Intronic
1021244489 7:18245088-18245110 CATACTGATGTGACTTCTCCTGG + Intronic
1022672829 7:32472126-32472148 GATGATGATGTGAGTGTTCCTGG - Intergenic
1026188177 7:68100147-68100169 GATGCTGATGTTGATATTCCTGG + Intergenic
1026685776 7:72508944-72508966 GAAGCTGATCTCACTTCTCCAGG + Intergenic
1028873557 7:95795150-95795172 GATGCTGATCAGTCTACTTCCGG - Intronic
1030731005 7:112988902-112988924 GATGTTGATGTCACTGGTCCTGG + Intergenic
1030879418 7:114858697-114858719 GATGCTGATGGCACTAGTCCTGG - Intergenic
1042841726 8:73130891-73130913 GATGCTCATGGGTCTCCTCCAGG - Intergenic
1042870014 8:73389937-73389959 GCTGCTGATGTGGCTGTTCCCGG + Intergenic
1044763625 8:95548569-95548591 GATGCTGATGACACAACTACTGG + Intergenic
1046868709 8:119179894-119179916 GGTGCTGATGTTGCTAGTCCAGG + Intronic
1047659559 8:127018316-127018338 GATGCTGATGTCGCTTGTCCTGG - Intergenic
1048488435 8:134869840-134869862 GATGCTGATGCTGCTAGTCCGGG - Intergenic
1050250536 9:3739393-3739415 GATGCTGATGTTGCTGGTCCAGG - Intergenic
1050622381 9:7467813-7467835 GAAGCCGATGTGACTATTTCAGG + Intergenic
1053090350 9:35269634-35269656 AATGCTAATGTGATAACTCCTGG - Intronic
1053634926 9:39988208-39988230 TGAGCTGATTTGACTACTCCAGG + Intergenic
1053770999 9:41476101-41476123 TGAGCTGATTTGACTACTCCAGG - Intergenic
1053833235 9:42106791-42106813 GATCCTGCTGTGACCACTCGTGG - Intronic
1054208961 9:62262489-62262511 TGAGCTGATTTGACTACTCCAGG - Intergenic
1054315854 9:63585651-63585673 TGAGCTGATTTGACTACTCCAGG + Intergenic
1054549735 9:66387930-66387952 TGAGCTGATTTGACTACTCCAGG - Intergenic
1054597316 9:67080618-67080640 GATCCTGCTGTGACCACTCGTGG + Intergenic
1054967250 9:71043660-71043682 GATGCTGATGTTGCTAGTCCAGG - Intronic
1055483109 9:76729352-76729374 GATGCTGATGTGGCTGGTCTGGG + Intronic
1055870108 9:80866574-80866596 GAAGCTGATGGGACTACTAAAGG + Intergenic
1056157885 9:83857288-83857310 GATTCTGATGTGACGACACAAGG - Intronic
1058912537 9:109534193-109534215 GCTGCTGATGTGAAGCCTCCCGG + Intergenic
1060149275 9:121277404-121277426 GATGCTGATGTAGCTGGTCCAGG + Intronic
1061017508 9:127990509-127990531 AAGGATGATGTGATTACTCCAGG + Intergenic
1186839343 X:13469522-13469544 GATGCTGATGCTGCTAGTCCAGG + Intergenic
1186882446 X:13879885-13879907 GATGCTGATGTTGCTCGTCCAGG + Intronic
1186894520 X:13992604-13992626 GATGCTGATGTTACTGGTCTAGG + Intergenic
1186965970 X:14786312-14786334 GATGATGCTGTGAATAATCCGGG - Intergenic
1188612829 X:32120401-32120423 GATTCTGACGTGAGTACTACTGG + Intronic
1188613012 X:32122364-32122386 GATTCTGATGTGAGTATTACTGG + Intronic
1188887564 X:35569117-35569139 GGTGCTGATGTGGCTCCTTCAGG + Intergenic
1190464254 X:50709820-50709842 GATGCTGATGCTACTGGTCCAGG - Intronic
1192564118 X:72148783-72148805 GATGCTGCTGTTGCTGCTCCTGG - Intergenic
1194721522 X:97346172-97346194 GATGCTGATGTTGCTGGTCCAGG - Intronic
1195209333 X:102637179-102637201 CATGCTGATGAGAATATTCCAGG + Intergenic
1195682151 X:107555409-107555431 GATGCTGATGCTACCACTCCAGG - Intronic
1195943149 X:110181602-110181624 AATGCTGGTTTGACTACTACAGG - Intronic
1196154672 X:112415493-112415515 GATGCTGCTGTGAACACTGCAGG + Intergenic
1196719427 X:118839701-118839723 GAAGCTCATGCGACTGCTCCCGG - Intergenic
1197333152 X:125179676-125179698 GATGCTGATGCCACTGGTCCAGG - Intergenic
1197655627 X:129113199-129113221 GGTCCTGATGAGACTACTGCGGG - Intergenic
1197717401 X:129719386-129719408 GATGCTGATGTTGCTGGTCCAGG + Intergenic
1198786523 X:140294804-140294826 GATGCTGATGTTGCTAGTCATGG + Intergenic