ID: 969405664

View in Genome Browser
Species Human (GRCh38)
Location 4:6989803-6989825
Sequence CAGCTAAGGTTGAAGAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 733
Summary {0: 1, 1: 0, 2: 1, 3: 35, 4: 696}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969405664_969405673 17 Left 969405664 4:6989803-6989825 CCTTTTTTCTTCAACCTTAGCTG 0: 1
1: 0
2: 1
3: 35
4: 696
Right 969405673 4:6989843-6989865 CCACAAGTTGGCTGCTAGTGAGG 0: 1
1: 0
2: 1
3: 4
4: 83
969405664_969405668 5 Left 969405664 4:6989803-6989825 CCTTTTTTCTTCAACCTTAGCTG 0: 1
1: 0
2: 1
3: 35
4: 696
Right 969405668 4:6989831-6989853 TCAGACCACACCCCACAAGTTGG 0: 1
1: 0
2: 0
3: 5
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969405664 Original CRISPR CAGCTAAGGTTGAAGAAAAA AGG (reversed) Intronic
900695065 1:4004671-4004693 CAGCAAAGCCTGAAGAACAAGGG + Intergenic
904350023 1:29899064-29899086 CAGAGATGGTTGCAGAAAAATGG + Intergenic
904711400 1:32433182-32433204 CAGCTAAGGGTGAAGGACCAAGG - Intergenic
904711434 1:32433303-32433325 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
905499571 1:38426077-38426099 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
906302818 1:44696011-44696033 CAGCCTAGCCTGAAGAAAAAGGG + Intronic
907292428 1:53425313-53425335 CTGCTAAGGATGAAGGAGAAGGG - Intergenic
907839190 1:58140107-58140129 TGGCAAATGTTGAAGAAAAAAGG - Intronic
908365519 1:63419355-63419377 CAGCTAACCTTTAAGAAAAAAGG - Exonic
908592231 1:65646901-65646923 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
908819884 1:68074674-68074696 CTGGTAAGGTTGCAGAGAAAGGG - Intergenic
908929612 1:69303192-69303214 AAGCTAAAGTTGAAAAAAGAGGG + Intergenic
909222852 1:72984523-72984545 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
909223850 1:72992506-72992528 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
909703064 1:78549789-78549811 CTGGCAAGGGTGAAGAAAAAAGG + Intergenic
909788472 1:79643508-79643530 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
909978643 1:82072163-82072185 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
910094320 1:83503078-83503100 CAGCTAAGCATGAAGAAACTGGG + Intergenic
911108621 1:94159826-94159848 AAGGCAAGATTGAAGAAAAAAGG - Intronic
911314234 1:96337097-96337119 CTGGCAAGGTTGAAGAGAAAAGG + Intergenic
911526588 1:98995010-98995032 CTGGCAAGGTTGCAGAAAAAAGG + Intronic
911570141 1:99510380-99510402 CCGCTAAGGGTGAAGGACAAAGG - Intergenic
911790343 1:102007012-102007034 CTGGTGAGGTTGTAGAAAAAAGG + Intergenic
911980183 1:104557508-104557530 CAGCTCAGGAAGAAAAAAAAAGG + Intergenic
912928358 1:113932924-113932946 CAGCAAAGGCTGAAGGAAAACGG - Intronic
915358043 1:155268413-155268435 GAGCTGAGTTGGAAGAAAAAAGG + Intronic
915665116 1:157437469-157437491 CAGCCAGGGTTGGGGAAAAAAGG - Intergenic
915836268 1:159178371-159178393 TTGCTAAGGTTGAGGGAAAAGGG - Intronic
918521644 1:185421111-185421133 GAGATAAGGTAAAAGAAAAAAGG - Intergenic
919965002 1:202514026-202514048 CTGGCAAGGTTGCAGAAAAAAGG - Intronic
920384538 1:205560581-205560603 CTGGTAAGGATGCAGAAAAAAGG + Intergenic
920531791 1:206707453-206707475 CAGCAAAGGTAGAGAAAAAAGGG + Intronic
921212214 1:212910509-212910531 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
921459998 1:215414721-215414743 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
921519926 1:216146547-216146569 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
922048205 1:221966912-221966934 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
922048222 1:221966976-221966998 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
922049755 1:221977876-221977898 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
922154277 1:223029134-223029156 CTGCTAAGGGTGAAGGAGAATGG + Intergenic
922352039 1:224742281-224742303 TTGCTAAGGTGGAAGAATAATGG + Intergenic
922643485 1:227260765-227260787 CAGATAAGGGAGAAGAAGAATGG - Intronic
923075001 1:230602201-230602223 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
923408842 1:233688269-233688291 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
923408915 1:233688541-233688563 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
923675558 1:236077962-236077984 CTGGCAAGGTTGAAGAGAAAAGG + Intergenic
923770918 1:236936856-236936878 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
923867727 1:237957891-237957913 TAGCTAGGGTATAAGAAAAAAGG + Intergenic
923968369 1:239170264-239170286 CTGGTAAGGTTGCAGAAAAAGGG + Intergenic
924180421 1:241434847-241434869 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1064577848 10:16763854-16763876 CAGCTGAGGTTGCAGAACCAGGG - Intronic
1064665424 10:17645623-17645645 CATTTAAGGTGGAACAAAAAAGG - Intronic
1064887215 10:20123969-20123991 CTGCTAAGGGTGAAGAAGAAGGG + Intronic
1064887244 10:20124090-20124112 CCGCTAAGGATGAAGGACAAAGG + Intronic
1065443404 10:25773917-25773939 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1065569005 10:27048965-27048987 CATTAAAGGTTGAAGAAGAAAGG - Exonic
1065965035 10:30763904-30763926 AAGAAAAGGTTGCAGAAAAATGG + Intergenic
1065980381 10:30889009-30889031 CTGACAAGGTTGAAGAGAAAAGG - Intronic
1067639204 10:48030496-48030518 CAGCCAGGGCTGCAGAAAAATGG - Intergenic
1068402579 10:56549325-56549347 CTGGTAAGGTTGCAGAGAAAGGG - Intergenic
1068573634 10:58659100-58659122 CTGGTAAGGTTGTTGAAAAAAGG + Intronic
1069059228 10:63876415-63876437 CTGCTGAGGTTGCAGAGAAAAGG - Intergenic
1069202442 10:65637663-65637685 CTGGTGAGGATGAAGAAAAAGGG + Intergenic
1070474732 10:76819588-76819610 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1070485787 10:76929786-76929808 CAGCTAAGGTTGAAAAACAGTGG + Intronic
1071701436 10:87941982-87942004 CAACTAAGGTTAAAAATAAATGG + Intronic
1071916009 10:90296023-90296045 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1071960907 10:90808398-90808420 CCGCTAAGGATGAAGGAGAAGGG - Intronic
1072011525 10:91306409-91306431 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1072031121 10:91523542-91523564 GAGCTAAGGTTGAACAAATTGGG - Intergenic
1074740565 10:116481637-116481659 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1074872018 10:117584411-117584433 CAGCTAAGCCTGAAGTCAAAAGG - Intergenic
1075248504 10:120845891-120845913 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1075464083 10:122638361-122638383 CAGCCAAGTTAGAAGAAACAGGG - Intronic
1075524871 10:123175577-123175599 CAGGGAAGGCTGAAGAAACATGG + Intergenic
1075542654 10:123328461-123328483 CTTCTAAGGTTGTAGAAGAAAGG + Intergenic
1077611963 11:3648864-3648886 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
1078969642 11:16393031-16393053 CAGTTATGGTTGACTAAAAATGG - Intronic
1079594277 11:22222928-22222950 CAGCTAAGCTTGAAGACAGGAGG - Intronic
1079672755 11:23188589-23188611 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1079727296 11:23891950-23891972 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1079958354 11:26891695-26891717 CTGCCAAGGTTGCAGAGAAAAGG + Intergenic
1080028144 11:27633914-27633936 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1080115715 11:28619409-28619431 CAGCAAACGTTACAGAAAAAAGG + Intergenic
1080410761 11:32022853-32022875 CAGGTAACATTCAAGAAAAAAGG + Intronic
1081356613 11:42121593-42121615 CTGCTGAGGTTGAAGGAGAAGGG - Intergenic
1082184257 11:49160786-49160808 CAGCTAAGGCAGAATTAAAAGGG - Intronic
1082984615 11:59157781-59157803 CAGCTGAGGTTGAGGCAGAAGGG - Intergenic
1083974828 11:66109565-66109587 CAGGTGAAGATGAAGAAAAAGGG - Intronic
1084232089 11:67760638-67760660 CCACTAAGGGTGAAGGAAAAGGG - Intergenic
1084613482 11:70219059-70219081 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1084613509 11:70219180-70219202 CTGCTAAGAGTGAAGAAGAAGGG + Intergenic
1084826885 11:71738422-71738444 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1085987799 11:81807119-81807141 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1086022101 11:82242576-82242598 CTGGTGAGGTTGAAGAGAAAAGG - Intergenic
1086682089 11:89684593-89684615 CAGCTAAGGCAGAATTAAAAGGG + Intergenic
1087112904 11:94490513-94490535 CAGATAACGTAGAAGAAAACTGG - Intronic
1087127598 11:94642548-94642570 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1087314410 11:96588632-96588654 CCGCTAAGGGTGAAGGAGAAAGG - Intergenic
1087314426 11:96588696-96588718 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1089026479 11:115275507-115275529 CATATAAGATTGAAGATAAAAGG + Intronic
1089472289 11:118730875-118730897 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1089740973 11:120582991-120583013 CTGCTGAGGTTGCAGAGAAAAGG - Intronic
1089987226 11:122825565-122825587 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1090396509 11:126422894-126422916 CAGGGAAGGTTGGAGAAGAAAGG + Intronic
1090546710 11:127773920-127773942 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1090657658 11:128858233-128858255 CAGCTAAGAATGAAGAGACAAGG + Intronic
1090693130 11:129206633-129206655 CATATATGGTTGAAGAAAACAGG + Intronic
1090723765 11:129502755-129502777 CAGCTAAAGTAGTAGATAAAGGG + Intergenic
1090927177 11:131259293-131259315 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1090952836 11:131488543-131488565 CAGCCCAGATTCAAGAAAAAGGG + Intronic
1091112411 11:132982157-132982179 CAGCAAAGGCAGAAGAAAATGGG - Intronic
1091886310 12:4019538-4019560 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1092592920 12:9967650-9967672 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
1092626947 12:10337624-10337646 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1092723935 12:11466991-11467013 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
1092789503 12:12059331-12059353 CCGCTAAGGGTGAAGGATAAGGG - Intronic
1093095780 12:14970621-14970643 CAGCTAGGGTGGGAGAAAGAAGG + Intergenic
1093950888 12:25164229-25164251 CTGCTAAGGGTGAAGGAGAAGGG - Intronic
1094316263 12:29139725-29139747 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1094566911 12:31607126-31607148 CAGCAAAGGCAGAAGAAAATTGG - Intergenic
1095271896 12:40228218-40228240 CTGGTAAGGATGCAGAAAAAGGG - Intronic
1095848934 12:46779054-46779076 CACCTTAGTTTGAAGAAATAAGG - Intronic
1096133221 12:49177425-49177447 CAGCTAGGGTTTAAGGAAAGGGG + Intergenic
1096679408 12:53245239-53245261 CAGCTAATGTGGAAGGAATACGG + Intergenic
1097398379 12:59102816-59102838 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1098173830 12:67771326-67771348 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1098654013 12:73006627-73006649 CTGCTAAGGTTGAAGGAGAAGGG + Intergenic
1098872237 12:75829372-75829394 CTGGTAAGGTTGCAGAGAAAAGG - Intergenic
1099188473 12:79540720-79540742 CTGCTAAGGGTGAAGGACAAAGG - Intergenic
1099188503 12:79540845-79540867 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1099332642 12:81309712-81309734 CAGAGAAGCTTGAAGATAAACGG - Intronic
1099666207 12:85632484-85632506 AATCTAAGGTTGAAGGCAAAAGG - Intergenic
1100208746 12:92379388-92379410 AAGATATGGTTGAAGAAATACGG + Intergenic
1101391738 12:104307164-104307186 CTGCTTACCTTGAAGAAAAAAGG + Intronic
1101889824 12:108703216-108703238 AAGCTAATGTAGAAGAAAAAAGG + Intronic
1102083963 12:110120977-110120999 CATCTAAGGAGGAAAAAAAAAGG + Intergenic
1102637073 12:114333920-114333942 CAGCTAGGGTTGAATAAACTAGG - Intergenic
1104334249 12:127878545-127878567 CAGCTCATGTTAAAGGAAAAGGG + Intergenic
1104594133 12:130108726-130108748 CAGCTCATGTTCAAGAGAAAGGG - Intergenic
1105336610 13:19476721-19476743 CAGGCAAGGTTGCAGAGAAAAGG + Intronic
1105565132 13:21538077-21538099 TAGCTAAGGGTAGAGAAAAAAGG - Intronic
1105834763 13:24199855-24199877 CAGCTAAGGTTTTAAAAAATTGG - Intronic
1106069509 13:26394931-26394953 AAGATAAGGATGGAGAAAAAAGG + Intronic
1106271529 13:28158992-28159014 CAGGTGAGGTTGCAGAGAAAAGG + Intronic
1107220522 13:37973979-37974001 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1107220555 13:37974104-37974126 CCGCTAAGGGTGAAGGACAAAGG + Intergenic
1107226255 13:38051267-38051289 CAGCTAAGGTTGTGGAGAAAAGG + Intergenic
1107367209 13:39694929-39694951 TAGTTAAGCTTGGAGAAAAAAGG - Intronic
1107683343 13:42872123-42872145 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1107793008 13:44021524-44021546 GAGCTACGGTTCAAGAAGAAGGG + Intergenic
1108301700 13:49083752-49083774 CAGCTATGGCTGTATAAAAATGG + Intronic
1108808523 13:54189799-54189821 CAGCTGAGGCTGACGAAGAATGG - Intergenic
1108913643 13:55583069-55583091 CCACTAAGGTTGAAGGAGAAGGG + Intergenic
1108947239 13:56041310-56041332 CAGCTAAGAGTGAAGGAGAAGGG - Intergenic
1108953168 13:56117240-56117262 CCGCTAAGGGTGAAGGAGAAAGG + Intergenic
1109499077 13:63214071-63214093 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1109673410 13:65639527-65639549 TTCCTAAGGTTAAAGAAAAATGG - Intergenic
1109709858 13:66146024-66146046 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1109716989 13:66231257-66231279 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1110645464 13:77878364-77878386 CACCTAAGGTTGATGTCAAATGG - Intergenic
1110650734 13:77938464-77938486 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1110765248 13:79275041-79275063 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1110845085 13:80184392-80184414 CAGCTAAGGGTGAAGGACCAAGG - Intergenic
1110978254 13:81867059-81867081 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1111301795 13:86359174-86359196 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1111344770 13:86936672-86936694 CAGGGAAGGGTGAAGAAGAATGG + Intergenic
1111362318 13:87191122-87191144 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1111459093 13:88517713-88517735 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1112294316 13:98173304-98173326 CACCTAAAATTGAAGAAAACAGG - Intronic
1112802774 13:103131155-103131177 TAGCAAAGGTTGAAGAAACCTGG - Intergenic
1112889541 13:104212857-104212879 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1113244585 13:108380227-108380249 CTGGCAAGGTTGCAGAAAAAGGG - Intergenic
1113453527 13:110430779-110430801 CTGTTAAGGTTGAAGAATAAGGG + Intronic
1114363509 14:22002342-22002364 GAGCTAAGGTTCTAGGAAAAGGG + Intergenic
1114969429 14:28006584-28006606 CACCTTAGGGAGAAGAAAAATGG + Intergenic
1114972543 14:28051226-28051248 CAGGTAAGGCTGCAGATAAAAGG - Intergenic
1115143245 14:30198037-30198059 CAGTTATGGTGGAAGACAAAAGG - Intergenic
1115168025 14:30471467-30471489 CAGCAAAGCAGGAAGAAAAATGG + Intergenic
1115206224 14:30908488-30908510 CAGCTAAGACTGAAGAATGAAGG - Intronic
1115240790 14:31249975-31249997 CTGCTAAGGATGAAGGAGAAGGG + Intergenic
1115649566 14:35393327-35393349 CAGCTATGGGTGAATAATAATGG - Intergenic
1115904543 14:38191516-38191538 CCGCTAAGGGTGAAGGACAAAGG - Intergenic
1115915367 14:38306644-38306666 CTGGCAAGGTTGAAGAGAAAAGG + Intergenic
1116534986 14:46017124-46017146 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1116544019 14:46140208-46140230 CACCTAAAGATGAATAAAAAAGG - Intergenic
1116573274 14:46545031-46545053 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1116786982 14:49298320-49298342 CAGCTATGGTTGAAGTCAAATGG - Intergenic
1116952724 14:50894232-50894254 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
1117244338 14:53869114-53869136 CTGGTAAGGCTGAAGAGAAAAGG + Intergenic
1117355515 14:54920128-54920150 CATCTAAGGAAGAATAAAAAAGG + Intergenic
1117958124 14:61138176-61138198 CCGCTAAGGGTGAAGGAAAAGGG + Intergenic
1118072352 14:62258893-62258915 TAGCTAAGTTTAAAGTAAAAAGG - Intergenic
1118971815 14:70643257-70643279 CTGCTAGGGGTGAAGGAAAAGGG + Intronic
1119129835 14:72161679-72161701 TTGCTAAGGTTGTAGAAAGAGGG - Intronic
1119221112 14:72908168-72908190 CAGCTAATGTAGAAGAATGAGGG + Intergenic
1120468870 14:84897268-84897290 AAGCTAAGGATGAGGAAAATGGG - Intergenic
1121760437 14:96440412-96440434 GAGCAGAGGGTGAAGAAAAAAGG - Intronic
1122040786 14:98986181-98986203 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1124621105 15:31274534-31274556 CAGCTGATGTTGAGGAAACATGG + Intergenic
1125045528 15:35239619-35239641 CCGCTAAGGTTGAAGGAGAAGGG - Intronic
1125045564 15:35239747-35239769 CTGCTAAGGGTGAAGGAGAAGGG - Intronic
1125131754 15:36290548-36290570 CTGCTAAGGGTGAAGTAGAAGGG + Intergenic
1125895628 15:43299490-43299512 CAGCTAGGGTGGATGAAAAATGG + Intronic
1126123353 15:45272997-45273019 CAGCAAAGGAAGAAGAAAAATGG + Intronic
1126530370 15:49703894-49703916 CCGCTAAGGTTGAAGGACCAAGG + Intergenic
1126988319 15:54340962-54340984 CTGGTAAGGCTGCAGAAAAAAGG + Intronic
1127762631 15:62153956-62153978 GGGTTAAGGTAGAAGAAAAATGG + Intergenic
1130567390 15:85008384-85008406 TAGCTAAGGTTCAAGGAGAAAGG - Intronic
1130888965 15:88117022-88117044 CAGCTAAGGTTGAGGAACAATGG - Intronic
1131127951 15:89871683-89871705 CAGCTAATGCTGGAGACAAAAGG - Intronic
1131447486 15:92512321-92512343 CCGCTAAGGGTGAAGGAGAAAGG - Intergenic
1131588615 15:93722856-93722878 CTGCTCAGTTTAAAGAAAAAAGG - Intergenic
1131882734 15:96876645-96876667 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1131882753 15:96876709-96876731 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1132354342 15:101160021-101160043 CAGCTTAGGTGGAAAAAAAGAGG + Intergenic
1133165589 16:3944686-3944708 AAGATAATGTTGAAGAAAATTGG - Intergenic
1133706152 16:8356870-8356892 CAAGTAAGGTTGCAGAGAAAAGG + Intergenic
1133766911 16:8844457-8844479 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
1133869825 16:9676242-9676264 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
1133946138 16:10350141-10350163 CAGTTATGGTGGAAGAAGAAGGG - Intronic
1135514538 16:23119403-23119425 CAGCTGAGGTTGAACAATAGTGG - Intronic
1137690628 16:50424665-50424687 CCTCTCAGGTTAAAGAAAAAAGG - Intergenic
1137725446 16:50653658-50653680 CAGCTAAGGAGGAAGAGGAAGGG + Intergenic
1137939952 16:52674400-52674422 TAGCTATGGCTGAAGACAAATGG - Intergenic
1139039420 16:62983782-62983804 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1139039457 16:62983905-62983927 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1139039494 16:62984030-62984052 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1139039530 16:62984155-62984177 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1139039630 16:62984524-62984546 CCACTAAGGGTGAAGGAAAAGGG + Intergenic
1139476271 16:67204061-67204083 CAGCTAAGTTTGAAGGCAGAAGG - Intergenic
1139943246 16:70621171-70621193 CCGCTAAGGTTGAAGGACCAAGG + Intronic
1140226983 16:73086219-73086241 CTGGTAAAGTTGCAGAAAAAGGG + Intergenic
1140324484 16:73988391-73988413 CTGGTAAGGTTGCAGAGAAAAGG + Intergenic
1140995566 16:80255903-80255925 CATCTAAGGGTGAAAATAAATGG + Intergenic
1141016059 16:80450698-80450720 CAGCACAGGTAGAAGAAAATAGG + Intergenic
1141865410 16:86746687-86746709 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1142038259 16:87875986-87876008 CATTTATGGTTGGAGAAAAAGGG + Intergenic
1142435451 16:90053884-90053906 CAATTAAGGTAGAAGACAAAGGG - Intergenic
1143817342 17:9527736-9527758 CAGCTAAGGTTTAAGGAAAGGGG + Intronic
1144104419 17:11972742-11972764 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1146597664 17:34184168-34184190 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1149998926 17:61420023-61420045 CAACTCAAGCTGAAGAAAAAGGG + Intergenic
1151622284 17:75253598-75253620 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
1151839945 17:76610566-76610588 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1152203380 17:78960108-78960130 CATCAAAGCTTGAAGAGAAAGGG - Intergenic
1152263540 17:79280069-79280091 CAGCTAGGGTTGTAGACAGAAGG + Intronic
1152872965 17:82768046-82768068 CACCTAAGAATAAAGAAAAAAGG - Intronic
1153591000 18:6674160-6674182 CAGCTAAGTTTTCAGAAAGACGG - Intergenic
1153994934 18:10432529-10432551 AAGATAAGGTGGAAGAATAAAGG - Intergenic
1155335471 18:24760247-24760269 CTGGTAAGGTTGTAGAGAAAAGG + Intergenic
1155624959 18:27824174-27824196 CTGGCAAGGTTGAAGAGAAAAGG + Intergenic
1155697250 18:28697932-28697954 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1155841679 18:30652643-30652665 CAGCTATGCTTCAAGATAAAGGG + Intergenic
1156451698 18:37270122-37270144 CGGCTAAGTTTGAGGAAAAAAGG + Intronic
1156500898 18:37557462-37557484 CAGCTAAGAGGGAAGAAAATGGG + Intronic
1156635620 18:39025575-39025597 GAGCTAAGGAAGTAGAAAAATGG - Intergenic
1157883928 18:51348019-51348041 CAGCTAAAGTTGTAGACAATAGG - Intergenic
1157884492 18:51353307-51353329 CAGCCCAGATTCAAGAAAAAGGG + Intergenic
1157938572 18:51900242-51900264 AAGCTAATATTGAAGATAAAAGG - Intergenic
1158273024 18:55737119-55737141 CAGGTAATGTGGAAGAAATAAGG + Intergenic
1158323622 18:56291012-56291034 AAGCCAATTTTGAAGAAAAATGG + Intergenic
1158336157 18:56416503-56416525 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1158336174 18:56416567-56416589 CCGCTAAGGGTGAAGGAGAAAGG - Intergenic
1158432222 18:57399696-57399718 CAGCTGATGTAGGAGAAAAAAGG + Intergenic
1159150282 18:64514457-64514479 CAGCTTAGGTAGAAGACATATGG - Intergenic
1159746510 18:72242862-72242884 CTCCTCAGGGTGAAGAAAAATGG + Intergenic
1159834845 18:73325654-73325676 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1161931161 19:7341293-7341315 CAGCTAAGGCTGGAAGAAAAAGG + Intergenic
1163900499 19:20095755-20095777 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
1163906823 19:20155521-20155543 CCGCTAAGGGTGAAGGAGAAAGG - Intergenic
1165510495 19:36264096-36264118 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1166499152 19:43328263-43328285 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1167140247 19:47645519-47645541 AAGAAAAGGTTAAAGAAAAATGG + Intronic
1167530392 19:50012271-50012293 GAGCTAGGGATGAAGAAGAATGG - Intronic
1167901942 19:52628745-52628767 CTGCTAAGGGTGAAGGAGAAGGG - Intronic
925325439 2:3017690-3017712 CTGGTAAGGATGAAGAGAAAAGG + Intergenic
926413372 2:12627388-12627410 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
926464287 2:13168684-13168706 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
926815752 2:16796645-16796667 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
928770806 2:34700502-34700524 CTGCTAAGGTTGAAGGACCAAGG + Intergenic
928779907 2:34805741-34805763 CCGCTAAGGATGAAGGAGAAGGG + Intergenic
928779934 2:34805860-34805882 CTGCTAAGGGTGAAGAACGAAGG + Intergenic
928928359 2:36600083-36600105 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
929764604 2:44833578-44833600 AAGCCAAGGTTGAGGAAAAATGG + Intergenic
930155345 2:48101640-48101662 CACCTAATGTTTAAGGAAAAAGG + Intergenic
930735432 2:54773949-54773971 CAGCAAAGGAACAAGAAAAAAGG - Intronic
930954911 2:57194055-57194077 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
931026582 2:58118056-58118078 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
931236656 2:60418328-60418350 CTGCTGAGGTTGAAGGAGAAGGG - Intergenic
931461416 2:62453464-62453486 CAACTGAGGGTGAAGGAAAAAGG - Intergenic
931850206 2:66244892-66244914 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
931850224 2:66244956-66244978 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
931897873 2:66753432-66753454 CACTTAAGGAGGAAGAAAAAAGG - Intergenic
932359044 2:71089852-71089874 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
932974174 2:76578664-76578686 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
933079072 2:77966129-77966151 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
933163533 2:79052341-79052363 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
933248352 2:80000827-80000849 AGGCTGAGGTTGAAGAGAAAAGG + Intronic
933332597 2:80913401-80913423 CAGTAAAGTTTGAAGAAACATGG + Intergenic
933506953 2:83189056-83189078 CATCTAGGGTTGAGGAATAATGG + Intergenic
933892157 2:86781902-86781924 CAGCTAAGGGGGAACAGAAAAGG + Intergenic
934592926 2:95574013-95574035 GAGCTCAGACTGAAGAAAAAGGG - Intergenic
935921091 2:108016073-108016095 ATGATAAGGATGAAGAAAAAGGG + Intergenic
936175768 2:110218889-110218911 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
936938754 2:117861534-117861556 CATTTAATGTAGAAGAAAAAAGG - Intergenic
937040179 2:118814776-118814798 AAGCCAAGGATGAAGAAATATGG - Intergenic
938175116 2:129118624-129118646 CAGCTATGTAGGAAGAAAAAAGG - Intergenic
940047523 2:149425062-149425084 CAGCTTATCTGGAAGAAAAAAGG - Intronic
940117810 2:150228502-150228524 AAACTAAGGTTGAAAATAAATGG - Intergenic
940450631 2:153831657-153831679 CTGCTAAGGCTGAGGAAACAGGG - Intergenic
941353189 2:164460138-164460160 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
942096886 2:172542753-172542775 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
942241898 2:173970557-173970579 TAGCTATGTTTGAAGACAAATGG - Intergenic
942288967 2:174450628-174450650 GAGCTAAGGTAGAAAAACAAAGG - Intronic
942793131 2:179783828-179783850 CTGATGAGGTTGCAGAAAAAAGG + Intronic
943391446 2:187274242-187274264 CTGGCAAGGTTGAAGAGAAAAGG - Intergenic
943421797 2:187675244-187675266 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
943560983 2:189461765-189461787 CAGTTAACGTTGAATCAAAATGG + Intronic
943638941 2:190338356-190338378 CAGCTAGGCCTGAAGAAATAAGG + Intronic
943834946 2:192507033-192507055 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
944118358 2:196212829-196212851 CTGGTAAGGTTGCAGAGAAAAGG - Intronic
944387239 2:199180368-199180390 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
944389426 2:199202008-199202030 CAGCTATTGTTAAAAAAAAAAGG - Intergenic
944546173 2:200801206-200801228 CTGGCAAGGTTGCAGAAAAAAGG + Intergenic
945153321 2:206811615-206811637 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
945301689 2:208220965-208220987 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
945556318 2:211280775-211280797 GAGCTGAGGTTGAAAAAAAAGGG - Intergenic
945754821 2:213832737-213832759 AAGCTTAGGTTGATGAAGAATGG - Intronic
945766609 2:213988017-213988039 CAGCTGAAGTGGGAGAAAAAAGG + Intronic
945938091 2:215923308-215923330 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
946215244 2:218178753-218178775 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
946215275 2:218178878-218178900 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
946781238 2:223194538-223194560 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
946893053 2:224297596-224297618 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
947649113 2:231769399-231769421 CTGCTAAAGATTAAGAAAAAGGG - Intronic
948480480 2:238247154-238247176 CAGCCAAGGTTTAAGGAGAAAGG - Intronic
948624337 2:239259765-239259787 CTGACAATGTTGAAGAAAAAAGG + Intronic
948712757 2:239835271-239835293 CAGCTCAGGTTCAAGTGAAAGGG + Intergenic
1169531715 20:6492001-6492023 CAGCTAGGGTTAAAACAAAAAGG - Intergenic
1169828736 20:9798601-9798623 CAGGTAAGTTTGAAGAGGAAAGG + Intronic
1169972167 20:11279777-11279799 CAGCCCAGATTGAAGAAAAGAGG + Intergenic
1170165696 20:13359006-13359028 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1170820895 20:19755774-19755796 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1171260989 20:23734552-23734574 CAGCTAAGGCTGATGCAAATGGG + Intergenic
1173101636 20:40093963-40093985 CCGCTAAGGGTGAAGGACAAAGG - Intergenic
1173101666 20:40094088-40094110 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1173781431 20:45760305-45760327 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
1174910335 20:54601127-54601149 CAGCTAAGACTGCAGAGAAAGGG + Intronic
1177100423 21:16893170-16893192 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1177429875 21:20978184-20978206 CTGGCAAGGATGAAGAAAAAAGG - Intergenic
1177527443 21:22312949-22312971 CAGTCAAGGTGGAAGACAAATGG + Intergenic
1179669294 21:42934584-42934606 CAGCTAAGACAGAAGAAAGATGG + Intergenic
1180116713 21:45711619-45711641 TCTCTAAGGTTGAAGGAAAAAGG - Intronic
1181899037 22:26137278-26137300 CACCTAAGGATAAGGAAAAAGGG + Intergenic
1182113745 22:27742995-27743017 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1182553314 22:31114162-31114184 AAGTTAAGGTTAAAAAAAAAAGG - Intronic
1183193852 22:36339700-36339722 CTGCAAAGTTTAAAGAAAAAAGG + Intronic
949743176 3:7259925-7259947 CTGGTAAGGTTGCAGAGAAAAGG - Intronic
952172833 3:30827942-30827964 CAGCTAATGTAGCAGAAAAAGGG - Intronic
952560547 3:34587739-34587761 CAGGTGAGGTTGTAGAGAAAAGG - Intergenic
952896731 3:38082622-38082644 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
953176963 3:40561849-40561871 CTGCTAAGGGTGAAGGAGAAGGG - Intronic
954201781 3:49027652-49027674 CAGCCCAGGTTGAAGACAAGGGG - Intronic
954857200 3:53654885-53654907 CAGGCAAGGAAGAAGAAAAAAGG + Intronic
954969465 3:54639185-54639207 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
954969483 3:54639249-54639271 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
956043078 3:65167192-65167214 CAGCCAAACTTCAAGAAAAAAGG - Intergenic
956549159 3:70439485-70439507 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
956624112 3:71249820-71249842 CTGCTGAGGCTGAAGAAATAGGG - Intronic
957060107 3:75474814-75474836 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
957294995 3:78324651-78324673 CAGCTAAGAGTGAAGGAGAAGGG - Intergenic
957317527 3:78587901-78587923 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
957490173 3:80915556-80915578 TAGCTAAGGTGGAAGGCAAATGG + Intergenic
957665931 3:83226937-83226959 ATGCTTAGGTTGAAGAAAATTGG - Intergenic
958072565 3:88633387-88633409 CAACTATGGTGGAAGACAAAGGG + Intergenic
958580137 3:96007649-96007671 CAGCTAAGGTGGTAGCAGAAGGG - Intergenic
958940269 3:100304438-100304460 CAGCTAATTATGAAGAAATAAGG - Intronic
959288573 3:104444776-104444798 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
959972476 3:112422334-112422356 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
960310343 3:116110099-116110121 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
960356449 3:116659517-116659539 CTGCTAATGTAGAAGAAAACTGG - Intronic
960527982 3:118732173-118732195 CATCTATGGTGGAACAAAAAAGG + Intergenic
961208339 3:125105565-125105587 CAGCAAAAGTTGAGCAAAAAAGG + Intronic
961221689 3:125206025-125206047 CAGCTGAGGAGGAAGGAAAAGGG - Intronic
961293278 3:125864592-125864614 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
961411718 3:126727058-126727080 CAGCTAAGGAAGCAGAAAAGAGG - Exonic
961730405 3:128960870-128960892 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
961837440 3:129674777-129674799 CAGCAAAGGCTGTTGAAAAAGGG - Intronic
962073940 3:132060691-132060713 CTGCTGAGGTTGTGGAAAAAAGG - Intronic
962567555 3:136678223-136678245 CAGCTAATGCTAAAAAAAAAAGG + Intronic
963381952 3:144541630-144541652 CTGGTAAGGTTGCAGAGAAAAGG + Intergenic
963684098 3:148415241-148415263 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
963895730 3:150683435-150683457 CAGCTAGGGGTGAAGCAAGATGG + Intronic
964000421 3:151764639-151764661 CTGGTGAGGTTGCAGAAAAAAGG + Intergenic
964906737 3:161726674-161726696 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
964983456 3:162713458-162713480 CAACTAAGGGTGAAGGAGAAGGG - Intergenic
965087850 3:164122547-164122569 CTGGTAAGGTTGTAGAATAAAGG + Intergenic
965105432 3:164346862-164346884 CCGCTAAGGATGAAGGAGAAGGG + Intergenic
965144379 3:164881275-164881297 AAGCACAGTTTGAAGAAAAATGG + Intergenic
965286921 3:166828718-166828740 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
965336125 3:167432183-167432205 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
965713142 3:171577208-171577230 CCGCTAAGGGTGAAGGAACAAGG - Intergenic
965713174 3:171577333-171577355 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
966066590 3:175828488-175828510 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
966085230 3:176062306-176062328 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
966105274 3:176326270-176326292 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
966105292 3:176326334-176326356 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
966152807 3:176883359-176883381 CTGGCAAGGTTGCAGAAAAAAGG + Intergenic
966233028 3:177670458-177670480 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
966279013 3:178208260-178208282 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
966541150 3:181091085-181091107 CTGGTGAGGTTGTAGAAAAAAGG - Intergenic
967496025 3:190145541-190145563 CTGCTAAGAGTGAAGAAGAAGGG - Intergenic
967561196 3:190921167-190921189 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
967624889 3:191671348-191671370 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
967644036 3:191900126-191900148 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
967658331 3:192075881-192075903 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
967740275 3:192996614-192996636 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
967819442 3:193827245-193827267 CAGTTTAGTTTGAAGAGAAAAGG - Intergenic
969405664 4:6989803-6989825 CAGCTAAGGTTGAAGAAAAAAGG - Intronic
969809907 4:9639826-9639848 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
970041902 4:11807302-11807324 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
970087361 4:12364759-12364781 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
970256634 4:14175273-14175295 CCTCTAAGGGTGAAGAAGAAGGG + Intergenic
970285007 4:14502295-14502317 CTGATGAGGTTGCAGAAAAAAGG - Intergenic
970986244 4:22162132-22162154 CTGGCAAGGTTGAAGAGAAAAGG + Intergenic
971123389 4:23726725-23726747 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
971123422 4:23726850-23726872 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
971180358 4:24324274-24324296 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
972030718 4:34454345-34454367 CTGATAAGGTTGCAGATAAAAGG + Intergenic
972036795 4:34533434-34533456 AAGCTTAGGTTGAAAGAAAAAGG + Intergenic
973872791 4:55183185-55183207 GAACAAAGGTTAAAGAAAAAAGG - Intergenic
974241575 4:59255467-59255489 CAGATAAAGTTGAAAAAAAGAGG - Intergenic
974249022 4:59360808-59360830 CAATTATGGTGGAAGAAAAATGG - Intergenic
974428607 4:61769024-61769046 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
974492233 4:62581305-62581327 AAGCTAAAATTAAAGAAAAATGG - Intergenic
975934113 4:79558754-79558776 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
976696321 4:87922797-87922819 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
976699337 4:87952131-87952153 CAGGTGAGGGTGCAGAAAAAGGG + Intergenic
977013175 4:91659549-91659571 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
977041829 4:92026920-92026942 CCGCTAAGGATGAAGGAGAAGGG - Intergenic
977041847 4:92026984-92027006 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
977217317 4:94297758-94297780 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
977217352 4:94297886-94297908 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
977409322 4:96641337-96641359 CTGCTAAGGTTTGAGTAAAAAGG - Intergenic
977782689 4:100996622-100996644 CAGCTAAGGGTGAAGGATCAAGG + Intergenic
977791847 4:101113921-101113943 CAAGTAAAGTAGAAGAAAAAAGG - Intronic
978043447 4:104098135-104098157 CTGGTGAGGTTGAAGAGAAAGGG + Intergenic
979012055 4:115384613-115384635 CTGGTTAGGTTGCAGAAAAAAGG - Intergenic
979205775 4:118035569-118035591 AAGGTATGGATGAAGAAAAAGGG - Intronic
979895380 4:126149893-126149915 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
980112152 4:128645626-128645648 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
980284729 4:130768244-130768266 CTGCTAAGGTTGAAGAACCAAGG - Intergenic
980284754 4:130768369-130768391 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
980527677 4:134013178-134013200 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
980611964 4:135171984-135172006 CAGCTAAGGGTGAAGGAGAAGGG + Intergenic
980611982 4:135172048-135172070 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
980903705 4:138928780-138928802 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
981040068 4:140214647-140214669 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
981524939 4:145699890-145699912 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
981539482 4:145833567-145833589 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
981719043 4:147780395-147780417 CCGCTAAGGGTGAAACAAAATGG + Intronic
981773768 4:148340979-148341001 CTGGTAAGGATGAAGAGAAACGG + Intronic
981907563 4:149939676-149939698 CTGGTAAGGTTGTAGAGAAAAGG + Intergenic
982084152 4:151817255-151817277 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
982180668 4:152746001-152746023 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
982340476 4:154293075-154293097 CAGCCAAGGGTGAAGGAAGAGGG - Intronic
982497375 4:156108452-156108474 CCGCTAAGGGTGAAGGACAAAGG + Intergenic
982524140 4:156456365-156456387 CTGGTGAGGTTGAGGAAAAAAGG + Intergenic
982870321 4:160571518-160571540 CAACTAGGGTTGAAGTAAAATGG - Intergenic
983055294 4:163094179-163094201 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
983360172 4:166717128-166717150 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
983414914 4:167440512-167440534 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
983484055 4:168312862-168312884 CAAATAAGTTTAAAGAAAAATGG + Intronic
983707493 4:170678542-170678564 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
984099237 4:175466085-175466107 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
984393803 4:179169540-179169562 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
984438934 4:179740933-179740955 CAGCTGATGTTTAAGAATAAAGG + Intergenic
984700451 4:182815482-182815504 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
984702333 4:182826193-182826215 CGGCTAGGGTTGCAGATAAAAGG + Intergenic
986193325 5:5516530-5516552 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
986263430 5:6169309-6169331 CAGCAAAAGATAAAGAAAAAAGG + Intergenic
986388673 5:7264575-7264597 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
986714613 5:10513985-10514007 CAGCAAAGGATGCAGAGAAAAGG - Intronic
986905582 5:12490875-12490897 CTGCTAAGGATGAAGGAGAAGGG - Intergenic
987281822 5:16420932-16420954 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
989403261 5:41032211-41032233 CTGCTAAGGTTGTGGAGAAAAGG - Intronic
989782364 5:45283648-45283670 CAGGTGAGGTTGCAGAGAAAAGG + Intronic
990051434 5:51506478-51506500 CACCTAAGGGTGAACAAAATAGG - Intergenic
990303739 5:54474824-54474846 CAGGGGAGGTTGAAGAAAGATGG - Intergenic
991156654 5:63444407-63444429 CAGCTAATGTTAAAGAAAACTGG - Intergenic
991273218 5:64811134-64811156 CAGCCAAGGTTGATGAAAACTGG + Intronic
992394434 5:76358248-76358270 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
992960615 5:81954185-81954207 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
992966100 5:82002145-82002167 CTGGTGAGGTTGAAGAGAAAAGG + Intronic
993192482 5:84699358-84699380 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
993836447 5:92824731-92824753 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
993836475 5:92824856-92824878 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
994115950 5:96061485-96061507 CAGCTAACAGAGAAGAAAAAAGG + Intergenic
994532808 5:100989215-100989237 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
994768767 5:103955053-103955075 CAGCTAAGAGAGAACAAAAATGG + Intergenic
994924428 5:106096198-106096220 AAGCTAAACCTGAAGAAAAATGG - Intergenic
995847322 5:116508335-116508357 CAGCCAAGCATGAAGCAAAAGGG + Intronic
996036846 5:118767906-118767928 CAGCTCTGGATGAATAAAAATGG + Intergenic
996357065 5:122606911-122606933 TAACTGAGGTTGAATAAAAATGG + Intergenic
996527848 5:124498002-124498024 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
996745771 5:126844805-126844827 CCGCTAAGGGTGAAGGACAAAGG + Intergenic
996850494 5:127946278-127946300 CTGGTAAGGTTGCAGAGAAAAGG - Intergenic
997769904 5:136544447-136544469 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
998996589 5:147873559-147873581 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
999619069 5:153454402-153454424 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
999738144 5:154528121-154528143 AAGCTGATGTTGAAGAAAGAGGG + Intergenic
1000401037 5:160827295-160827317 CAGGCAAGGTTGAAGAGAAAAGG - Intronic
1000715541 5:164639344-164639366 CAGCAAAGGTTAAAAAAAACAGG - Intergenic
1001393760 5:171402361-171402383 CTGGCAAGGTTGCAGAAAAAAGG + Intronic
1001708920 5:173762377-173762399 CAGATAAGGTTGGAGAGAAGTGG + Intergenic
1003174803 6:3746577-3746599 GAGCTATGGTTGAAGGCAAAGGG + Intronic
1003291194 6:4779658-4779680 CTGCTAGGATTGAGGAAAAACGG + Intronic
1003430384 6:6032554-6032576 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1003430403 6:6032618-6032640 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1004106060 6:12668376-12668398 CTGCTAAGGGTGAAGAAGAAGGG - Intergenic
1004147564 6:13082466-13082488 CAGTTCAGGAAGAAGAAAAATGG + Intronic
1004283771 6:14301815-14301837 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1004358398 6:14949715-14949737 GAGCTCATGTAGAAGAAAAATGG + Intergenic
1004749371 6:18545369-18545391 CTGGTGAGGTTGCAGAAAAAAGG - Intergenic
1007122385 6:39393899-39393921 AAGCCAAGGAAGAAGAAAAAAGG + Intronic
1007126018 6:39426414-39426436 CAGCAAAGGGTGCAGGAAAAAGG + Intronic
1007271219 6:40638671-40638693 AAGGTAAGGATGAAGAAGAAAGG + Intergenic
1007877523 6:45122427-45122449 TACCTAAGGATTAAGAAAAAAGG + Intronic
1008155343 6:48007377-48007399 TTGCTAAGGTTGAAAAAGAAAGG + Intronic
1008850496 6:56015813-56015835 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1009343375 6:62586813-62586835 CCGCTAAGGGTGAAGAACCAAGG - Intergenic
1009343405 6:62586934-62586956 CTGCTAAGGGTGAAGTAGAAGGG - Intergenic
1010586936 6:77665371-77665393 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1010586955 6:77665435-77665457 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1010618985 6:78050607-78050629 AAGATAAGTTTAAAGAAAAAAGG + Intergenic
1010827120 6:80487128-80487150 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1011353423 6:86447892-86447914 CAGCTAAAATTAAAAAAAAAAGG - Intergenic
1012141098 6:95627907-95627929 CTGGTGAGGTTGAAGAGAAAAGG + Intergenic
1012523607 6:100150632-100150654 CAGCTAAGGTGGGAGAAGAGTGG + Intergenic
1012689345 6:102293785-102293807 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1012723017 6:102772085-102772107 CTGGTAAGGTTGCAGAGAAAGGG + Intergenic
1013843956 6:114427356-114427378 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1014360395 6:120467114-120467136 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1014614881 6:123587041-123587063 CTGCTCAGGGTGAAGGAAAAGGG + Intronic
1014718399 6:124891396-124891418 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1014906982 6:127042360-127042382 CTGGTGAGGTTGCAGAAAAAAGG + Intergenic
1015155328 6:130088580-130088602 CAGATGACATTGAAGAAAAATGG + Intronic
1015266536 6:131296474-131296496 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1015269436 6:131324304-131324326 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1015271163 6:131339871-131339893 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1015271181 6:131339935-131339957 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1015738639 6:136428936-136428958 CTGCTAAGATTGTAGAGAAAGGG - Intronic
1015827922 6:137335445-137335467 CATGTTAGGTTGAAGAAAGATGG - Intergenic
1016204302 6:141453654-141453676 CTGCTAAGGGTGAAGGACAAAGG - Intergenic
1016225897 6:141736900-141736922 TAGCTAAGGTAGAAAAGAAAAGG + Intergenic
1016248615 6:142016664-142016686 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1016650497 6:146455150-146455172 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1016651289 6:146463833-146463855 CAGCTAAGGTTGAGAAACTATGG + Intergenic
1017779534 6:157705390-157705412 CTGCTAAGGGTGAAGGAGAAGGG + Intronic
1018084719 6:160291336-160291358 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1018289318 6:162274668-162274690 CAATTAAATTTGAAGAAAAATGG + Intronic
1018495679 6:164343796-164343818 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1018521732 6:164657078-164657100 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1018810763 6:167296254-167296276 CAGCCAAGGTAAAAGGAAAAGGG + Exonic
1019654972 7:2187387-2187409 CAGCACAGTTAGAAGAAAAAAGG - Intronic
1019798531 7:3070548-3070570 CACCTTAGGTGGAAAAAAAAGGG - Intergenic
1020943689 7:14572987-14573009 GAGCCAAGATTGAATAAAAATGG + Intronic
1021188457 7:17592757-17592779 TAGCTAATGTTTAAGAAGAAAGG + Intergenic
1021605757 7:22407548-22407570 CAGCTATGGATGAGGAAGAAAGG + Intergenic
1021810451 7:24397254-24397276 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1021833645 7:24644780-24644802 CTGTTAAGGTTGCAGAGAAAAGG - Intronic
1021978056 7:26028729-26028751 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1021978075 7:26028793-26028815 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1022372686 7:29785947-29785969 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1022669771 7:32445071-32445093 CTGGTGAGGTTGAAGAGAAAAGG + Intergenic
1023085679 7:36568094-36568116 CATCTTAGGCTAAAGAAAAAGGG + Intronic
1023195756 7:37636940-37636962 CTGGTAAGGTTGCAGAGAAAAGG - Intergenic
1023462358 7:40412657-40412679 CAGGCAAGATTGATGAAAAATGG - Intronic
1023542821 7:41284430-41284452 CAAATAAGGTTGAAGAAACCGGG + Intergenic
1023699101 7:42875341-42875363 CCGCTAAGGCTGAAGGAGAAGGG + Intergenic
1023699117 7:42875405-42875427 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1024697367 7:51870827-51870849 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1024697386 7:51870891-51870913 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1025270234 7:57504925-57504947 CTGATAAGGTTGCAGATAAAAGG - Intergenic
1027955020 7:84866604-84866626 CAGAGAATCTTGAAGAAAAATGG - Intergenic
1028553598 7:92099115-92099137 CAGATAAGGGTGAAGGAAAGTGG - Intronic
1028689977 7:93640897-93640919 CTGCTAAGGGTGAAGGAGAAGGG - Intronic
1030751695 7:113238199-113238221 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1031004473 7:116456559-116456581 CCGCTAAGGGTGAAGGAGAAGGG - Intronic
1031035067 7:116780111-116780133 CAGCTAAGGGTTACAAAAAAAGG + Intronic
1031355421 7:120781914-120781936 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1031399817 7:121316724-121316746 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1031728136 7:125263611-125263633 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1032660775 7:133981607-133981629 CTGGTAAGGTTGTGGAAAAAAGG + Intronic
1032775101 7:135104562-135104584 CCGGCAAGGTTGCAGAAAAAAGG - Intronic
1033676167 7:143541939-143541961 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1033695666 7:143787500-143787522 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1033925199 7:146450651-146450673 CAGCCTAGGTTTAAGAGAAAAGG + Intronic
1035924549 8:3713223-3713245 CAGCTGATGTAGGAGAAAAAAGG - Intronic
1036071122 8:5441324-5441346 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1036109813 8:5885803-5885825 CAACTAATGTGGAAAAAAAATGG - Intergenic
1036153362 8:6319531-6319553 TAGCTCAGGTTTAAGATAAAGGG + Intergenic
1036281251 8:7403286-7403308 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1036340215 8:7908286-7908308 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1036371910 8:8169508-8169530 CTGCTAAGGGTGAAGGAACAAGG - Intergenic
1036371925 8:8169572-8169594 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1036472561 8:9064215-9064237 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
1036878979 8:12496071-12496093 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1036878994 8:12496135-12496157 CTGCTAAGGGTGAAGGAACAAGG + Intergenic
1036973952 8:13388325-13388347 CTTCTAAGGTAGAAGAACAAAGG - Intronic
1038190533 8:25315802-25315824 TTGCTGAGGATGAAGAAAAAGGG - Intronic
1038315370 8:26480194-26480216 CAGTTAAAGGTGAAGAAAACAGG + Intronic
1040377920 8:46844386-46844408 CAGACAGGGTTGAAGAAAAAGGG - Intergenic
1040380103 8:46864312-46864334 CAGACAGGGTTGAAGAAAAAGGG - Intergenic
1040587718 8:48758894-48758916 CACCTAAGATAAAAGAAAAAAGG - Intergenic
1040688495 8:49906545-49906567 CAAGAAAGGCTGAAGAAAAATGG + Intergenic
1041195940 8:55401423-55401445 CAGCTAAGGCTGAGGACAAAGGG + Intronic
1041544706 8:59029576-59029598 CAGACAAGGTGGAAGAGAAATGG + Intronic
1041968119 8:63704674-63704696 AAGAAAAGGTTAAAGAAAAATGG - Intergenic
1042869297 8:73382879-73382901 TAGCTAAGGTGGAAAAGAAATGG - Intergenic
1043168637 8:76936114-76936136 CAGATAAGTTTGAAAAAACAAGG - Intergenic
1043436575 8:80240976-80240998 CAGCCGTGGTAGAAGAAAAAAGG - Intergenic
1043601822 8:81948802-81948824 CACTTAAGGTCGAAGAAATAGGG + Intergenic
1043718123 8:83509956-83509978 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1043737920 8:83770051-83770073 CTGGTGAGGTTGAAGAGAAAAGG + Intergenic
1043835963 8:85046281-85046303 CTGGCAAGGTTGCAGAAAAAAGG - Intergenic
1043837507 8:85063861-85063883 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1043926026 8:86037920-86037942 CAGAGAAGGCTGAAAAAAAATGG + Intronic
1044416887 8:91949041-91949063 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1044921749 8:97176009-97176031 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1044924930 8:97201830-97201852 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1045110361 8:98934458-98934480 CAACTAAGAGTGAACAAAAAGGG + Intronic
1045644584 8:104286959-104286981 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1045935592 8:107675229-107675251 CAACTTAGATTCAAGAAAAAGGG - Intergenic
1046293914 8:112196834-112196856 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1046386579 8:113514359-113514381 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1046511854 8:115213124-115213146 CCGCTAAGGGTGAAGGACAAAGG - Intergenic
1046511882 8:115213249-115213271 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1046559070 8:115815611-115815633 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1047682121 8:127264896-127264918 CAGCAAAGCTTGAAGCAAGAAGG - Intergenic
1047699135 8:127432681-127432703 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1047829734 8:128616599-128616621 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1048168633 8:132084909-132084931 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
1048168652 8:132084973-132084995 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
1048228096 8:132610014-132610036 CAGCTGAGGTAGGAGAACAACGG - Intronic
1048585629 8:135771881-135771903 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1049017887 8:139934014-139934036 CAGCTAAGGATGGAGAAATATGG - Intronic
1050238430 9:3608270-3608292 CAGGTGAGTTTGCAGAAAAAAGG - Intergenic
1050908371 9:11034949-11034971 CAGATAAAATTGAAGGAAAAAGG + Intergenic
1051052417 9:12949322-12949344 CCTCTAAGGGTGAAGAAGAAGGG - Intergenic
1051331568 9:16029516-16029538 CTGCTAAGGTTGAGGGAATAGGG + Intronic
1051338912 9:16093159-16093181 CTGCAAAGGTAAAAGAAAAACGG + Intergenic
1051849496 9:21490415-21490437 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1052402530 9:28018701-28018723 AAGGCAAGGTTGAAGAGAAAAGG + Intronic
1053057761 9:35004254-35004276 CAGCTAAGGGTGAAGGAGAAGGG - Intergenic
1055222312 9:73951253-73951275 CTGGTAAGGCTGCAGAAAAACGG - Intergenic
1055626482 9:78181653-78181675 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1055881544 9:81009975-81009997 CCGCTAAGGCTGAAGGAGAAGGG - Intergenic
1056044915 9:82705266-82705288 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1056060967 9:82884802-82884824 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1056290943 9:85143284-85143306 CAGCTAAGGTAAAGAAAAAATGG + Intergenic
1056804687 9:89719510-89719532 CAGCTAATGTCCAAGAACAAGGG - Intergenic
1056959457 9:91109872-91109894 CTGGCAAGGTTGTAGAAAAAAGG + Intergenic
1057377775 9:94540803-94540825 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1057683772 9:97215631-97215653 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1057922872 9:99112831-99112853 CAGCAAAGATTAAAAAAAAATGG + Intronic
1057981792 9:99670781-99670803 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1058168623 9:101650897-101650919 CAGAGAAGGTTTGAGAAAAAAGG - Intronic
1059574386 9:115474251-115474273 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1059574404 9:115474315-115474337 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1059606912 9:115843910-115843932 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1059863693 9:118490379-118490401 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1061935450 9:133855041-133855063 CAGCCCAGATGGAAGAAAAAGGG + Intronic
1185960862 X:4545041-4545063 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1185960901 X:4545171-4545193 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1185990857 X:4892607-4892629 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1186113099 X:6276953-6276975 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1186560546 X:10607884-10607906 CAGTTAAGGTTCAACAAAAAAGG + Intronic
1186739267 X:12500087-12500109 TTGCTCAGGTTGGAGAAAAAGGG - Intronic
1187233468 X:17444419-17444441 CAGCTAAGTTTGAGAATAAATGG - Intronic
1187621022 X:21054977-21054999 CTGGAAAGGCTGAAGAAAAAAGG + Intergenic
1188024779 X:25196693-25196715 GAGCAAAGGATGTAGAAAAATGG - Intergenic
1188757117 X:33975577-33975599 CTGGTAAGGTTGCAGAGAAAAGG + Intergenic
1188799088 X:34504519-34504541 TTGGTAAGGTTGCAGAAAAAAGG - Intergenic
1188953726 X:36408600-36408622 TAGCCAAAGTTGAAGAAAATGGG + Intergenic
1188982676 X:36741126-36741148 CTGGTGAGGTTGCAGAAAAAAGG - Intergenic
1189466702 X:41283133-41283155 CACCTAAGGTTAAAACAAAAAGG + Intergenic
1189920538 X:45899199-45899221 CAGTAATGATTGAAGAAAAAGGG + Intergenic
1190159232 X:48018070-48018092 CTGCTGAGGTTGTAGAGAAAAGG + Intronic
1190174945 X:48140299-48140321 CTGCTGAGGTTGTAGAGAAAAGG + Intergenic
1190378016 X:49809080-49809102 CTGGTGAGGTTGCAGAAAAAAGG - Intergenic
1193239603 X:79152014-79152036 ATGCTAAGGTTTAAGAACAAAGG + Intergenic
1193523758 X:82563365-82563387 CTGCTAAGGTTGTGGAGAAAAGG + Intergenic
1193941275 X:87682808-87682830 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1193999223 X:88406685-88406707 CAGCTAAGGTAGTATTAAAAGGG + Intergenic
1194152105 X:90338632-90338654 TAACTATGATTGAAGAAAAATGG - Intergenic
1194186440 X:90778011-90778033 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1194351088 X:92825504-92825526 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1194551576 X:95307438-95307460 CAGCTAGGAATGGAGAAAAATGG + Intergenic
1194822990 X:98529054-98529076 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1194874052 X:99164332-99164354 CAGCTAAGGTTGAAGGAGCAAGG + Intergenic
1194948556 X:100097390-100097412 CTGCTGAGGTTGTAGAGAAAAGG + Intergenic
1195110375 X:101641930-101641952 CACCTAAGGTCCAAAAAAAAAGG - Intergenic
1195908879 X:109869907-109869929 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1196018190 X:110961693-110961715 CAGCTAAGCTTCTTGAAAAAAGG + Intronic
1196299809 X:114040986-114041008 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1196341972 X:114606225-114606247 CCGCTAAGGGTGAAGGAGAAGGG + Intronic
1196502296 X:116399498-116399520 CAGGAAAGGATGAAGAACAATGG - Intergenic
1196533741 X:116817193-116817215 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1196572317 X:117280257-117280279 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1196774061 X:119322462-119322484 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1197011354 X:121568403-121568425 CAACTTAGCTTGAAGAAAAAGGG - Intergenic
1197064700 X:122223013-122223035 CCGCTAAGGGTGAAGGAGAAGGG - Intergenic
1197131300 X:123008490-123008512 CAGCTCAGGTTGAGGAGTAAAGG + Intergenic
1197168987 X:123410311-123410333 CAACTAAGGATAAAGAAGAAGGG + Intronic
1197352260 X:125393545-125393567 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1197470721 X:126863943-126863965 CAGCTAAGGGTGAAGGACCAAGG - Intergenic
1198599606 X:138269056-138269078 CTGCTAAGGGTGAAGGAGAAGGG + Intergenic
1198634886 X:138686090-138686112 CTGCTAACTTTTAAGAAAAAAGG + Intronic
1199330112 X:146549479-146549501 CTGCCAAGGTTGTAGAGAAAAGG - Intergenic
1199576248 X:149316590-149316612 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1199889003 X:152056269-152056291 CTGGTAAGGTTGCAGAGAAAAGG - Intergenic
1200440973 Y:3211762-3211784 TAGCTAAGCTTCAAGAATAAGGG - Intergenic
1200498458 Y:3915384-3915406 TAACTATGATTGAAGAAAAATGG - Intergenic
1200533040 Y:4360087-4360109 CCGCTAAGGGTGAAGGAGAAGGG + Intergenic
1200659417 Y:5942184-5942206 CTGCTAAGGGTGAAGGAGAAGGG - Intergenic
1201754850 Y:17475836-17475858 CAGCTAAATATGAAGAAAATAGG - Intergenic
1201846702 Y:18430149-18430171 CAGCTAAATATGAAGAAAATAGG + Intergenic
1201936864 Y:19419439-19419461 CCGCTAAGGGTGAAGAAGAAGGG - Intergenic
1202038851 Y:20662256-20662278 TTGCTGAAGTTGAAGAAAAAGGG - Intergenic
1202111830 Y:21428911-21428933 CTGCTAAGGATGCAGAGAAAAGG + Intergenic
1202300632 Y:23409853-23409875 CTGGCAAGGTTGCAGAAAAAAGG - Intergenic
1202570179 Y:26260745-26260767 CTGGCAAGGTTGCAGAAAAAAGG + Intergenic