ID: 969406492

View in Genome Browser
Species Human (GRCh38)
Location 4:6996574-6996596
Sequence GCGAAAACAGGGCTGCAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 604
Summary {0: 2, 1: 13, 2: 24, 3: 121, 4: 444}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969406482_969406492 20 Left 969406482 4:6996531-6996553 CCAGTAAAAAAAAAAAAAAGATG 0: 1
1: 14
2: 260
3: 2715
4: 17542
Right 969406492 4:6996574-6996596 GCGAAAACAGGGCTGCAGGGTGG 0: 2
1: 13
2: 24
3: 121
4: 444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969406492 Original CRISPR GCGAAAACAGGGCTGCAGGG TGG Intronic