ID: 969406025

View in Genome Browser
Species Human (GRCh38)
Location 4:6992333-6992355
Sequence GTGTATTCACAGATGATATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 158}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969406017_969406025 28 Left 969406017 4:6992282-6992304 CCGTGTAGGACTCGGGCTTTCCC 0: 1
1: 0
2: 0
3: 10
4: 89
Right 969406025 4:6992333-6992355 GTGTATTCACAGATGATATTGGG 0: 1
1: 0
2: 1
3: 8
4: 158
969406018_969406025 8 Left 969406018 4:6992302-6992324 CCCCTCTAAAACTGCACACCTGT 0: 1
1: 0
2: 0
3: 12
4: 161
Right 969406025 4:6992333-6992355 GTGTATTCACAGATGATATTGGG 0: 1
1: 0
2: 1
3: 8
4: 158
969406019_969406025 7 Left 969406019 4:6992303-6992325 CCCTCTAAAACTGCACACCTGTG 0: 1
1: 0
2: 1
3: 13
4: 178
Right 969406025 4:6992333-6992355 GTGTATTCACAGATGATATTGGG 0: 1
1: 0
2: 1
3: 8
4: 158
969406020_969406025 6 Left 969406020 4:6992304-6992326 CCTCTAAAACTGCACACCTGTGG 0: 1
1: 0
2: 1
3: 10
4: 126
Right 969406025 4:6992333-6992355 GTGTATTCACAGATGATATTGGG 0: 1
1: 0
2: 1
3: 8
4: 158
969406023_969406025 -10 Left 969406023 4:6992320-6992342 CCTGTGGGTTTGAGTGTATTCAC 0: 1
1: 0
2: 6
3: 47
4: 211
Right 969406025 4:6992333-6992355 GTGTATTCACAGATGATATTGGG 0: 1
1: 0
2: 1
3: 8
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969406025 Original CRISPR GTGTATTCACAGATGATATT GGG Intronic
901371483 1:8801682-8801704 GTGTATGCACAGAATATTTTAGG - Intronic
903204294 1:21768963-21768985 GTGTTTTAAAAAATGATATTGGG - Intronic
907601158 1:55771018-55771040 TTGTATTCACAAATTATTTTTGG + Intergenic
908312595 1:62900309-62900331 GTATGTTCATAGATAATATTTGG - Intergenic
909261962 1:73501552-73501574 TTGTAGTCACTTATGATATTAGG + Intergenic
909935334 1:81544523-81544545 GAGAAGTCACAGATGACATTAGG - Intronic
911273594 1:95833368-95833390 TTGTATTCACAGTAGAGATTAGG - Intergenic
912207595 1:107525579-107525601 GTGTATACACAGATGGAAGTTGG + Intergenic
917944649 1:179955611-179955633 GTTTATTCACAGATAATTTGGGG + Intronic
924319659 1:242836240-242836262 CTTTATTCACAGGTGATAGTTGG + Intergenic
924368743 1:243324048-243324070 GTGTATTCACTGGTAATATTTGG - Intronic
1063541715 10:6940766-6940788 GTGTATTTACAGAGGTAATTAGG - Intergenic
1068566538 10:58581966-58581988 GTATATGCACAGATGACCTTGGG - Intronic
1069080947 10:64087758-64087780 TTGTATTCACAGAGGATGTTGGG + Intergenic
1070120904 10:73575801-73575823 TTGACTACACAGATGATATTTGG - Intronic
1071832252 10:89383456-89383478 GTGTATTCCCACATTGTATTTGG - Exonic
1075011364 10:118873129-118873151 GTATATTCAAAGGAGATATTGGG + Intergenic
1077514745 11:2994662-2994684 GAGTCTTCACAGATGCAATTAGG + Intergenic
1079236386 11:18693588-18693610 GTATGTTCACAGATGATCTGTGG - Intronic
1079606655 11:22377330-22377352 GTGCATTCAGAGAAGATGTTAGG + Intronic
1080731124 11:34954363-34954385 CTGTGTACACAGATGAGATTAGG + Intronic
1082041795 11:47692034-47692056 GTGTCTTCAGTAATGATATTAGG - Intronic
1086075950 11:82852400-82852422 ATGTATACACTGATGGTATTAGG + Intronic
1086756857 11:90575197-90575219 GTATTTTCACAGATTATAATGGG - Intergenic
1087511169 11:99095715-99095737 GTGAATTAACAAATGAAATTGGG + Intronic
1088875815 11:113935446-113935468 GTAGAGTCACAGATCATATTTGG + Intronic
1089233658 11:117004075-117004097 GTGGATGATCAGATGATATTTGG - Intronic
1090101475 11:123801780-123801802 CTGTATTCAAAGAAGAAATTAGG - Intergenic
1096655335 12:53087246-53087268 GTGAATTCAAAGAATATATTTGG + Intergenic
1099377894 12:81915625-81915647 TTGTATTTTCAGATGATATAAGG + Intergenic
1100509882 12:95260061-95260083 TTGTATTCATAGATGATTGTAGG + Intronic
1100931507 12:99615124-99615146 GTGTTTACACAGATGACATTAGG + Intronic
1100946539 12:99789786-99789808 GTGTGTTTTCAGATGAGATTGGG - Intronic
1102127014 12:110491720-110491742 GTATCTTCAAAGTTGATATTTGG - Exonic
1102271658 12:111541706-111541728 GTGTATTAACAGAAGAACTTTGG - Intronic
1107502252 13:40992289-40992311 GTGTGTTCACAGATGCACTTAGG - Intronic
1111521781 13:89413961-89413983 GTGAATTCACAGTTGAAATTGGG - Intergenic
1112888124 13:104198727-104198749 GTATATTCATAGATGAGCTTTGG + Intergenic
1115159904 14:30382051-30382073 ATGCATTCACTGATGTTATTTGG + Intergenic
1115411556 14:33081137-33081159 CTCTATTATCAGATGATATTGGG + Intronic
1115890334 14:38019413-38019435 GTGTTATCACAGAAGATAATGGG - Intronic
1118409468 14:65463001-65463023 GTGTTTTCATAGTGGATATTTGG + Intronic
1120491725 14:85186588-85186610 ATGTAATCACTGATGATATAGGG + Intergenic
1127064095 15:55219111-55219133 CTTTATTCACAGAGGATAGTTGG - Intronic
1127328818 15:57919254-57919276 GGATATTCACAGATGCTAATGGG + Intergenic
1127567432 15:60205586-60205608 GTATATACAAAGATGGTATTTGG - Intergenic
1130826453 15:87551774-87551796 GTCTTTTCGCAAATGATATTGGG - Intergenic
1131212093 15:90506632-90506654 TTTTAATCACAGAAGATATTTGG + Intergenic
1137037489 16:35578787-35578809 GTGTTTTCACATATTTTATTGGG - Intergenic
1137963047 16:52904337-52904359 GTCTCTTCACAAATGATGTTGGG + Intergenic
1138012448 16:53395168-53395190 GTGTATCCACAGAGGATGTCAGG - Intergenic
1138282559 16:55783269-55783291 GTGTGTCCACAGTTGATTTTCGG - Intergenic
1138879504 16:60993984-60994006 GTGTATTCATACAAGATAGTTGG - Intergenic
1139891888 16:70258423-70258445 GTCTGTTCACATATGAGATTTGG - Intronic
1143163352 17:4885471-4885493 GTGTCTTCACAGTGGATTTTGGG + Exonic
1143679550 17:8466131-8466153 GTGTATTAATACATTATATTTGG + Intronic
1148935981 17:51165149-51165171 CTGTTTTCACAGTTGACATTTGG + Intronic
1149007728 17:51822830-51822852 GAGTCTTCTCACATGATATTTGG - Intronic
1149854235 17:60065769-60065791 GTGTTTTCACAGAACATTTTGGG + Intronic
1157363938 18:47046068-47046090 GTGTTGTCACAGATGATTTCTGG + Intronic
1158928853 18:62300985-62301007 GGGTATTCACAGCTGAAAGTGGG + Intronic
1160369228 18:78357669-78357691 GTGTATTCATTAATGATTTTTGG - Intergenic
1165703021 19:37952929-37952951 GTGTATGCACAGAGGATTCTTGG + Intronic
1165833833 19:38743065-38743087 ATGTCTTCACAGATGAACTTCGG + Exonic
925693155 2:6546424-6546446 GTGGATTCACAGAAGACATATGG - Intergenic
926205656 2:10833027-10833049 GGGAGCTCACAGATGATATTGGG + Intronic
928640437 2:33292917-33292939 ATTTATTCACAGAGCATATTTGG + Intronic
930664370 2:54087639-54087661 GTGTATTCAAGAATGAAATTAGG - Intronic
935095614 2:99941580-99941602 GTGTAGTCACAGTGGAAATTAGG - Intronic
937205079 2:120231169-120231191 GTGTTTTCACAGATGCCTTTAGG + Intergenic
941268658 2:163397257-163397279 GTGTATACACATAAAATATTTGG - Intergenic
942290175 2:174461493-174461515 CTGTAATCACAAGTGATATTGGG + Intronic
945491467 2:210460774-210460796 GTGCTTTCACAGATGATCTGGGG + Intronic
947374869 2:229485392-229485414 GGGTGTTCACAGATTACATTTGG + Intronic
948201337 2:236131465-236131487 GTGTATCCACAGATGGGTTTAGG + Exonic
1169241995 20:3990040-3990062 GATTATTCACAAATGATATTGGG + Intronic
1170324814 20:15145177-15145199 CTGTATTCACAGATGACATTTGG + Intronic
1170446625 20:16434625-16434647 GTGTCTTCACAGAGTATGTTAGG + Intronic
1171944635 20:31365561-31365583 TTGTATGCACATATGATTTTTGG - Intergenic
1175606939 20:60318852-60318874 GTGTATTCAGCTTTGATATTTGG + Intergenic
1183126487 22:35786838-35786860 GTGATTTCACATATGAAATTGGG - Intronic
949143390 3:663893-663915 GTGTATGCACAGCTGCTATAAGG - Intergenic
950801349 3:15554234-15554256 GTGTGTTAACAGAAAATATTCGG - Intergenic
951305769 3:21059726-21059748 GTCTTTCTACAGATGATATTTGG - Intergenic
953470252 3:43160141-43160163 CTGTCTTCCCAGATTATATTCGG - Intergenic
956286560 3:67616131-67616153 GTGGAATCACAGGTGAGATTAGG + Intronic
957485636 3:80858794-80858816 GTGCATTCAGAGATGCTATCTGG - Intergenic
958077735 3:88705360-88705382 GTCTCTTCACAGGTGATATCTGG - Intergenic
958760218 3:98297426-98297448 GTGGATTCATAGATGCTATGTGG - Intergenic
958878470 3:99641985-99642007 GTGTATTCCCAGATGCTTTAGGG - Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
963346958 3:144106327-144106349 GTGGTTTCACAGATGAAATCTGG + Intergenic
964142654 3:153421511-153421533 ATGTCTTAACAGATGATATATGG - Intergenic
964686375 3:159400303-159400325 GAGTATTCACCTATGATAATTGG + Intronic
966685222 3:182685940-182685962 CTGTATTCACAGAAAAGATTTGG + Intergenic
969406025 4:6992333-6992355 GTGTATTCACAGATGATATTGGG + Intronic
970390788 4:15610715-15610737 TTGGATTCATAGATGTTATTGGG - Intronic
970644226 4:18101120-18101142 GTGTATTCACAAAGGAAAGTAGG - Intergenic
970884955 4:20977461-20977483 GTGTGTTTCCTGATGATATTTGG + Intronic
971083572 4:23244185-23244207 TTGTATTCACAGATTATACAGGG - Intergenic
971496953 4:27276815-27276837 GTGCAGTGACACATGATATTTGG + Intergenic
973571445 4:52243649-52243671 GTGTGTTCATAGAAGAGATTTGG - Intergenic
973643306 4:52924867-52924889 CTGCATTCACAGATGAGATGTGG - Intronic
976578692 4:86708229-86708251 GACTATTCCCATATGATATTAGG + Intronic
976759182 4:88529944-88529966 CTGTGTTCTCAGATTATATTAGG + Intronic
976871562 4:89800375-89800397 ATGTATTCACAAAGGATTTTAGG - Intronic
977474418 4:97487164-97487186 GGGTATAGACAGGTGATATTTGG - Intronic
978924311 4:114224024-114224046 TTGTATTCACAGTTCCTATTAGG + Intergenic
978964071 4:114721010-114721032 GCTTTTTCACAGAAGATATTGGG + Intergenic
979553604 4:122019348-122019370 CTGTATTCACAGACTGTATTGGG - Intergenic
980412642 4:132443424-132443446 GTGTTTCCACAGATAATCTTTGG + Intronic
980602874 4:135047599-135047621 ATTTATTCACAGATGATGTGGGG - Intergenic
981870978 4:149486249-149486271 GTGTGTCCAGAGATGTTATTTGG + Intergenic
985246181 4:187981971-187981993 GTGTATAAACAGATGAAATATGG + Intergenic
987456293 5:18151168-18151190 TTGAATTCACAGATTTTATTGGG - Intergenic
987811582 5:22843228-22843250 GTGTTTTCACAGATAGAATTGGG - Intronic
988638153 5:33010221-33010243 GCATATTCAAGGATGATATTGGG + Intergenic
988916630 5:35900892-35900914 ATGTATTCACAGATGGTGTGTGG - Intergenic
988921646 5:35947779-35947801 GGGAATGCAAAGATGATATTTGG - Intergenic
989777823 5:45230495-45230517 GTGTATTCACAAATAACACTTGG + Intergenic
991034225 5:62112048-62112070 GTCTATGTACAGATGATAGTTGG + Intergenic
991347784 5:65688103-65688125 GTGAATTCTTAGATGAAATTTGG - Intronic
993180780 5:84549204-84549226 GTGCATTCACAGAAGATACAGGG - Intergenic
994283876 5:97939667-97939689 GTGTCTTCAGAGAAGATATATGG - Intergenic
996831127 5:127741554-127741576 GAGAATTCACAGATGTTATCAGG + Intergenic
999474156 5:151882756-151882778 GTGTGTTTACAGATGATATAGGG - Intronic
1000733493 5:164867843-164867865 GTGTATTTAGAAATGATCTTTGG + Intergenic
1001172379 5:169432519-169432541 TTATATCCACAGATGATCTTTGG - Intergenic
1006382627 6:33708855-33708877 GTGCATTCTCAGGTGACATTAGG + Intronic
1007017264 6:38481360-38481382 TTGTATTCCCAGTTGATACTTGG + Intronic
1008358849 6:50590815-50590837 ATGTAGACACAGATGATTTTAGG - Intergenic
1008977918 6:57449804-57449826 GTCTATTCACTGATCATACTTGG - Intronic
1009166065 6:60342748-60342770 GTCTATTCACTGATCATACTTGG - Intergenic
1009532738 6:64842062-64842084 GTGCAAACACTGATGATATTTGG - Intronic
1009558012 6:65199954-65199976 GAGTATAAACAGATTATATTGGG + Intronic
1010153040 6:72758709-72758731 GTGTATTCAAAGATGATTATAGG - Intronic
1011170656 6:84501071-84501093 GTGTATTATCAGATGACTTTTGG + Intergenic
1013984989 6:116180762-116180784 ATTTATTCACTGATGAAATTGGG - Intronic
1019496509 7:1342883-1342905 GTGGACACACAGATGAGATTTGG - Intergenic
1021329340 7:19315925-19315947 GTGTGTTCTAAGATAATATTAGG + Intergenic
1023314289 7:38919338-38919360 GTTGTTTCACAAATGATATTTGG - Intronic
1025927241 7:65969994-65970016 CTGTTTTCACAGATGGTCTTTGG - Intronic
1027683084 7:81244751-81244773 GTGTATTCATAAATAATATTTGG - Intergenic
1032747556 7:134803128-134803150 GTCTAATGACAAATGATATTCGG + Intronic
1033502422 7:141965447-141965469 GTGGGTCCACAGATGATATCTGG + Intronic
1033666413 7:143444983-143445005 GTGTATTCTCCGATGACCTTTGG + Intergenic
1034342039 7:150363707-150363729 GTGTCTTCACAGAGGATTTCTGG + Intergenic
1036004911 8:4651187-4651209 GTTTATACACATCTGATATTAGG - Intronic
1038082144 8:24150413-24150435 GTGTATTTGCAGAGGATCTTGGG + Intergenic
1040098085 8:43467810-43467832 GTGATATCACTGATGATATTTGG + Intergenic
1041869736 8:62619130-62619152 GTGTTTTCACAGATGAAAGCAGG - Intronic
1041999153 8:64101864-64101886 TTGTATACACCTATGATATTTGG - Intergenic
1042012319 8:64261117-64261139 GTTTTTTAACAGATAATATTCGG + Intergenic
1046480728 8:114814044-114814066 ATGGATTCACAGCTGAAATTTGG + Intergenic
1047102944 8:121699287-121699309 GTTTATTTACAAATTATATTAGG + Intergenic
1047545436 8:125811843-125811865 GTTAACTCACAGATGAGATTGGG + Intergenic
1051072670 9:13191338-13191360 GTATATTGAGAGATGATGTTAGG - Intronic
1052755943 9:32541294-32541316 GTCTATTTAAAGATGACATTTGG - Exonic
1056034813 9:82593228-82593250 TTTTATTCACAGATCAAATTGGG + Intergenic
1061739055 9:132686113-132686135 TTGTTTTTACAGATGAGATTGGG + Intronic
1185850778 X:3484358-3484380 GTGGATTGAAAGATAATATTTGG - Intergenic
1186842721 X:13500777-13500799 GTGATTTCACAGATGACAATAGG - Intergenic
1194515811 X:94852940-94852962 GTATATTCAGATATGTTATTGGG - Intergenic
1196545876 X:116963453-116963475 AGGTAATCAAAGATGATATTTGG + Intergenic
1198472322 X:136959022-136959044 TTGTTATCACAGATGATCTTGGG + Intergenic
1199316015 X:146379198-146379220 GTGTGTTCTCACATGATTTTTGG - Intergenic
1199480624 X:148294788-148294810 GTTTATTAATAAATGATATTGGG - Intergenic
1201669018 Y:16494538-16494560 GAGTATGAACATATGATATTTGG + Intergenic