ID: 969410747

View in Genome Browser
Species Human (GRCh38)
Location 4:7026453-7026475
Sequence TAAATGGCTTTATAGTTGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969410742_969410747 19 Left 969410742 4:7026411-7026433 CCTTCCTATCATCAGATATCCAG 0: 1
1: 0
2: 4
3: 23
4: 202
Right 969410747 4:7026453-7026475 TAAATGGCTTTATAGTTGGTTGG No data
969410743_969410747 15 Left 969410743 4:7026415-7026437 CCTATCATCAGATATCCAGTTTT 0: 1
1: 0
2: 0
3: 17
4: 225
Right 969410747 4:7026453-7026475 TAAATGGCTTTATAGTTGGTTGG No data
969410744_969410747 0 Left 969410744 4:7026430-7026452 CCAGTTTTCAAATTCAGATGTCA 0: 1
1: 0
2: 1
3: 40
4: 353
Right 969410747 4:7026453-7026475 TAAATGGCTTTATAGTTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969410747 Original CRISPR TAAATGGCTTTATAGTTGGT TGG Intronic
No off target data available for this crispr