ID: 969414336

View in Genome Browser
Species Human (GRCh38)
Location 4:7048813-7048835
Sequence CAGAAAAGGACAAATCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 0, 2: 10, 3: 82, 4: 402}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969414336_969414342 28 Left 969414336 4:7048813-7048835 CCTGCAGGATTTGTCCTTTTCTG 0: 1
1: 0
2: 10
3: 82
4: 402
Right 969414342 4:7048864-7048886 GTCAGGGATCATCCGTGTTGTGG No data
969414336_969414340 12 Left 969414336 4:7048813-7048835 CCTGCAGGATTTGTCCTTTTCTG 0: 1
1: 0
2: 10
3: 82
4: 402
Right 969414340 4:7048848-7048870 CACTTTGCCTCATGTCGTCAGGG 0: 1
1: 0
2: 5
3: 92
4: 993
969414336_969414339 11 Left 969414336 4:7048813-7048835 CCTGCAGGATTTGTCCTTTTCTG 0: 1
1: 0
2: 10
3: 82
4: 402
Right 969414339 4:7048847-7048869 TCACTTTGCCTCATGTCGTCAGG 0: 1
1: 0
2: 2
3: 22
4: 239

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969414336 Original CRISPR CAGAAAAGGACAAATCCTGC AGG (reversed) Intronic
900682696 1:3925531-3925553 CAGAAAAGACCAAAGCCTGGAGG - Intergenic
901517302 1:9757072-9757094 CATTAAAAGAAAAATCCTGCCGG - Intronic
903824579 1:26134001-26134023 CAGACATGGACAGATCCAGCAGG + Intergenic
903964990 1:27082424-27082446 AAGAAAAAGACAAATCCAACTGG - Intergenic
905963980 1:42074084-42074106 CAGAAATGGACAGATCTAGCAGG - Intergenic
906066701 1:42986009-42986031 CAGAAAAGGCCCAAACCAGCCGG - Intergenic
906885979 1:49649544-49649566 CAGAAATGGACAGATCCAGCAGG + Intronic
906911030 1:49950981-49951003 CATAGAAAGACAAATACTGCAGG + Intronic
907000104 1:50844028-50844050 CAGAAAATGACAAATGCTGGTGG - Intronic
907138119 1:52158369-52158391 CAGATAGGGACAGATCCTGAGGG + Intronic
907550462 1:55300640-55300662 GAGAAAAGGACAAAAGCTGTGGG + Intergenic
908430865 1:64055925-64055947 CACAAAAGGACAAATATTGTCGG - Intronic
908575642 1:65456380-65456402 CAGAAATGGACAGATCCAGCAGG - Intronic
909931012 1:81500545-81500567 AATCAAAGGACAAATACTGCAGG + Intronic
909971137 1:81991109-81991131 TAGAGAAGGACAAATGCAGCTGG + Exonic
910541247 1:88360304-88360326 AAGAACAAGACACATCCTGCTGG + Intergenic
911146053 1:94553459-94553481 CAAGAAAGGACAAAGTCTGCTGG - Intergenic
911403298 1:97404352-97404374 CAGAAATGGACAGATCCAGCAGG - Intronic
911458980 1:98165021-98165043 CAGAAAAAGACAAAACCTACAGG - Intergenic
911458984 1:98165053-98165075 CAGAAAAAGACAAAACCTACGGG - Intergenic
911458989 1:98165085-98165107 CTGAAAAAGACAAAACCTACAGG - Intergenic
911976792 1:104507729-104507751 CTGAAAAGAACAAATCTTGCCGG - Intergenic
912479117 1:109965357-109965379 CAGAAATGGACAAATCCAGCAGG + Intergenic
912480294 1:109977850-109977872 CAGAATGGGACAAATGCTGAGGG + Intergenic
912750238 1:112281446-112281468 TAGGACAGGACAAAGCCTGCTGG - Intergenic
912855153 1:113161831-113161853 TAGAAATGGACAAATCCAGCAGG - Intergenic
912945533 1:114081145-114081167 CAGAAAAGGAGAGAACCTCCAGG + Intergenic
913028303 1:114869827-114869849 CAGAAATGGACAGACCCAGCAGG - Intronic
913351147 1:117861061-117861083 CAGAAAAGCACGAATCCTTTGGG + Intergenic
915096872 1:153469271-153469293 CCTAAAAGGACAAAGCTTGCAGG - Intergenic
916271474 1:162947364-162947386 CATCAAAGGTCAAATCCTGTAGG - Intergenic
916805657 1:168258309-168258331 CAGAAATTGACAGATCCAGCAGG - Intergenic
917496991 1:175549460-175549482 CAGGAAGGGAGAAATCTTGCAGG - Intronic
917766320 1:178221822-178221844 CAGAAATGGACAGATCCAGTGGG - Intronic
917782708 1:178415632-178415654 CAGAAATGGACAGATCTAGCAGG - Intronic
918096252 1:181336814-181336836 CACAAAAGCACAAATACTGTAGG - Intergenic
918539704 1:185617189-185617211 CAGAAATGGACATATCCAGTAGG + Intergenic
919876708 1:201874677-201874699 CAGAAATGGCCAAACCCTCCTGG - Intronic
921605402 1:217147017-217147039 CAGAAATGGACAGATCCAGCAGG + Intergenic
921795892 1:219344444-219344466 TATAAAAGGATAAATCCTGGGGG - Intergenic
922869241 1:228887174-228887196 CAGAAAATGGGATATCCTGCAGG - Intergenic
924004804 1:239597762-239597784 CAGAAGATGAGAAATGCTGCTGG - Intronic
924074921 1:240323810-240323832 CAGCCAAGGACAGATCCTGGGGG - Intronic
924507156 1:244696719-244696741 CAGCTCAGGACCAATCCTGCAGG - Intronic
1063976329 10:11419359-11419381 CAGAAATTGACAGATCCAGCAGG + Intergenic
1065087687 10:22196439-22196461 AAGAAATGGACAGATCCAGCAGG - Intergenic
1066019222 10:31280382-31280404 CAGAAAAGGATAAATATTCCTGG + Intergenic
1066511366 10:36100773-36100795 CAGAAATAGACAGATCCAGCAGG + Intergenic
1067047765 10:42994999-42995021 CACAAAAGGACAAATATTGTAGG + Intergenic
1067194077 10:44099251-44099273 AAGAAAAGGACAGATCCAGCAGG + Intergenic
1067687202 10:48473236-48473258 CACAAAAAGACAAATACTACAGG + Intronic
1067802607 10:49369497-49369519 ACTAAAAGAACAAATCCTGCAGG + Intronic
1069154368 10:65008129-65008151 CAGAAATGGACAGATCCTGCAGG - Intergenic
1069966447 10:72121824-72121846 CAGAAATGGACAGATCCAGAAGG + Intronic
1071428784 10:85586748-85586770 CAGAAATGGACAAATCCAGCAGG + Intergenic
1072550217 10:96471535-96471557 CAGCAAAGGGCCAACCCTGCGGG + Intronic
1072623911 10:97098838-97098860 CAGAAAGGGACAATGCCTGGGGG + Intronic
1074850377 10:117434650-117434672 CAGCCAAGGACAAGTCCTGGCGG + Intergenic
1075168768 10:120093621-120093643 CAGAAAAAGACAAATACTGCAGG - Intergenic
1075267357 10:121013547-121013569 CAGAAATGGACAGATACAGCAGG + Intergenic
1075402485 10:122171175-122171197 CAGACAGGTACAAAACCTGCGGG - Intronic
1077282606 11:1752512-1752534 CAGCCAAGGCCACATCCTGCCGG + Intronic
1078601855 11:12739526-12739548 CACAAAAGGACAAATACAGTAGG - Intronic
1078823188 11:14903771-14903793 CACAAAAGGACAAATATTGTAGG + Intergenic
1079146116 11:17853552-17853574 CAGAAATGGACAACTCCATCTGG + Intronic
1081313816 11:41606011-41606033 CAGAAAAATATAAATGCTGCAGG - Intergenic
1081839586 11:46188094-46188116 CAGAAATGGACAGATCCAGCAGG + Intergenic
1082850717 11:57761962-57761984 CTGAGAAAGACAAATCCAGCAGG - Exonic
1082898871 11:58223988-58224010 CACAGAAAGACAAATACTGCAGG + Intergenic
1084339661 11:68487926-68487948 CAGAAATGGTGAAATCCAGCAGG - Intronic
1084402046 11:68950246-68950268 CAGAACAGGACAATTCCTGCTGG + Intergenic
1084418225 11:69046617-69046639 CACAAAAGAACAAATACTGCAGG + Intergenic
1084676057 11:70635459-70635481 CACAAAAAGATAAATACTGCAGG + Intronic
1086052248 11:82606987-82607009 AAGCAGAGGACAAATCCTACAGG + Intergenic
1086392380 11:86378535-86378557 CAGAAATGAACAGATCCAGCTGG - Intronic
1087493333 11:98856630-98856652 CAGAAATGGAGAGATCCAGCAGG + Intergenic
1087542606 11:99540091-99540113 CAAAAAAGGCCACATCATGCAGG - Intronic
1088336622 11:108711871-108711893 CAGGAATAGACAAATCCAGCAGG - Intronic
1088882939 11:113986048-113986070 CAGAAAAGGTGAAATCCGACAGG + Exonic
1088929455 11:114335882-114335904 CAGAAATGGACAGATTCAGCAGG + Intergenic
1091037357 11:132245914-132245936 TAGAGAAGATCAAATCCTGCGGG - Intronic
1091125907 11:133096974-133096996 CAGAAGTGGACAGATCCAGCAGG + Intronic
1091854230 12:3725903-3725925 CAGAAAAAAAAAAATCCTGGAGG - Intronic
1092176804 12:6414695-6414717 CAGAAATGGACAGATCCAGCAGG - Intergenic
1093109825 12:15136965-15136987 CAGAAATGGAGAGATCCAGCAGG - Intronic
1093510918 12:19927272-19927294 CATAGAAGGACAAATACTGCAGG - Intergenic
1094616464 12:32040773-32040795 CAGGGAAGGACACATACTGCAGG + Intergenic
1095084582 12:38047804-38047826 AAGAAAAGAACAAAGCCTCCAGG - Intergenic
1096391770 12:51235208-51235230 AAGAAAAGGAAAAATCCCTCTGG - Intergenic
1096728065 12:53581274-53581296 CAGAAATGGACGTATCCAGCAGG + Intronic
1097037088 12:56131078-56131100 GAGAAAAGAGCAGATCCTGCTGG + Exonic
1097932411 12:65203698-65203720 CAGAAATGGTCAGATCCAGCAGG - Intronic
1099771268 12:87060859-87060881 CAGATAAGGATAAATCTTTCAGG + Intergenic
1100252486 12:92842084-92842106 CACAAAAAGACAAATACTGTTGG + Intronic
1102050215 12:109856555-109856577 CAGCAAAGGAAAGAGCCTGCTGG - Intronic
1103628602 12:122240837-122240859 CAAAAAAGGAAAAAAGCTGCTGG + Intronic
1103938017 12:124486684-124486706 CAGATAAGCCCAAGTCCTGCAGG + Intronic
1103995296 12:124825789-124825811 GACAGAAGGACAAATACTGCAGG + Intronic
1105055682 12:133096917-133096939 CAGAACTGGACAGATCCAGCAGG - Intronic
1105390854 13:19976654-19976676 CACAAAAAGACAAATACTGCAGG - Intronic
1105755956 13:23464679-23464701 CAGAAAAGGACGAATACTGTAGG + Intergenic
1105770165 13:23602439-23602461 CAGAAATGGACAGATTCAGCAGG + Intronic
1105830006 13:24155927-24155949 CACAAAAGGACAGATACTGTAGG - Intronic
1106306132 13:28512033-28512055 CAGAAATGGACAGATTCAGCAGG - Intergenic
1106830125 13:33572077-33572099 CAGAAAACAAGAAATCTTGCAGG - Intergenic
1107160553 13:37222080-37222102 TAGAAATGGACAGATCCAGCAGG - Intergenic
1107275014 13:38668239-38668261 CATAGAAAGACAAATCCTGCAGG + Intergenic
1108791630 13:53975529-53975551 CAGAAAAAAAAAAATCCTTCTGG + Intergenic
1110078463 13:71280375-71280397 CAAAAAAGGATAAATCCTTAAGG - Intergenic
1112035640 13:95493854-95493876 CACAAAAGGACAAATATGGCCGG - Intronic
1113845950 13:113391682-113391704 CACAGAAGGACAAATTCTGTGGG - Intergenic
1114445490 14:22784785-22784807 CAGAACAGAACAAAGCTTGCAGG + Intronic
1114615697 14:24067157-24067179 CTGAGAAGGACTAATACTGCAGG - Intronic
1115475272 14:33807508-33807530 CAGAAATGGACAAAACCTGTGGG - Intergenic
1115530474 14:34322441-34322463 CAGTAAAGGAAAAATCTGGCTGG + Intronic
1116442735 14:44972436-44972458 CAGAAATGGACAGATCCAGCAGG - Intronic
1117651572 14:57912832-57912854 CAGAAATGGACAGATCCAGCAGG - Intronic
1118727874 14:68643071-68643093 CAGAAATGGACAGATCCAGCCGG - Intronic
1119323708 14:73746308-73746330 CAGAAAAGGATTAAGCCTCCAGG + Intronic
1122546469 14:102525446-102525468 CACAAAAAGACAAATACTGTAGG + Intergenic
1122759561 14:104012364-104012386 CAGTAAAGGAGTAATCCAGCAGG - Intronic
1123035934 14:105471982-105472004 CAGAAAAGGACAGGCCCTGGGGG - Intergenic
1123116902 14:105899005-105899027 CAGAAGAGGACAGGGCCTGCAGG + Intergenic
1123763695 15:23453648-23453670 CAAAAAAGGACAAATGCTTGAGG - Intergenic
1123808519 15:23899408-23899430 TAGAAATGGACAAATCCAGCAGG - Intergenic
1123810091 15:23916128-23916150 TAAAAAAGGACAGATCCAGCAGG - Intergenic
1124004028 15:25782159-25782181 CACAAAAGGACAACTCTTGCCGG + Intronic
1124057885 15:26259399-26259421 CACAGAAAGACAAATACTGCAGG + Intergenic
1126550089 15:49919395-49919417 AGGAAAAGGAAAAATCATGCAGG - Intronic
1126611603 15:50535236-50535258 CAGAAATGGACAGATCCAGCAGG + Intronic
1127338667 15:58017309-58017331 CATAAATGGACAAATGCTGAAGG + Intronic
1129972392 15:79790171-79790193 CACAAAAGGACAAATATTGTAGG + Intergenic
1130249696 15:82291471-82291493 CAGAAATGGACAGATTCAGCAGG + Intergenic
1130453041 15:84076894-84076916 CAGAAAAGAACAGAGCCAGCTGG + Intergenic
1131029213 15:89172365-89172387 CACAAAAGGACAAATACTGTAGG - Intronic
1131046608 15:89320599-89320621 CACAATAGGACAAATCATCCTGG + Intronic
1131378287 15:91943328-91943350 CACAAAAGGACAGATACTGTAGG - Intronic
1131892674 15:96990066-96990088 CAGAAATGGACAGATCCAGCAGG - Intergenic
1131965875 15:97841662-97841684 CAGAAAAGACCACATACTGCAGG - Intergenic
1132269193 15:100508155-100508177 GAGAAACTGACAAATGCTGCAGG - Intronic
1132723164 16:1327024-1327046 CAGGAAAGGACACACCCGGCAGG - Intergenic
1132753413 16:1469955-1469977 CAGAAAAAGACAGCTCCCGCAGG + Intronic
1133644304 16:7748916-7748938 AAGAAAAAGACAAAACCAGCTGG + Intergenic
1133898883 16:9954568-9954590 TAGAAAAGGACTCATTCTGCAGG - Intronic
1134065599 16:11226023-11226045 AAGGAAAGAACAAAACCTGCTGG + Intergenic
1134228035 16:12407139-12407161 CATGAAAGGCCACATCCTGCGGG + Intronic
1134560560 16:15205777-15205799 CAGAAAAGGACACATTCTTGAGG - Intergenic
1134921097 16:18117392-18117414 CAGAAAAGGACATATTCTTGAGG - Intergenic
1135107952 16:19667298-19667320 CAGAAAGGGTCAGAGCCTGCAGG - Intronic
1135767866 16:25193350-25193372 AAGAAAAGGACAACCCCAGCCGG - Intergenic
1137269174 16:46891740-46891762 AAGACAAGGACAAATGCTGGAGG - Intronic
1137443500 16:48516343-48516365 CAGAAATGGACAGATCCAGCAGG + Intergenic
1138058919 16:53867761-53867783 CAGAAAACGACAGATACAGCAGG - Intronic
1138061696 16:53898167-53898189 GAGGAATGGACAGATCCTGCAGG - Intronic
1138176564 16:54904357-54904379 CAGAAATGGATAGATCCAGCAGG + Intergenic
1138582836 16:57952830-57952852 CAGTATAGGACACATCTTGCAGG - Intronic
1139232710 16:65300813-65300835 TAGAAATGGACAGATCCAGCTGG + Intergenic
1140318062 16:73918793-73918815 CACAAAAGGACAAACCCCACTGG - Intergenic
1141353399 16:83320340-83320362 CTGAAAAGGACAATCCATGCTGG - Intronic
1141996554 16:87639756-87639778 CTGGAAGGGACAAATCCTGTGGG - Intronic
1144870554 17:18367403-18367425 CAGAAACGGACAGATCCAGCAGG - Intergenic
1144963051 17:19057156-19057178 CAGAAACGGACAGATCCAGCAGG - Intergenic
1144972109 17:19117369-19117391 CAGAAACGGACAGATCCAGCAGG + Intergenic
1145271229 17:21405938-21405960 TAGATAAGAACAAATCCAGCTGG + Intronic
1145792784 17:27638256-27638278 CAGAAAAGGGGACAGCCTGCAGG - Exonic
1145807650 17:27746125-27746147 CAGAAAAGGGGACAGCCTGCAGG - Intergenic
1146354666 17:32123969-32123991 CATAAAAAAACAAATCCCGCTGG - Intergenic
1147263486 17:39222225-39222247 CAGGAAAGGACACAGCCTGGAGG - Intronic
1148330560 17:46811571-46811593 CAGAAAAGGAGCAAACCTGCAGG + Intronic
1148438766 17:47701100-47701122 CAGATAAGGAAGAAGCCTGCTGG - Intronic
1150178206 17:63085041-63085063 CAGAAATGGACAGATCCAGCAGG - Intronic
1150194996 17:63288585-63288607 CAGAAATGGACAGATCCAACAGG - Intronic
1150511884 17:65761956-65761978 CATAAATGGACAGATCCAGCAGG - Intronic
1150566379 17:66344721-66344743 CAGATATTGACAAGTCCTGCTGG + Intronic
1150883251 17:69055588-69055610 CAGAAATGGACAGATCCAGCAGG + Intronic
1152765613 17:82136327-82136349 CACAAAGGGACACATCCTGTGGG + Intronic
1152815395 17:82404716-82404738 AAGAAAAGAAAAAATTCTGCTGG - Intronic
1152940247 17:83167132-83167154 CAGAAATGAACAGATCCAGCAGG - Intergenic
1154974782 18:21446501-21446523 CAGGAAAGAACTGATCCTGCAGG - Intronic
1156204883 18:34874583-34874605 AAGAGAAGGACATTTCCTGCAGG + Intronic
1156518588 18:37701881-37701903 CTGAAAGGGAGAAATCCTGGTGG + Intergenic
1156675880 18:39526719-39526741 CAGAAAAGGAAAAAAACTGGAGG + Intergenic
1157268077 18:46246352-46246374 CAGAAAAGGACTAATGGTCCTGG + Intronic
1157310839 18:46551949-46551971 CACAAAAAGACAAATTCTGTAGG + Intronic
1158285653 18:55878671-55878693 GAGAACAGAACAAATTCTGCAGG + Intergenic
1159907620 18:74110985-74111007 CAGAAATTGACAGATCCAGCAGG + Intronic
1160036500 18:75306253-75306275 CACAAAAAGACAAATACTGTAGG - Intergenic
1161749574 19:6084931-6084953 CACAAAAGGACAAATCCAGCCGG - Intronic
1162245510 19:9396658-9396680 CACAAATGGACAGATCCAGCAGG + Intergenic
1163903467 19:20129254-20129276 CAGTAAAGGCCAAGTTCTGCAGG - Intergenic
1163917353 19:20252818-20252840 CAGTAAAGGCCAAAGTCTGCAGG + Intergenic
1163922087 19:20299421-20299443 CAGAAATGAAAAAATCCAGCCGG - Intergenic
1164037946 19:21470259-21470281 AAGAAAAGAAAAAATCCTGGAGG + Intronic
1164239573 19:23372717-23372739 CAGTAAAGGCCAAAGTCTGCAGG - Intronic
1164545218 19:29155010-29155032 TATACAAGGTCAAATCCTGCAGG + Intergenic
1164662962 19:29994513-29994535 CACAAAAGGACAAATGCTGTAGG - Intronic
1164871703 19:31650953-31650975 CACAATAGGACAAATGTTGCAGG + Intergenic
1165720525 19:38075794-38075816 CAGAAAAGAAAAGATCTTGCAGG + Intronic
1165984993 19:39760438-39760460 CACAGAAGGACAAATACTGCAGG + Intergenic
1166222067 19:41371778-41371800 CATAAGAGGACAAATACTGTAGG - Intronic
1166951836 19:46433961-46433983 CAGCAAAGAACAAATGCTGGTGG - Intergenic
1168572141 19:57480140-57480162 CAAAACAGGAAAAGTCCTGCTGG + Intergenic
925038348 2:709435-709457 CACAAAAAGACAAACGCTGCAGG - Intergenic
925091652 2:1161394-1161416 CAGAAAAGGGGAAAGCCTCCAGG + Intronic
925772294 2:7294672-7294694 CATTAAAGGACAAATTCTGTAGG + Intergenic
926262536 2:11279606-11279628 CAGAAATGGACAGATCCAGCAGG + Intronic
927223881 2:20742362-20742384 CAGAAATGGACAGATCCAGCAGG - Intronic
927824077 2:26295298-26295320 CACAAAAGGACAAATTCTGTAGG + Intergenic
929975349 2:46628404-46628426 CAGAATTAGAAAAATCCTGCCGG - Intergenic
930042570 2:47139158-47139180 CAGAAATGGACAAATACAGCAGG - Intronic
930789810 2:55313491-55313513 TAGAAAAGGCCCAATGCTGCTGG - Intronic
931189064 2:59982205-59982227 GAGAAAAGAACAAATCCTGTGGG + Intergenic
931738533 2:65220783-65220805 CAGAACATGAGAAATCCTACAGG + Intergenic
931971820 2:67595354-67595376 CATAAATGGACAAATCCAGCAGG - Intergenic
933248032 2:79997468-79997490 CAGAAACAGAAAAATCCTGCAGG - Intronic
933376850 2:81490703-81490725 CAGAAAAGTCCAAATCATCCTGG - Intergenic
933444379 2:82359879-82359901 CACAGAAAGACAAATACTGCAGG - Intergenic
935671115 2:105557881-105557903 TAGAAATAGACAAATCCAGCTGG + Intergenic
935750575 2:106230000-106230022 CAGAAATGGACAGATCCAGCAGG - Intergenic
935914384 2:107933638-107933660 AAGATAAGGACAAATCTTACAGG + Intergenic
937398301 2:121558328-121558350 CAGAAAAAAAGAAATCCTCCAGG + Intronic
938177332 2:129145525-129145547 CACAGAAAGACAAATACTGCAGG - Intergenic
938718345 2:134041474-134041496 CAGAAATGGATCAATCCAGCAGG + Intergenic
940732285 2:157406665-157406687 CAGAAATGGACAAATATAGCAGG - Intergenic
941308512 2:163899864-163899886 CACAAAAGTACAAAACTTGCTGG + Intergenic
941687846 2:168465629-168465651 CACAAAAAGACAAATACTGTAGG + Intronic
942011726 2:171769827-171769849 CAGAAAAGGACAGATCCAGCAGG + Intergenic
942109647 2:172667534-172667556 CTGGGAAGGACAAATCCTCCAGG + Intergenic
942755510 2:179336988-179337010 AAGCAATGGACAAATCCTTCAGG + Intergenic
943458293 2:188136298-188136320 AAGAAAAGAAAAAAACCTGCAGG + Intergenic
944368151 2:198948948-198948970 CAGGAAAGATCAAATTCTGCAGG - Intergenic
944432958 2:199655724-199655746 CAGAAATGAACAGATCCAGCAGG - Intergenic
945644560 2:212474603-212474625 AAGACAAGGACAAAACCTTCAGG - Intronic
946148224 2:217746970-217746992 CAGAAAAGGACCCACCCTCCAGG + Intronic
946509333 2:220337330-220337352 TAAAAAAAAACAAATCCTGCTGG + Intergenic
946701919 2:222423615-222423637 TAGCAAAGGAAACATCCTGCAGG - Intergenic
946870279 2:224078640-224078662 CAGATAGGGACAAATCTTGCGGG + Intergenic
947265975 2:228281942-228281964 CATAAAAAGACAAATACTGTAGG + Intergenic
947951011 2:234147259-234147281 AAAAAAAAAACAAATCCTGCAGG + Intergenic
948180462 2:235975742-235975764 AAGAAAAGGAGAAAACCTGAGGG - Intronic
948410055 2:237752405-237752427 CAAAAAAGAAAAAATGCTGCTGG + Intronic
948567471 2:238896082-238896104 CTGAGAAGGAGGAATCCTGCTGG - Intronic
1168905954 20:1404056-1404078 TATAAAAGAACTAATCCTGCTGG + Intergenic
1169290499 20:4346610-4346632 TAGAAATGGACATATCCAGCAGG - Intergenic
1169975279 20:11318839-11318861 CAAAGAAGGACAAATACTGCAGG + Intergenic
1170098661 20:12674781-12674803 CAGAAAAGAGCAAAGCCAGCCGG + Intergenic
1170238760 20:14138498-14138520 CACATAAGGACAAATACTGCAGG + Intronic
1170834895 20:19875756-19875778 CACCAAAGGACACATTCTGCTGG - Intergenic
1171017217 20:21552932-21552954 GACAAAAGGACAAATCCTGTAGG - Intergenic
1173088289 20:39945843-39945865 GGGAAAAGAACAAATTCTGCAGG + Intergenic
1174642795 20:52059669-52059691 CAGAGAAGGAAAAAACCAGCAGG + Intronic
1175289379 20:57864449-57864471 CAGAAATGGACAGATCTAGCAGG - Intergenic
1177031562 21:15986294-15986316 AAGAAAAGGCCACATACTGCTGG - Intergenic
1177205706 21:18008593-18008615 CCACAAAGGACAAATACTGCAGG - Intronic
1177363667 21:20105188-20105210 CGGAAAAGAACTACTCCTGCCGG + Intergenic
1179531247 21:42021069-42021091 CACAGTGGGACAAATCCTGCAGG + Intergenic
1179589802 21:42399309-42399331 CGGAGAAAGACAAATACTGCAGG + Intergenic
1179626320 21:42651490-42651512 CTAAAAAAGAAAAATCCTGCGGG - Intergenic
1180059380 21:45376697-45376719 CAGGAGAGGACCAATCTTGCTGG - Intergenic
1181414718 22:22751024-22751046 AAGGAAAGGAGAAATTCTGCAGG - Intronic
1181724887 22:24804852-24804874 AAGAAAAGGACAGACCATGCTGG - Intergenic
1183262971 22:36807874-36807896 CAGAAAAGGCAAATTCCTTCAGG + Intronic
1184397787 22:44254900-44254922 CTGACAAGGGCAAATTCTGCAGG - Intronic
1184809640 22:46822661-46822683 CTATAAAGGACAGATCCTGCTGG - Intronic
1185359248 22:50395504-50395526 CGGAAAAGGACATGACCTGCAGG - Intronic
950480343 3:13239777-13239799 CACAGAAGGACGAAGCCTGCAGG + Intergenic
950484107 3:13262807-13262829 CACAAAAGAACAAATATTGCAGG + Intergenic
951321101 3:21246716-21246738 CAGAAATGGACAGATCCAGAGGG - Intergenic
951956051 3:28255172-28255194 GAGAAAAGGACAAATTCAGAGGG - Intronic
952426683 3:33182485-33182507 CAGAAATGGACAGATCTGGCAGG - Intronic
952947837 3:38492108-38492130 CAGCAAAGGACAAAATTTGCAGG + Exonic
953659399 3:44880590-44880612 CAGCAAAGGGAAAAGCCTGCTGG + Intronic
953873710 3:46650610-46650632 AAGAAATGGACAAATCCAGCAGG + Intergenic
954585356 3:51730764-51730786 CTGAAATGGACAAAACCAGCAGG - Intergenic
955913853 3:63886147-63886169 CACAGAAAGACAAATACTGCAGG + Intronic
956075471 3:65500613-65500635 CAGAAAAAGAAAAATCCTACTGG + Intronic
959174800 3:102893627-102893649 CATAGAAAGACAAATACTGCAGG + Intergenic
960115610 3:113889320-113889342 CATAAAAGAACACATCCTGTAGG + Intronic
960845834 3:122003888-122003910 CAGATAAGAACAAATTCTGCTGG + Intronic
961002352 3:123382667-123382689 CACAAAAGGACAAATATTGTGGG + Intronic
963573996 3:147036023-147036045 CAGAAATGGACAGATACAGCAGG + Intergenic
963841350 3:150110439-150110461 CAGAAGTGGACAAATCCAGCAGG - Intergenic
964917666 3:161855667-161855689 CAGAAATGGACAGATTCTGTGGG + Intergenic
968346009 3:198009198-198009220 CAGAAATGGACAGATGCAGCAGG - Intronic
968534987 4:1119426-1119448 CAGAAATGGACAGATCCTGCAGG + Intergenic
968575816 4:1365663-1365685 CAGAAAGGGACAAGTACTTCTGG - Intronic
968673783 4:1866100-1866122 CAGGACAGAACAAAGCCTGCTGG - Intergenic
968792345 4:2675318-2675340 CAGAAATGAACAGATCCAGCAGG - Intronic
968943313 4:3650681-3650703 CACAAAAGGACAAATCCTGTAGG - Intergenic
969371865 4:6736668-6736690 CACAAAAGAACAAATACTGCAGG - Intergenic
969414336 4:7048813-7048835 CAGAAAAGGACAAATCCTGCAGG - Intronic
970871657 4:20823270-20823292 GGGAAAAGGCCAAATCCTGAAGG + Intronic
971562020 4:28090705-28090727 CAGCAAAGGACCAAACATGCTGG + Intergenic
973948396 4:55984959-55984981 TATAAAAGGACAAAACCAGCAGG - Intronic
974281636 4:59802703-59802725 TACAAAAGGACATAACCTGCTGG - Intergenic
974369587 4:60998345-60998367 CAGACAAGAACAAATGCTGGAGG - Intergenic
974473735 4:62353498-62353520 AAGAAAAAGATAAATCCGGCCGG + Intergenic
974677883 4:65118715-65118737 CACAAAAGGGCAAATACTGTAGG - Intergenic
975651578 4:76598665-76598687 CAGAAAAAGACACCTCCTCCAGG - Intronic
976110977 4:81673518-81673540 CAGGTAATGACAAATGCTGCTGG + Intronic
977247620 4:94651912-94651934 CATAAAAGGAATAATCCTGCGGG + Intronic
977608614 4:99009515-99009537 CAGAAAAGAACAAATGTTGGTGG - Intronic
977822247 4:101487028-101487050 CAGAAATGGACAAATCCAGGAGG - Intronic
978658161 4:111091365-111091387 CAGAAATGAACAGATCCAGCAGG + Intergenic
981529677 4:145740119-145740141 CAGAAAAGAAGAAATGCTGATGG - Intronic
981673570 4:147315020-147315042 GAGAAAAGGACTAATCCAGGGGG - Intergenic
982519990 4:156404332-156404354 CACAGAAGGACAAATTCTACAGG + Intergenic
982933205 4:161435598-161435620 CAAAAAAGGACAAATGCTTGAGG + Intronic
983937549 4:173512710-173512732 GAGAAAAGGACACATCTTGTAGG - Intergenic
983938446 4:173518867-173518889 CAGAAAAGGAGAGATGCTGGCGG - Intergenic
983980605 4:173991175-173991197 CAGCAAAAGACAAATTCTCCTGG + Intergenic
984405023 4:179317945-179317967 CAGAAATGGACAGATTCAGCAGG - Intergenic
984606913 4:181796334-181796356 AAGAAAGGGACACATACTGCTGG + Intergenic
985081469 4:186269494-186269516 CACAAAAGAACAAATACTGTGGG + Intronic
985204376 4:187518944-187518966 AAGAAAATGAAAAATCCAGCTGG + Intergenic
985308299 4:188568449-188568471 CACAAATGGACAGAACCTGCAGG - Intergenic
986059318 5:4173089-4173111 CAGAAAAAGACAACTTCTGACGG + Intergenic
986156151 5:5178300-5178322 CAGAAAAGGCCAAGTCCTTCAGG - Intronic
986196326 5:5539401-5539423 AAGGCAAGGACAAAGCCTGCTGG - Intergenic
986331246 5:6717437-6717459 CAGAAAAGGACAAACAGTGAGGG - Intronic
986739646 5:10694839-10694861 CAGGAAAGCACAGAGCCTGCAGG + Intronic
987481162 5:18459565-18459587 CTGAAAAGGATGAGTCCTGCTGG - Intergenic
987921495 5:24287312-24287334 CTGAAAAGGACAATACTTGCTGG - Intergenic
989453053 5:41609410-41609432 CAGAAAAGAACAAAGCCTCCAGG - Intergenic
990202142 5:53387692-53387714 CAGAAATGAACAGATCCAGCAGG + Intergenic
990244086 5:53845942-53845964 CAGAAATGGACAGATTCAGCAGG + Intergenic
990297171 5:54413996-54414018 AAGAAATGGACAGATCCAGCAGG + Intergenic
990327019 5:54687760-54687782 TAGAAATGGACAGATCCAGCAGG - Intergenic
990570936 5:57077941-57077963 CAGAAATGGACAGATCCAGTAGG - Intergenic
990604237 5:57392688-57392710 CAGAAATGGACAGATCCAGCAGG - Intergenic
991170383 5:63617527-63617549 CTGAAAAGGAAGAATCATGCTGG - Intergenic
993093577 5:83456996-83457018 CACAGAAAGACAAATACTGCAGG + Intergenic
994861154 5:105196892-105196914 CAGAAAAGTGAAAATCCTGGGGG - Intergenic
994926403 5:106121943-106121965 CAGAAAAGCACATTTCCAGCTGG + Intergenic
995480927 5:112591986-112592008 CAGAAAAGGACACATACAGACGG - Intergenic
995863766 5:116668592-116668614 CATAAAAGCAAAATTCCTGCAGG - Intergenic
996233553 5:121097855-121097877 CAGAAATGGACAGATTCAGCAGG + Intergenic
996338209 5:122407990-122408012 CAGAAAAGGACAGTCCCTCCTGG + Intronic
996433517 5:123407650-123407672 CAGAAATGGACAGATCCAGCAGG + Intronic
996667573 5:126077798-126077820 CAGAAATGGAGAAATCCCCCAGG - Intergenic
996776561 5:127138675-127138697 CAGAAACGGACAGATCTAGCAGG + Intergenic
997176569 5:131784145-131784167 CAAAAAAGGACATATCCAGGAGG + Intronic
997298997 5:132788708-132788730 CAGATAAGAACAAATTCTACAGG - Intronic
997460335 5:134047454-134047476 CAGAAAAGGACCATTCCTATGGG + Intergenic
999565018 5:152849573-152849595 CAGAAATGGACAGATCTAGCAGG - Intergenic
999684758 5:154092218-154092240 CAGAAAAGGTCAGATTCTGGAGG - Intronic
999848093 5:155507406-155507428 CTGAAAAGGACAGATGCTGATGG - Intergenic
999943481 5:156569839-156569861 CAGAAAGAGGCCAATCCTGCTGG + Intronic
1001094711 5:168767313-168767335 CAGAATAGGACAAAGACTCCAGG + Intronic
1001128607 5:169044481-169044503 CATAAAAGGCCACATACTGCAGG + Intronic
1001316600 5:170645547-170645569 CAGAAATGGACAGATCCAGCAGG + Intronic
1002146994 5:177191969-177191991 CGGATCAGAACAAATCCTGCAGG - Exonic
1002689396 5:181039851-181039873 CAGTAAGGAACAAATCCTGGGGG - Intergenic
1002788258 6:419954-419976 CACAGAAGGACAAATACTGCAGG - Intergenic
1003010728 6:2424730-2424752 CATGAAAGGACAAATACTGTAGG - Intergenic
1003465086 6:6371568-6371590 AAGAAATGAACAAAGCCTGCAGG + Intergenic
1004574348 6:16880054-16880076 CAGAAATGGACAGATCCATCAGG - Intergenic
1004792934 6:19048920-19048942 CAGAAATAGAGAAATCCAGCAGG - Intergenic
1005129042 6:22482469-22482491 CAGAAATGGACAGATCCAACAGG + Intergenic
1005200404 6:23338178-23338200 CAGAAAAGGACAAAAACTCACGG - Intergenic
1006307467 6:33232404-33232426 CAGAAGAGGCCAAATCCTGGAGG + Intergenic
1006735813 6:36271683-36271705 CTGAAAAGGAGAATTCCTGGTGG + Intronic
1009388158 6:63111753-63111775 CAGCAAATGATGAATCCTGCAGG + Intergenic
1010079539 6:71844138-71844160 TAGAAATGGACAGATCCAGCAGG - Intergenic
1010556870 6:77292895-77292917 CATAAAAGAACAAATTTTGCTGG - Intergenic
1011665682 6:89630542-89630564 CAGAAGACGACAGCTCCTGCTGG - Exonic
1013720530 6:113021450-113021472 CAGAAATGGACAGATCCAACAGG + Intergenic
1013754159 6:113441474-113441496 CAGAAAAGAACATGTTCTGCTGG - Intergenic
1016054495 6:139565426-139565448 CAGCAGGGGGCAAATCCTGCTGG + Intergenic
1016447577 6:144149770-144149792 CAAAAAAGGAAAAATCGGGCCGG - Intergenic
1016715323 6:147220439-147220461 CAGAAATGGACAGATCCAGCAGG - Intronic
1017660934 6:156671935-156671957 CAGAAATGGACAGATCCAACAGG + Intergenic
1017663289 6:156694758-156694780 CACAGAAGGACAAATACTGTGGG + Intergenic
1018100212 6:160431437-160431459 CATTTAAGGACAAATCCAGCTGG - Intronic
1018526541 6:164716571-164716593 CAGAAATGGACAGAGCCAGCAGG + Intergenic
1018652589 6:166004625-166004647 CACAGAAGGACAAACCCTGCAGG - Intergenic
1018884252 6:167919596-167919618 CAGAAAAGCACACAACATGCTGG - Intronic
1019627227 7:2023113-2023135 CAGAAACGGACAGATCCCGCAGG + Intronic
1019902479 7:4032790-4032812 AAGAAAAGTACAAATGCTGCTGG + Intronic
1020230464 7:6314497-6314519 CATAAAAGGACAAATATTGTAGG - Intergenic
1020495765 7:8851546-8851568 CAGATTAGGACACATCCTACTGG - Intergenic
1020562626 7:9748925-9748947 CAGAAAGGGACAGATCCAGCAGG - Intergenic
1020587956 7:10095358-10095380 CAGAAATGGAGAGATCCAGCAGG - Intergenic
1022011315 7:26310255-26310277 CAGAAATGGAGAAAACCAGCTGG + Intronic
1022084481 7:27053271-27053293 CAGAAAAGCAAGAGTCCTGCTGG + Intergenic
1022481043 7:30743355-30743377 CAGGGAAGGACAAATACTGTAGG - Intronic
1022841418 7:34167765-34167787 CACAGAAGGACAAATCCTCGTGG + Intergenic
1023085946 7:36570256-36570278 CACAGAAGGACGAATACTGCCGG - Intronic
1023210751 7:37802504-37802526 CAGAAATGAACAGATCCAGCAGG - Intronic
1023352563 7:39334937-39334959 CAGTTAGGGACAAATCCAGCTGG + Intronic
1023553676 7:41397578-41397600 CAGAAAGGTACAAATCTAGCAGG - Intergenic
1023877994 7:44300706-44300728 CAGAAATGGACAGATGCAGCAGG + Intronic
1024533674 7:50412787-50412809 CAGAAATGGACAGATCCAGCAGG + Intergenic
1025773966 7:64541829-64541851 CAGTAAAGGACAAGGTCTGCAGG - Intronic
1028383335 7:90224048-90224070 CAGCAAATCACAAATGCTGCTGG - Intronic
1028399775 7:90412608-90412630 CACAAGAGGACAAATCATGAGGG - Intronic
1028769883 7:94606553-94606575 CAGAAATGGACACAACCAGCAGG + Intronic
1028926794 7:96366637-96366659 CAGAAATGGACAGATCCAACAGG - Intergenic
1029705185 7:102272368-102272390 CAGAAATGCACAAAGGCTGCAGG - Intronic
1029781182 7:102735530-102735552 CAGAAATGGACAGATTCAGCAGG - Intergenic
1030707167 7:112705149-112705171 CAGAAATGGACAGATCCAACAGG + Intergenic
1031329330 7:120444417-120444439 AAGAAAAAGACAAATCTAGCTGG - Intronic
1032275724 7:130453554-130453576 AAGAAGAGGAAAAACCCTGCGGG - Intergenic
1032327805 7:130948316-130948338 CACAAAAGGACAAATACTGTAGG + Intergenic
1032476206 7:132213145-132213167 CACAAAATGGCAAATACTGCAGG + Intronic
1032625557 7:133588008-133588030 CAGAAAATGTCAAATCCTCAAGG - Intronic
1033068465 7:138179276-138179298 CAGTAACTGACAAATCCAGCAGG + Intergenic
1033157482 7:138969375-138969397 CATGAAAGGACAAATACTGTAGG - Intronic
1035440877 7:158898301-158898323 CAGAAATGGACAAATCCAACAGG - Intronic
1035567875 8:653766-653788 CACAGAAGGACGAATCCCGCAGG + Intronic
1035567906 8:653939-653961 CACAGAAGGACAAATCCCGCAGG + Intronic
1036775653 8:11611089-11611111 CAGAGAAAGACAAATATTGCAGG + Intergenic
1037622400 8:20576317-20576339 CACAGAAGGACAAATACTGTAGG - Intergenic
1038523953 8:28257361-28257383 GAGAGAAGGCCAAATCCAGCAGG + Intergenic
1039735692 8:40329998-40330020 CAGCCTAGGACTAATCCTGCAGG + Intergenic
1041305534 8:56454121-56454143 CAGCAATGGACAGATCCAGCAGG + Intergenic
1041334635 8:56767601-56767623 CAGAAATGGACAGATCCAGTAGG - Intergenic
1041892453 8:62885546-62885568 CAGAAATGGACAGATCCAGCAGG - Intronic
1042785118 8:72537483-72537505 CAGAAGAGGAAAAATCGAGCGGG - Exonic
1042972405 8:74424417-74424439 CATTAAAGGACAAATCTTGGAGG - Intronic
1043088625 8:75869746-75869768 CTGAAAAGGACAAATAAAGCAGG - Intergenic
1043412824 8:80016876-80016898 CAGAAAAGGACAGATCCAGCAGG + Intronic
1045728346 8:105202704-105202726 CAGAAATGGACAGATCCAGCAGG - Intronic
1046443915 8:114290318-114290340 CAGAAATGGACAGATCCAGTAGG - Intergenic
1046500552 8:115070874-115070896 CAGAAAAAGAGCAATACTGCGGG - Intergenic
1046768717 8:118097903-118097925 CAGACAAGGCCAAATTCTCCTGG - Intronic
1046859277 8:119071928-119071950 CAAAAAAGGACTACTCCTGGGGG + Intronic
1046959168 8:120091972-120091994 CACAAACGGACTAATCCAGCAGG + Intronic
1048510995 8:135062421-135062443 CAGAACAGGACAAAGTATGCAGG + Intergenic
1049029824 8:140026094-140026116 CACAAAAGGACAAGTACTGTAGG - Intronic
1049568218 8:143354296-143354318 CACAAAAGGAAAAATACTGCAGG + Intronic
1049807027 8:144545811-144545833 CTGAGAAGGACAAATGCGGCTGG + Intronic
1050015791 9:1232517-1232539 CAGTAACTGACAAATCCTGCTGG + Intergenic
1050111876 9:2225375-2225397 CAGAAATGACCAGATCCTGCAGG - Intergenic
1050695382 9:8274259-8274281 CAGGAATGGACAAATCCAGTGGG - Intergenic
1051723551 9:20065160-20065182 CAGAAAAGGACAGATTGGGCAGG + Intergenic
1051945391 9:22563383-22563405 CACAGAAGGACAAATATTGCGGG + Intergenic
1052566131 9:30154288-30154310 CAGAAATGGACAAATCTAGTGGG - Intergenic
1052733633 9:32318309-32318331 CAGACAAAGGCAAAGCCTGCAGG + Intergenic
1053045582 9:34913876-34913898 CACAAAAGGACAAAGCCTAAAGG - Intergenic
1053317311 9:37063015-37063037 CACAAAAGGACAAATACGGTCGG + Intergenic
1054963386 9:70994624-70994646 CAGAAAGGGAAAAATACTGAAGG - Intronic
1054974313 9:71124062-71124084 GAGAAAAGCACAAAACCTTCAGG + Intronic
1055144060 9:72911602-72911624 CATAAAAAGACAAATACCGCAGG - Intronic
1055398882 9:75901917-75901939 TAGAAAAGGACAAAACAGGCTGG + Intronic
1055727625 9:79248695-79248717 GAGAAAAGAAAAAATCCGGCCGG + Intergenic
1055855781 9:80686280-80686302 CAGAAATGTACAAATCAAGCAGG + Intergenic
1056380818 9:86055689-86055711 CACAGAAGGACAAATGCTGTAGG + Intronic
1057375891 9:94522529-94522551 CAGAAATGGACAGATGCAGCAGG - Intergenic
1057715266 9:97489207-97489229 CAGAAATGGACAGATCCAGAAGG - Intronic
1058884193 9:109310935-109310957 CACAAATGGACAAATACTGTAGG + Intronic
1058971256 9:110085176-110085198 CAGAAAACAACAATTCCTACGGG - Intronic
1059137214 9:111818624-111818646 TGCAAAAGGACAAATCCTGTAGG + Intergenic
1059915769 9:119098284-119098306 CACAGAAAGATAAATCCTGCAGG + Intergenic
1060703380 9:125779151-125779173 CACAAAAGGACAAATATTGTAGG - Intronic
1061083091 9:128383837-128383859 CAGAATAGGACAAGTCCACCGGG + Intronic
1061503330 9:131016146-131016168 CAAAAAAGAACAAATACTGTAGG + Intronic
1061757476 9:132825095-132825117 CTGAAAAGCACAAATACTACAGG + Intronic
1062473393 9:136716047-136716069 CACCAAAGCACAAATCCTGCAGG - Intronic
1186477011 X:9865527-9865549 CAGGAAAGGATAAATCCTTAGGG - Intronic
1187135649 X:16544720-16544742 AAGAAAAGGAAAAATTCTTCAGG + Intergenic
1187310795 X:18140015-18140037 CAGAAATGGACAGATCCAGCAGG + Intergenic
1187330806 X:18337693-18337715 CAGAAATGGACAGATCTAGCAGG + Intronic
1187949575 X:24458561-24458583 CTGAAAAAGCCACATCCTGCAGG + Intergenic
1189085851 X:38022981-38023003 CAGCAAGGGACAAATCATGAAGG + Intronic
1189328054 X:40125067-40125089 CAGAACAGGACAAAGCAGGCTGG - Intronic
1189717377 X:43880761-43880783 CAGAAAGGGACAAATCATGAAGG + Intronic
1190269190 X:48849336-48849358 CAAAAAAAGACAAATACTGCAGG - Intergenic
1190447333 X:50539909-50539931 AATAAAAGGACAAAGCTTGCAGG + Intergenic
1192187977 X:68967457-68967479 CAGAAATGGACAGATTCAGCAGG - Intergenic
1192572337 X:72216760-72216782 CACAAAAGGACAAATACTTTGGG - Intronic
1193178445 X:78423383-78423405 CAGCAATGGACAGATCATGCAGG + Intergenic
1193562451 X:83035353-83035375 CAGCAAAGGACAAATTCTCCAGG + Intergenic
1193630502 X:83880936-83880958 CAGAAAATGATAATTCCTCCTGG - Intronic
1194027132 X:88766195-88766217 CAGCAAAGGACAAATCATCCTGG + Intergenic
1194184304 X:90753780-90753802 CAGAAATGAACAGATCCAGCAGG + Intergenic
1195699683 X:107694394-107694416 CAGAAATGGACAGATCCAGTAGG - Intergenic
1195897847 X:109766066-109766088 CAGAAATGGACACATACAGCAGG + Intergenic
1196155825 X:112428717-112428739 TAGAAAAGGACAGACCTTGCAGG - Intergenic
1196852889 X:119955481-119955503 CAGTAATTGACAAATCCAGCAGG - Intergenic
1197084868 X:122460186-122460208 TAGAAAAGGCCAAGCCCTGCAGG + Intergenic
1197765704 X:130058294-130058316 AAGAAAGGGGCAAATCCTGGGGG + Intergenic
1197997129 X:132389646-132389668 CAGTAAAGGACAAAACCCACAGG - Intronic
1198489888 X:137128847-137128869 CAGAAATGAACAGATCCAGCAGG + Intergenic
1199010361 X:142750970-142750992 CACAGAAAGACAAATACTGCAGG - Intergenic
1199110247 X:143923964-143923986 CAGAAATAGACAGATTCTGCAGG + Intergenic
1199808843 X:151329079-151329101 CACAAAAGGACAAATACTGTAGG + Intergenic
1200006099 X:153085364-153085386 CACAAAAGGACAAATAGTGTAGG - Intergenic
1200223870 X:154405888-154405910 CACAAAAAGACAAATACTGTAGG - Intronic
1200530894 Y:4335707-4335729 CAGAAATGAACAGATCCAGCAGG + Intergenic
1200751064 Y:6944651-6944673 CACAAAAAGATAAATACTGCAGG - Intronic
1201335601 Y:12877796-12877818 CACAAAAAGACAAATACTGCAGG + Intergenic
1201541445 Y:15109461-15109483 AAGAAATGAACAAAGCCTGCAGG - Intergenic
1201780986 Y:17722585-17722607 CAGCAAAGGACACAACCAGCTGG - Intergenic
1201820567 Y:18183405-18183427 CAGCAAAGGACACAACCAGCTGG + Intergenic