ID: 969416986

View in Genome Browser
Species Human (GRCh38)
Location 4:7067518-7067540
Sequence TGCCCAGGGCACACCCGGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 1, 2: 2, 3: 34, 4: 294}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969416979_969416986 19 Left 969416979 4:7067476-7067498 CCGGCCTCGAGCTGCGGCACGGA 0: 1
1: 0
2: 0
3: 3
4: 65
Right 969416986 4:7067518-7067540 TGCCCAGGGCACACCCGGCCCGG 0: 1
1: 1
2: 2
3: 34
4: 294
969416980_969416986 15 Left 969416980 4:7067480-7067502 CCTCGAGCTGCGGCACGGAAATG 0: 1
1: 0
2: 0
3: 3
4: 35
Right 969416986 4:7067518-7067540 TGCCCAGGGCACACCCGGCCCGG 0: 1
1: 1
2: 2
3: 34
4: 294
969416974_969416986 30 Left 969416974 4:7067465-7067487 CCGCTGTGGCCCCGGCCTCGAGC 0: 1
1: 0
2: 1
3: 32
4: 248
Right 969416986 4:7067518-7067540 TGCCCAGGGCACACCCGGCCCGG 0: 1
1: 1
2: 2
3: 34
4: 294
969416976_969416986 21 Left 969416976 4:7067474-7067496 CCCCGGCCTCGAGCTGCGGCACG 0: 1
1: 0
2: 1
3: 8
4: 74
Right 969416986 4:7067518-7067540 TGCCCAGGGCACACCCGGCCCGG 0: 1
1: 1
2: 2
3: 34
4: 294
969416977_969416986 20 Left 969416977 4:7067475-7067497 CCCGGCCTCGAGCTGCGGCACGG 0: 1
1: 0
2: 1
3: 12
4: 107
Right 969416986 4:7067518-7067540 TGCCCAGGGCACACCCGGCCCGG 0: 1
1: 1
2: 2
3: 34
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969416986 Original CRISPR TGCCCAGGGCACACCCGGCC CGG Intronic
900162866 1:1232560-1232582 TGCCGTGGGCACGGCCGGCCTGG + Exonic
900318088 1:2069346-2069368 TGCCCAGGACCCTCCCTGCCAGG - Intronic
900427734 1:2588127-2588149 ATCCCTGGGCACACCCAGCCTGG + Intronic
900495505 1:2974259-2974281 AGCCCAGGGTACACGCTGCCTGG + Intergenic
900549629 1:3247754-3247776 CGCCCAGGGCGCACCAGGACGGG - Intronic
900661965 1:3789255-3789277 AGCCCAGGGCACAGCCTGCCTGG + Intronic
901084695 1:6603189-6603211 TGCCCACGACCCACCCGGCCCGG + Intronic
902231029 1:15027749-15027771 TGTCCAGGGTACACCCAGGCTGG + Intronic
902282101 1:15382206-15382228 TGCCCAGGGCAGAACCTCCCAGG + Intronic
902565444 1:17308267-17308289 TGCCCAGCACACACACGGCATGG - Exonic
903281604 1:22253131-22253153 CACCCAGGGCACCCCCGGCCAGG - Intergenic
905105749 1:35562599-35562621 ACCCCAGGGCCCACCTGGCCAGG + Exonic
905442658 1:38005198-38005220 TGCCCGGGGCACGCCGAGCCCGG - Intronic
905485390 1:38292434-38292456 TGCCCAGGGCTCCCCAGGCTGGG - Intergenic
907112355 1:51937397-51937419 TGCCCAGGACACAGCTGGGCAGG - Exonic
912710203 1:111944515-111944537 TGCCCAGGGCATGGCTGGCCGGG - Intronic
915168771 1:153963434-153963456 TGCCCAGGCCTCCCCGGGCCCGG - Exonic
919578095 1:199336996-199337018 TGCTCAGGTCAGACCAGGCCAGG - Intergenic
922155416 1:223037074-223037096 TGCCCAGGGCCCAACAGACCAGG + Intergenic
922792345 1:228317326-228317348 TGCCCAGAGCCCACCCAGCATGG - Intronic
1062855257 10:776953-776975 GGCCCATGGCAGCCCCGGCCCGG + Intergenic
1063162106 10:3425941-3425963 TGCCCAGCTCAGACCCTGCCAGG - Intergenic
1066435177 10:35391164-35391186 TGGCCAGAGCACACCTGGACAGG + Intronic
1067067176 10:43110724-43110746 TGACCAGGGGACACCAGGGCAGG + Intronic
1067222215 10:44352522-44352544 TGCCCAAGCCACAGCTGGCCAGG - Intergenic
1067332470 10:45334553-45334575 TTCCCAGGCCGCACCCTGCCGGG - Intergenic
1067462154 10:46465877-46465899 TGCCCAGGGGGCACCAGGCGCGG + Exonic
1067625041 10:47918721-47918743 TGCCCAGGGGGCACCAGGCGCGG - Intergenic
1067755376 10:49000789-49000811 TGGGCAGGGCACACGAGGCCTGG + Intergenic
1071599852 10:86953799-86953821 TGCCCCAGGCACGCCTGGCCTGG + Intronic
1072555536 10:96511809-96511831 TCCCCAGGTCACACCCAGCAGGG + Intronic
1072750069 10:97972109-97972131 TGCCCAGAGAAAACCCAGCCTGG + Intronic
1075666504 10:124234320-124234342 TGCACAGGTCACCCACGGCCGGG - Intergenic
1075799620 10:125145329-125145351 TCCCCAAGGCACCCCTGGCCAGG - Intronic
1076343922 10:129767710-129767732 TGCCCAGAGCACACTAGGCCAGG - Exonic
1077239662 11:1503902-1503924 GGCCAAGGGCGCACCCGGCTGGG + Intergenic
1077297069 11:1831382-1831404 TGCCCAGGGCAGCCCCCGCCCGG + Intronic
1077382185 11:2249331-2249353 CCCCCAGGGCACACACGTCCCGG - Intergenic
1077385841 11:2269173-2269195 GGCCCGGGGCAGACCCCGCCCGG + Intronic
1077414360 11:2417949-2417971 TGCCCACCGCCCACCGGGCCCGG + Intronic
1077550200 11:3196806-3196828 TTCCCAGGGCACACAGTGCCTGG - Intergenic
1078128682 11:8594006-8594028 GGCCCGGGGCGCAGCCGGCCAGG - Intronic
1078429764 11:11280132-11280154 ACCCCAGGGCACCCCCCGCCCGG + Intronic
1080709624 11:34734361-34734383 TGCCATGGGCACACCTGGCAGGG + Intergenic
1083475186 11:62910677-62910699 TGCCAAGCGCACACCCCGCCGGG - Exonic
1083766424 11:64843613-64843635 TTCCCTGGTCACACCCTGCCGGG - Intronic
1083780117 11:64913425-64913447 TGCCCTGGCCACCCCAGGCCTGG + Intronic
1084113780 11:67030184-67030206 TGCCCAGGGCAAACCCCTCCTGG + Intronic
1084209675 11:67615214-67615236 CGCCCAGGTCAGACCTGGCCAGG + Intergenic
1084296206 11:68214389-68214411 CGCGCAGGGCACACCCGGAGTGG - Intergenic
1084432131 11:69116956-69116978 TGCCCTGGGCAGCCCAGGCCTGG - Intergenic
1084455063 11:69263710-69263732 AGACCAGGGCACTCCTGGCCTGG + Intergenic
1084608034 11:70183959-70183981 TGCCCAGGGGACACACAGCAAGG + Intronic
1088687387 11:112296420-112296442 TGCCCAAGGAACACATGGCCAGG - Intergenic
1089153610 11:116384374-116384396 TGCCCAGGGCACACATGGAAAGG - Intergenic
1089317546 11:117602263-117602285 GGCCCTGGGCACACGTGGCCTGG + Intronic
1091042818 11:132297793-132297815 AGCCCAGGACACACACGGCTTGG - Intronic
1091658082 12:2360344-2360366 AGCCCAGGCCACACCTGCCCTGG + Intronic
1096149123 12:49297625-49297647 TGCCCAGGCCCCGCCCTGCCCGG - Intronic
1096173980 12:49499356-49499378 TCCCCAGAGCTCACCAGGCCAGG - Intronic
1101813654 12:108129440-108129462 TGCCCTGCGCGCACCGGGCCCGG + Intergenic
1101910070 12:108854830-108854852 GGACCAGGGCAGAACCGGCCTGG + Intronic
1103847969 12:123912489-123912511 TGCCCAGGACAGACCCCCCCAGG - Intronic
1103949294 12:124542474-124542496 TGCCCAGGGCAGAGGTGGCCTGG - Intronic
1104666594 12:130651535-130651557 TGCCCACGGCACAGCCGTCCTGG + Intronic
1106033877 13:26026452-26026474 TCCCCAGGTCACACCCTGCTGGG - Intergenic
1113693207 13:112326569-112326591 AGCCCAGGACACCCACGGCCGGG + Intergenic
1114031588 14:18584478-18584500 TCCCCAGGCCACACCCACCCTGG + Intergenic
1117492493 14:56264117-56264139 TGCCCAGGGCACACATTCCCAGG + Intronic
1117550617 14:56832542-56832564 TGCCCAGTGCCCACCAGGCTGGG - Intergenic
1118756597 14:68849440-68849462 TGCCTAGGGCACACATGGTCAGG + Intergenic
1119435808 14:74597201-74597223 TGCCCGGGGCTCACTCTGCCTGG - Intronic
1119539270 14:75428125-75428147 TGCCCAGGCCTGTCCCGGCCCGG - Intronic
1119610402 14:76056913-76056935 TGCCCAGGGCATCCCCAGCCTGG - Intronic
1120873155 14:89355968-89355990 TGGCCAGGGCAGAACAGGCCTGG - Intronic
1121013546 14:90535227-90535249 TGCCCCGGCCACACCTGCCCAGG + Exonic
1121049146 14:90808873-90808895 TGCCCAGGGCACAGCTGGCCGGG + Intronic
1121122222 14:91383230-91383252 TGCCCTGGGCACTCCAGGCCTGG - Intronic
1121323903 14:93008640-93008662 AGCCAAGAGCACAGCCGGCCGGG - Intronic
1122033583 14:98931611-98931633 TGCCCAGTCCACACCCAGCCAGG + Intergenic
1122879035 14:104681827-104681849 ACCCCTGGCCACACCCGGCCTGG + Intergenic
1122902473 14:104787515-104787537 CTGCCTGGGCACACCCGGCCCGG - Intronic
1122987661 14:105219950-105219972 TGCCCAGAGCCCACCCCGCTGGG - Intronic
1123039166 14:105483384-105483406 TGCCCTGGGCAGACCTGGCATGG - Intergenic
1123058157 14:105582078-105582100 GGCCCCAGGCACACCTGGCCAGG + Intergenic
1123082251 14:105701007-105701029 GGCCCCAGGCACACCTGGCCAGG + Intergenic
1123627633 15:22238651-22238673 TGCCCGGGGCACAGGCTGCCCGG + Intergenic
1124210780 15:27763668-27763690 TGCCCAGGGCACAGCTGGCTGGG + Intronic
1124248996 15:28095287-28095309 TCCCCCGGGCGCACCCGGGCGGG - Intronic
1124256241 15:28145129-28145151 TGTCCAGCACACACCAGGCCAGG + Intronic
1126663637 15:51055894-51055916 TGCCCTGTGCACACCTGGGCTGG - Intergenic
1128450862 15:67805218-67805240 TGCCCTGGGGACACCCTGCGTGG - Intronic
1131068451 15:89449028-89449050 TGCCAAAGGCATCCCCGGCCTGG + Intergenic
1131108158 15:89748367-89748389 CAGGCAGGGCACACCCGGCCTGG - Intergenic
1132146913 15:99434695-99434717 AGCCCAGGGCAGACCCTGTCAGG - Intergenic
1132453608 16:10432-10454 TGCTCAGGTCAGACCCGGGCGGG - Intergenic
1132625884 16:891263-891285 TCCCCAGGACTCACCTGGCCAGG - Intronic
1132629143 16:908486-908508 GGCCCCGAGCACACCCGACCAGG + Intronic
1132653412 16:1031575-1031597 TGCCCAGGGCTCAGCAGGGCAGG + Intergenic
1132659700 16:1055846-1055868 TGCTCAGGGGACAGCGGGCCGGG + Intergenic
1132785071 16:1652391-1652413 TGGCCAGGCCCCACCTGGCCTGG + Intronic
1132862102 16:2076782-2076804 TGCCCGTGGCACACGCAGCCCGG - Intronic
1134062883 16:11209682-11209704 TGCCCAGGGAACTCCCGGGCTGG - Intergenic
1135423239 16:22318418-22318440 TGCCCAGGGCTCACTTGGGCGGG + Intronic
1136267836 16:29131405-29131427 TGCCCTGCGCCCACTCGGCCTGG - Intergenic
1136686130 16:31995944-31995966 TTCCTGGGGCACACCCCGCCAGG - Intergenic
1136786743 16:32939473-32939495 TTCCTGGGGCACACCCCGCCAGG - Intergenic
1136883029 16:33914317-33914339 TTCCTGGGGCACACCCCGCCAGG + Intergenic
1139583863 16:67888594-67888616 TGCCCAGGGCCCAGCCAGCTTGG - Intronic
1140303335 16:73779524-73779546 TGCCCATGGCAGACACGGCAGGG - Intergenic
1140469185 16:75205113-75205135 AGGGCAGGGCTCACCCGGCCGGG + Intronic
1140472599 16:75223826-75223848 AGGGCAGGGCTCACCCGGCCGGG - Intronic
1141688446 16:85583275-85583297 GGCACAGGGCACACATGGCCAGG - Intergenic
1141828330 16:86496134-86496156 GGCCCAGAGAACACCCGGCCTGG - Intergenic
1142071140 16:88091752-88091774 TGCCCTGCGCCCACTCGGCCTGG - Intronic
1203088979 16_KI270728v1_random:1201143-1201165 TTCCTGGGGCACACCCCGCCAGG - Intergenic
1143564863 17:7715318-7715340 AGCCCAGGGCACAGCCGGCAGGG + Intergenic
1144729100 17:17516637-17516659 TCCCCAAAGCACACACGGCCAGG - Intronic
1144735650 17:17553941-17553963 CACCCAGAGCACACCCAGCCAGG + Intronic
1145866971 17:28247796-28247818 TGCCCAGGGCACATGGGCCCAGG - Intergenic
1146052887 17:29567062-29567084 TGCCCAGGGCCCTCCCGCGCGGG + Exonic
1146815664 17:35940019-35940041 TCCCAAGGGCATACCCTGCCTGG + Intronic
1147218658 17:38915342-38915364 TGCCCATGGTACACCAGGGCTGG - Intronic
1150283375 17:63942076-63942098 TGAGCAGAGCACACCAGGCCGGG - Intronic
1150292506 17:63989559-63989581 AGCCCAGAGTACACCCGGCGAGG - Intergenic
1150566948 17:66350318-66350340 TGCCCGGGGCTCACCCAGGCAGG + Intronic
1150654057 17:67028120-67028142 TGCCCTGAGCACACCAGTCCTGG - Intronic
1150656776 17:67044630-67044652 TGCCCAGGGCACCCACGCCTCGG + Exonic
1151419355 17:73987176-73987198 AGGCCAGGGCAAACCAGGCCAGG - Intergenic
1151828641 17:76537366-76537388 TGCCCAGGGCCCGGCCGGGCCGG + Intronic
1151876405 17:76869959-76869981 TGCCCAGTGGACGCCCGGCGGGG + Intronic
1151961563 17:77408498-77408520 TGCCCCTGGAACACACGGCCCGG - Intronic
1152034532 17:77864041-77864063 AGCCCAGGCCGCACCCAGCCTGG + Intergenic
1152485493 17:80589060-80589082 TGCCCTGGGCACACAGGGACTGG - Intronic
1152574804 17:81135318-81135340 TGCCCAGGGGACACCAAGGCTGG - Intronic
1152729045 17:81960985-81961007 TGCCCCCGACACCCCCGGCCCGG - Exonic
1152784721 17:82241748-82241770 TGCCCAGGGCACAGCCAGAATGG + Intronic
1154131200 18:11738351-11738373 TGCCCACAGCAGACCTGGCCTGG - Intronic
1154200506 18:12296566-12296588 TACCCTGGGCACTCCCAGCCAGG - Intergenic
1155053225 18:22165703-22165725 TGCGCAGGCCAGGCCCGGCCCGG - Intergenic
1160168319 18:76532145-76532167 TGCCCATGACCCACCCGCCCAGG - Intergenic
1160168361 18:76532297-76532319 TGCCCAGGACCCACCCACCCAGG - Intergenic
1160412371 18:78683731-78683753 TGCCCAGGGCACCCCCCTCCAGG + Intergenic
1160413150 18:78688413-78688435 TGCCCAGGGCAGACTCGGCCTGG + Intergenic
1160727628 19:624604-624626 TGCCCAGGGCTCACCTGGGCTGG - Intronic
1160868017 19:1264615-1264637 GGGCCAGGGGACACCCGTCCAGG - Intronic
1161161669 19:2765147-2765169 TGCCCAGGGCAGGGGCGGCCGGG - Intronic
1161457051 19:4374793-4374815 TGCCGAGGACGCACCCTGCCTGG + Intronic
1161962292 19:7529476-7529498 TGCCGAGGGCACAGCCGGTGTGG - Intronic
1162019313 19:7861494-7861516 AGGCCAGGCCACACCAGGCCAGG - Intronic
1162029382 19:7910812-7910834 TGCCCAGTGCAAGCCCCGCCTGG - Intronic
1162029392 19:7910857-7910879 TGCCCAGTGCACGCCCCGCCTGG - Intronic
1162039083 19:7958419-7958441 AGCACAGGGCACACCCGAACTGG + Intergenic
1162344696 19:10112405-10112427 TGCCCAGGGCACAGCAGCACAGG - Intronic
1162376501 19:10308447-10308469 TGCCCAGGACACCCCGGTCCTGG - Exonic
1162546811 19:11335768-11335790 TGTCCAGGACACAGCGGGCCAGG - Exonic
1163440853 19:17321973-17321995 TGCCCAGGTCACACCAACCCTGG - Exonic
1163639964 19:18456587-18456609 TGCCCAAGCCACACACTGCCTGG - Intronic
1163799737 19:19357136-19357158 TGGCTAAGGCACACCCAGCCTGG - Exonic
1164603561 19:29579787-29579809 TGCACAAGGCACCCCAGGCCTGG + Intergenic
1165091096 19:33388809-33388831 GCCCCAGTGCACACCCAGCCTGG + Intronic
1165104807 19:33462471-33462493 TGGCCAGGCCACACCCGCCACGG + Intronic
1165789999 19:38485662-38485684 TGCCCAGGGCGCACACAGCGCGG - Exonic
1166295690 19:41888195-41888217 TCCCCAGGCCCCTCCCGGCCTGG + Exonic
924958305 2:10787-10809 TGCCCGTGGCCCACCCGCCCGGG + Intergenic
925410867 2:3639297-3639319 TGCCCAGAGCACACACCGCATGG - Intronic
925640116 2:5979147-5979169 GGCCCAGGGCACACCCAGGAGGG + Intergenic
926727961 2:16013246-16013268 TGCCGAGTGCACAGCCCGCCAGG + Intergenic
927962656 2:27250470-27250492 GGCCCAGGGCCCAGCCGGCAGGG - Intergenic
929689342 2:44061586-44061608 TGCCCAGAGGCCACCCTGCCTGG - Intergenic
931649316 2:64454203-64454225 TGCCCAGGGCCGACGCGGCACGG + Exonic
932580147 2:72988139-72988161 TGCCCAGGGGGCACCCAGCTGGG - Intronic
933305194 2:80588748-80588770 TGCCCAGGGCACTCCAGGGACGG - Intronic
936076436 2:109404595-109404617 TGCCACGGGCACACAGGGCCTGG + Intronic
937434584 2:121869943-121869965 TGCCCTGAGCACACCCAGCTGGG + Intergenic
937439349 2:121903320-121903342 TGCCGAGTGCATACCCTGCCCGG - Intergenic
937961940 2:127466674-127466696 TGTCCAGGCAACACCCAGCCAGG - Intronic
937990867 2:127661606-127661628 TGCCCAGGGCACACCCAGCCTGG + Intronic
946158952 2:217824503-217824525 TGCCCAGGTCACAGCTGGCAAGG + Intronic
948879657 2:240850366-240850388 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
948879672 2:240850410-240850432 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
948879687 2:240850454-240850476 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
948879702 2:240850498-240850520 TGCCCAGGGCAGGCCCAGCCAGG + Intergenic
1171173733 20:23036082-23036104 TGCAGTGGCCACACCCGGCCTGG + Exonic
1171214454 20:23342125-23342147 CGCCCTGGGCCCACACGGCCTGG + Intergenic
1171218537 20:23372482-23372504 TGCGCAGGCCACAACCGGGCTGG + Exonic
1171420044 20:25011927-25011949 TGTCCAGGTCACGCCAGGCCAGG + Intronic
1172890596 20:38260967-38260989 TTCCCACGGCGCACCCGGCCCGG + Intronic
1173176738 20:40770724-40770746 TGACCAGGGGACACACAGCCAGG + Intergenic
1174138121 20:48394482-48394504 TGACCAGGACAGACCTGGCCCGG + Intergenic
1174449045 20:50608795-50608817 CGCCCAGGGCCCTCCCTGCCAGG + Intronic
1175319493 20:58075171-58075193 GGCCCTGGGCACCCCCGGGCTGG - Intergenic
1175414578 20:58793205-58793227 TGCACAGGAAACACGCGGCCTGG - Intergenic
1175886172 20:62292077-62292099 TGCACAGGCCACCCCCAGCCGGG - Intronic
1175994354 20:62805430-62805452 CTCCCAGGCCAGACCCGGCCCGG - Intronic
1176213767 20:63938813-63938835 GGACCAGCGCCCACCCGGCCTGG + Intergenic
1179354865 21:40649769-40649791 AGCCCAGGGCACTGCAGGCCAGG + Intronic
1179544195 21:42103644-42103666 TCCCCAGCACACACCAGGCCAGG + Exonic
1179906367 21:44425176-44425198 AGCTCAGGGCACAGCAGGCCAGG - Intronic
1179964473 21:44793448-44793470 AGGCCAGCGCACACCCGGGCAGG - Intronic
1180078429 21:45475097-45475119 TCCCCAGCGCACGCCCGGCTGGG - Intronic
1180160777 21:45997861-45997883 TGCTGCGGGCACTCCCGGCCCGG - Intronic
1180455700 22:15511535-15511557 TCCCCAGGCCACACCCACCCTGG + Intergenic
1180722196 22:17917718-17917740 TGGCCAGGGCAGCCCCGCCCAGG - Intronic
1181104779 22:20567721-20567743 TCACCAGGGCAAACCCTGCCAGG - Intronic
1182098104 22:27639378-27639400 TGCCCAGGCCCCATCCTGCCTGG + Intergenic
1182697860 22:32208497-32208519 AGACCAGGGCTCACCGGGCCTGG - Intergenic
1183407580 22:37638098-37638120 AGCCCAGACCACACCGGGCCTGG - Intronic
1183547046 22:38459991-38460013 TCCCCAGGGCACAGCCTGCTGGG - Intergenic
1183629802 22:39026136-39026158 TGCCCTGTGGGCACCCGGCCCGG - Intronic
1183633244 22:39045995-39046017 TGCCCTGTGGGCACCCGGCCCGG - Intronic
1184188336 22:42878960-42878982 GGTCCAGGGCAGCCCCGGCCTGG - Intronic
1184238816 22:43200832-43200854 TGCCCTGGGCACACTGGGCATGG + Exonic
1184423441 22:44395273-44395295 TGCCCGGGGCTCAGCCGGCTCGG + Intergenic
1184693053 22:46126061-46126083 AGCCCAGGCCCCACCCGCCCTGG + Intergenic
1184828968 22:46971974-46971996 TGTCATGGGCACACCCGGCTGGG + Intronic
1184959895 22:47921332-47921354 CGCACAGGGCCCACCAGGCCTGG - Intergenic
1185014375 22:48334606-48334628 TGCCCAGGGCTGAGCCGGGCTGG + Intergenic
1185073577 22:48670413-48670435 TACCCAGTGCCCACCAGGCCTGG - Intronic
1185330877 22:50251566-50251588 GCCCCAAGGCCCACCCGGCCCGG + Intronic
949517735 3:4822240-4822262 GGCCCAGAGCACAGCCAGCCAGG + Intronic
950264296 3:11562933-11562955 TGCCCACGGCACACGTGGCAAGG - Intronic
950467100 3:13162062-13162084 TGCCCCAGCCCCACCCGGCCTGG - Intergenic
950738997 3:15034727-15034749 TGACCTGGGCACACTGGGCCAGG - Exonic
953773068 3:45793577-45793599 TCCCCAGGCCAGGCCCGGCCCGG - Intronic
954135811 3:48581617-48581639 TCCACAGGGCCCACCCGGCTTGG - Exonic
954217795 3:49133922-49133944 AGCTCAGGGCACTCCCTGCCGGG - Intergenic
954304429 3:49717926-49717948 TGCCCAGGGCTCCCCCACCCAGG - Exonic
955117543 3:56020744-56020766 TGCCCAGGGCACTGTCTGCCAGG - Intronic
961389279 3:126542712-126542734 GGCGCAGGGCACACCTGGCCAGG + Exonic
961450390 3:126999851-126999873 TGCCCAGGCCACGCCAGGCATGG - Intronic
965519523 3:169658881-169658903 TGCCCCCGGCACGCCCGGCTCGG - Intronic
968556654 4:1249214-1249236 GGCTCAGGGCCCGCCCGGCCGGG + Intronic
968642894 4:1723193-1723215 TGCCCATGGCTCCCCCTGCCAGG + Intronic
968799568 4:2733240-2733262 GGCCCAGGGCACCCCCACCCAGG + Intergenic
969416986 4:7067518-7067540 TGCCCAGGGCACACCCGGCCCGG + Intronic
969418212 4:7074772-7074794 GGCCCCGGCCACACCCGTCCTGG - Intergenic
969608032 4:8211989-8212011 TGCCCAGGTCAGACCCGCCAAGG + Intronic
969964074 4:10976180-10976202 TGCCCAGGGCACAACGGGAGTGG - Intergenic
971349550 4:25843822-25843844 TTGCCAGGCCAGACCCGGCCAGG - Intronic
972330371 4:38058448-38058470 TGCCCATGGCTCAGCCGCCCAGG - Intronic
981844688 4:149154163-149154185 TGCTCAGCGCACATTCGGCCAGG - Intergenic
985467576 5:12303-12325 TGCCCTGGGCCCGCCCGCCCGGG + Intergenic
990545464 5:56816426-56816448 TGCCCCGGGGACACCCGTCCGGG - Intronic
990557557 5:56951614-56951636 TGCCCCCGGCCCACCGGGCCCGG - Intronic
990895861 5:60699843-60699865 GGCCCAGAGCTCAGCCGGCCGGG - Intronic
992997714 5:82348908-82348930 TGCCCAGAGCACAGCTGGCCAGG - Intronic
997413652 5:133708632-133708654 TGCCTAGGGAACACATGGCCGGG - Intergenic
997711520 5:136008720-136008742 TTCCCAGGGCACAACTGGCATGG + Intergenic
999124349 5:149235999-149236021 TGCCCAGCCCACAGCCAGCCAGG + Intronic
999262719 5:150247558-150247580 AGCCCAGGGCCCACCAGGACTGG - Intronic
999534654 5:152503549-152503571 AGCCCAGGGCACACCCAGGCCGG + Intergenic
999729392 5:154464744-154464766 TGCCCAGGGCAGAACAGGGCAGG - Intergenic
1001871484 5:175159843-175159865 TGCCCAGGTCACTCCTGCCCCGG + Intergenic
1002091653 5:176810103-176810125 TGCCCGGGGCACCCCTGCCCTGG + Intergenic
1002924204 6:1595454-1595476 CGGCCGGGGCACACCAGGCCAGG + Intergenic
1002991260 6:2241133-2241155 GGCCCGGGGCACAGCTGGCCTGG + Intronic
1003187105 6:3841403-3841425 TGCCCAGGGAACCACCGCCCTGG - Intergenic
1005594660 6:27368000-27368022 TGCCCTGAGCACACCTGGTCAGG - Intergenic
1006211422 6:32398634-32398656 TGCACAGGTCACACACGGACAGG - Intronic
1007396591 6:41581448-41581470 GGCCCAGGGCTCACACTGCCAGG + Intronic
1011662054 6:89603094-89603116 TGTCCAGGGCACACCCTTCGTGG - Exonic
1013395950 6:109739859-109739881 TGCCAAGGGCACAGCTGGCGAGG + Intronic
1017555254 6:155558183-155558205 TGCCCAGGAGACACCCAGCTGGG - Intergenic
1018719056 6:166558535-166558557 TGCCCTGGGCACACACTGCTTGG - Intronic
1018962778 6:168459804-168459826 ACCCCAGGGCTCACCCAGCCCGG - Intronic
1019532543 7:1510998-1511020 TACCCAGCGCAGACCAGGCCTGG + Intergenic
1019724088 7:2591355-2591377 TGGCCGTGGAACACCCGGCCTGG + Intronic
1019725094 7:2597497-2597519 CTCCCAGTGCACACCGGGCCAGG - Intronic
1019748920 7:2716706-2716728 TGCCCAAGGCCCACCTGGACAGG + Intronic
1019779866 7:2932987-2933009 TGCCCTGGCCACCCCCGGCCCGG + Intronic
1023819761 7:43974064-43974086 TGCCCTGGGCCCACCAGGACAGG - Intergenic
1023874940 7:44281843-44281865 TGCCCACTGCTCTCCCGGCCAGG + Intronic
1026878565 7:73893866-73893888 TGCCCAGGGCCCACGCAGACGGG - Intergenic
1027008936 7:74724883-74724905 TGCCCACTGCACTCCCAGCCTGG + Intronic
1029331528 7:99860366-99860388 TGCCCAGCGCACCCAGGGCCAGG - Intronic
1029438249 7:100574216-100574238 GGCACAGGGCCCACCCCGCCCGG - Intronic
1029473055 7:100766700-100766722 TGCCCAGGCAACACCAGGCAAGG + Intronic
1029748034 7:102527517-102527539 TGCCCTGGGCCCACCAGGACAGG - Intergenic
1032194241 7:129780373-129780395 GGCGCAGGGCACGCCCGTCCGGG + Intergenic
1032194647 7:129781848-129781870 GGTCCTGGGCACACCCGGCCCGG - Intergenic
1034191635 7:149217760-149217782 TGCCAAGGGCACACTCAGTCAGG - Intronic
1034343494 7:150372201-150372223 GGCCCAGGCCGCCCCCGGCCCGG + Exonic
1035292996 7:157851593-157851615 TGGCCAGGGCACACCCGCCAAGG + Intronic
1035297540 7:157875833-157875855 TGCCCTGGGGACGCCTGGCCTGG - Intronic
1035476203 7:159145341-159145363 TTCCGAGCGCACACCTGGCCCGG - Intergenic
1036409859 8:8489377-8489399 TGCCCAGCATACACCCGGCATGG + Intergenic
1037803811 8:22048875-22048897 TGCCGTGGCCACGCCCGGCCGGG - Intergenic
1039474590 8:37833079-37833101 TGCCCGGGGCACCCCCGCCCAGG - Exonic
1042590540 8:70393649-70393671 GGGCCTGGGCACACCTGGCCTGG - Intronic
1045432149 8:102124156-102124178 CGCCCCCGGCACACCCGCCCCGG + Intronic
1048257425 8:132915570-132915592 TGCCCAGGACACACCTGGGCTGG + Intronic
1048852969 8:138662032-138662054 CCCCCAGGGCCCAGCCGGCCGGG - Exonic
1049240117 8:141533425-141533447 GTCCCAGGGCACACACCGCCTGG - Intergenic
1049350426 8:142161460-142161482 TGCCCTGGGCACACAGCGCCTGG + Intergenic
1049433426 8:142575599-142575621 GGCCCAGGACACACGCAGCCTGG + Intergenic
1049509662 8:143021102-143021124 AGCAGAGGGCTCACCCGGCCTGG + Intronic
1049521601 8:143094303-143094325 TGCCCAGGGCTCACCCAGGTGGG - Intergenic
1049618372 8:143586539-143586561 GGCCCTGAGCAGACCCGGCCCGG + Intronic
1049660439 8:143817415-143817437 TACCCTGGGCACACCTGGACTGG - Exonic
1051078181 9:13265261-13265283 TGCCCAGGACACAGTCGACCTGG - Intronic
1051367535 9:16331807-16331829 GGCCCTGGGCACCCCAGGCCGGG - Intergenic
1051370667 9:16356339-16356361 TGATCAGGGCACACCGCGCCAGG + Intergenic
1057024599 9:91725467-91725489 TGCCCCGGACATACCCTGCCAGG + Intronic
1057171667 9:92966592-92966614 TGCCCGGGGCCCACCCCACCTGG + Intronic
1057199983 9:93134629-93134651 TTCCCAGGGCGAACCCCGCCTGG - Intergenic
1057210772 9:93199975-93199997 TGTCCAGGGCAGCCCCAGCCTGG + Intronic
1058866507 9:109166718-109166740 TGCCCAGGCCTCCGCCGGCCTGG - Intronic
1059471065 9:114505215-114505237 TGCCCGGGGCTCCCCCAGCCGGG + Intronic
1060598356 9:124861694-124861716 TGCCCAAGGCACGGCCGGCGAGG - Intronic
1060667258 9:125439310-125439332 AGCCCAGGGCACAGCCTTCCGGG - Intronic
1061158942 9:128882327-128882349 TGCCCCGGGCGCCCCGGGCCGGG - Intronic
1061180310 9:129021606-129021628 TGCCCGGAGCACACCCAGGCAGG - Intronic
1061244215 9:129392971-129392993 TGCCCAGGGCCCACACGTCAGGG + Intergenic
1061348233 9:130043308-130043330 TCCCCCGGGCTCCCCCGGCCGGG + Intergenic
1061825056 9:133252680-133252702 CGCCCAGGACAAACCGGGCCTGG - Intronic
1061933304 9:133844375-133844397 TTCCCAGGGAACACCTGCCCAGG + Intronic
1062338667 9:136083824-136083846 TGCTGAGGGGACCCCCGGCCTGG + Intronic
1062341379 9:136095198-136095220 TGCCCAGGCCGGACCGGGCCGGG - Exonic
1062354012 9:136153400-136153422 TGCCCATGGCACACGAGGCTGGG + Intergenic
1062389533 9:136328366-136328388 TGCCCTGGGCCCAGCCGGGCAGG + Intronic
1062397335 9:136357773-136357795 AGCCCAGGGCAGGCCCGCCCAGG - Intronic
1062503022 9:136859309-136859331 AGCCCAGGGCTCACCCGGGCTGG - Exonic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1062572000 9:137190072-137190094 AGCCCAGGGCACAGCCCACCCGG + Exonic
1185603780 X:1355509-1355531 GGCCCAGGGGAGACCCAGCCAGG + Intronic
1187400376 X:18954316-18954338 TGCCCAGGCCCCACACGGCCAGG + Exonic
1198515782 X:137405653-137405675 TGACCAGGGCGCAACCCGCCCGG + Intergenic
1199947014 X:152678656-152678678 TCCCCAGGGAGCACCTGGCCTGG + Intergenic
1199962667 X:152789798-152789820 TCCCCAGGGAGCACCTGGCCTGG - Intergenic
1200411646 Y:2867661-2867683 TGCCAAGGGCAAACCAGGCGTGG + Intronic
1201604538 Y:15770911-15770933 TGCCCGGAGCACACCCAGGCAGG + Intergenic