ID: 969406492 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 4:6996574-6996596 |
Sequence | GCGAAAACAGGGCTGCAGGG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 604 | |||
Summary | {0: 2, 1: 13, 2: 24, 3: 121, 4: 444} |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
969406482_969406492 | 20 | Left | 969406482 | 4:6996531-6996553 | CCAGTAAAAAAAAAAAAAAGATG | 0: 1 1: 14 2: 260 3: 2715 4: 17542 |
||
Right | 969406492 | 4:6996574-6996596 | GCGAAAACAGGGCTGCAGGGTGG | 0: 2 1: 13 2: 24 3: 121 4: 444 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
969406492 | Original CRISPR | GCGAAAACAGGGCTGCAGGG TGG | Intronic | ||