ID: 969421890

View in Genome Browser
Species Human (GRCh38)
Location 4:7102329-7102351
Sequence CTGTTTCTGGGGAGCAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 208}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969421883_969421890 -4 Left 969421883 4:7102310-7102332 CCAACACGCAGCCAAGCCACTGT 0: 1
1: 0
2: 0
3: 13
4: 129
Right 969421890 4:7102329-7102351 CTGTTTCTGGGGAGCAACCAGGG 0: 1
1: 0
2: 2
3: 17
4: 208
969421882_969421890 17 Left 969421882 4:7102289-7102311 CCTTATCACGTGCTGTGGATGCC 0: 1
1: 0
2: 0
3: 8
4: 70
Right 969421890 4:7102329-7102351 CTGTTTCTGGGGAGCAACCAGGG 0: 1
1: 0
2: 2
3: 17
4: 208
969421879_969421890 24 Left 969421879 4:7102282-7102304 CCATAGCCCTTATCACGTGCTGT 0: 1
1: 0
2: 0
3: 8
4: 95
Right 969421890 4:7102329-7102351 CTGTTTCTGGGGAGCAACCAGGG 0: 1
1: 0
2: 2
3: 17
4: 208
969421881_969421890 18 Left 969421881 4:7102288-7102310 CCCTTATCACGTGCTGTGGATGC 0: 1
1: 0
2: 0
3: 12
4: 62
Right 969421890 4:7102329-7102351 CTGTTTCTGGGGAGCAACCAGGG 0: 1
1: 0
2: 2
3: 17
4: 208
969421878_969421890 25 Left 969421878 4:7102281-7102303 CCCATAGCCCTTATCACGTGCTG 0: 1
1: 0
2: 0
3: 8
4: 69
Right 969421890 4:7102329-7102351 CTGTTTCTGGGGAGCAACCAGGG 0: 1
1: 0
2: 2
3: 17
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969421890 Original CRISPR CTGTTTCTGGGGAGCAACCA GGG Intergenic
900793268 1:4693133-4693155 CAGTTTATGGGGAGAAACCGAGG + Intronic
903281818 1:22254587-22254609 GTGTTTTGGGGGAGCAGCCATGG + Intergenic
906080054 1:43080329-43080351 CTGTTTCTGGGGAGACCTCAGGG + Intergenic
906306528 1:44723597-44723619 CTGGTTCTGGTGAGCTTCCACGG + Intronic
906668062 1:47635604-47635626 CTGTTTCTGGGGAACGACCCTGG + Intergenic
906783438 1:48593103-48593125 CTGTCTCTGGGGAGCAAAACTGG - Intronic
907533925 1:55130590-55130612 CTGTTTCTCCAGAGCAACCTAGG - Intronic
909528717 1:76657674-76657696 CTGCTTCTGGGGAGGCCCCAAGG - Intergenic
911077513 1:93891925-93891947 CTCTTTATGGGGGGAAACCAAGG + Intronic
912689685 1:111794985-111795007 TGGTTTCTGGGGAGCCAACATGG + Intronic
918708056 1:187692906-187692928 CTGTTTCAGGGAAGCAACTATGG + Intergenic
919122517 1:193358838-193358860 CTGTTTCTTTGGAGAAACCCTGG - Intergenic
920509821 1:206542575-206542597 CAGTTCCTGGGCAGCAACCTCGG + Intronic
921286913 1:213617157-213617179 CTGTTTCTGGGAGTCACCCAGGG + Intergenic
921743229 1:218709794-218709816 CTGTTTCCAGTGAGCCACCAAGG + Intergenic
922238213 1:223737183-223737205 CTTTTTCTGGAGAGGAAGCAAGG + Intronic
922367610 1:224880709-224880731 CTGTTTCTGGGTGGTAACCAGGG + Intergenic
922994140 1:229942766-229942788 GAGTTGCTGGGCAGCAACCAAGG - Intergenic
1062766992 10:73778-73800 TTGTTTCTGGGGAGAGACCCTGG - Intergenic
1062767429 10:76279-76301 TTGTTTCTGGGGAGAGACCCTGG - Intergenic
1062930594 10:1349910-1349932 TTGGTTGTGGGGAGCAGCCAAGG - Intronic
1064678503 10:17785726-17785748 CTGTGTCCGGGGACCAACCGGGG + Intronic
1066040520 10:31544497-31544519 CTGTTTCTGGGGAGGCCTCAGGG - Intergenic
1067056634 10:43056462-43056484 CTGTTTCTGGGAAGCAGCAAGGG - Intergenic
1068689912 10:59905270-59905292 CCGTTTCTGGGCAGCCTCCAGGG + Intronic
1069633361 10:69911045-69911067 CTGTTTCTGGGGAGCCCCACTGG - Intronic
1070540175 10:77410032-77410054 CTGGTTCTGGGCAGGAAGCAGGG + Intronic
1070810367 10:79294667-79294689 TTGGTCGTGGGGAGCAACCAGGG - Intronic
1071318780 10:84430531-84430553 CTTTTTCTAGGGAGCGGCCAGGG + Intronic
1071990267 10:91094421-91094443 CTGCTTCTGGGGAGGACTCAGGG + Intergenic
1073117440 10:101099549-101099571 CTGTGTTTGGGCAGCAGCCAGGG - Intronic
1074146848 10:110724566-110724588 CTCTTTGTGGGGAGAAGCCAGGG - Intronic
1077141922 11:1028523-1028545 CTGTGTCCGGGGAGCCCCCAGGG - Intronic
1078195336 11:9132471-9132493 ATGTTCCTGGGCAGCAACCAAGG + Intronic
1079102950 11:17552828-17552850 CTGTTCCTGGCTAGCAAGCAAGG - Intronic
1082797620 11:57389358-57389380 GTGGTTCTGGGGAGGAACAAGGG - Intronic
1088382638 11:109212621-109212643 TTATTTCTGGGAAGCAACGATGG + Intergenic
1088433627 11:109785725-109785747 CAGTTTCTAGTGAGGAACCAGGG - Intergenic
1088678717 11:112221229-112221251 CTTTTTGTGGGGAGCTACAAGGG + Intronic
1089682198 11:120124876-120124898 CTGTGTCTGGAGAGCAATCAGGG + Intronic
1091754031 12:3040293-3040315 CTGTGTGTGGGTAGCAGCCATGG + Intronic
1096753850 12:53782422-53782444 CTTTTTCTGGGGGGAAAGCAGGG + Intergenic
1097375191 12:58835120-58835142 CTGCTTCTGGGGAGCCCTCAGGG + Intergenic
1097503077 12:60431137-60431159 CTGTCTCTGGGCTGCAATCAAGG + Intergenic
1097959024 12:65514515-65514537 ATGTACCTGGGGAGGAACCAAGG + Intergenic
1098112022 12:67133074-67133096 CTGGTTCTGGTGTGCAAGCATGG + Intergenic
1100272420 12:93039095-93039117 CTGTTTCTGGGGAGGCCTCAGGG + Intergenic
1106678738 13:31988232-31988254 CTGTTTCTAGGGAGCAGATAAGG - Intergenic
1108151892 13:47544767-47544789 CTAGTCCTGGGGAGCAGCCATGG - Intergenic
1108210865 13:48138623-48138645 CTGTTTCTGGGGAGGCCTCAGGG - Intergenic
1108584535 13:51858805-51858827 ATGTTTCTGGGTGGCAACCTAGG - Intergenic
1109856208 13:68131322-68131344 CTGCTTCTGGGGAGGATTCATGG + Intergenic
1112246475 13:97739179-97739201 CTGATTTGGGGGAGCATCCAAGG - Intergenic
1114356210 14:21912157-21912179 CTGTTTCTGGGGAGGCTTCAGGG + Intergenic
1116919742 14:50560441-50560463 CTGTTTGGGCGGAGGAACCATGG + Intronic
1122520333 14:102339238-102339260 CTGTTTGTGGGGTGTATCCATGG + Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1123860436 15:24460672-24460694 AAGTTTCTGGGGAGAAAACAGGG + Intergenic
1125899497 15:43331723-43331745 CAGTTTCTGTGGAGCAATAAGGG + Intronic
1128882868 15:71259599-71259621 GTGATTCTGAAGAGCAACCAGGG - Intronic
1129164962 15:73771694-73771716 TTGTTTCTGAGGAGGAAACAAGG - Intergenic
1129583108 15:76832829-76832851 CTGTTTCTGGGGAGGCCTCAGGG - Intronic
1129846732 15:78771278-78771300 CTGTTCCAGGAGAGCAACCCTGG - Exonic
1130161758 15:81408250-81408272 CTGGTTCTGGGGAGCAAGAGAGG + Intergenic
1130255166 15:82322613-82322635 CTGTTCCAGGAGAGCAACCCTGG + Intergenic
1130599808 15:85267393-85267415 CTGTTCCAGGAGAGCAACCCTGG - Intergenic
1131735398 15:95326556-95326578 CTGTTTCTTGGGTGAACCCATGG - Intergenic
1132631156 16:918212-918234 CTGTTTCTCGGCAGCGCCCACGG - Intronic
1134251427 16:12576970-12576992 CTATTTCAGGGGTGGAACCAAGG - Intergenic
1134257977 16:12627009-12627031 CTGGTTCTGGGGTGGGACCAGGG - Intergenic
1137844886 16:51677527-51677549 CTCTTTCTGGGAAGTAATCAAGG + Intergenic
1140876124 16:79153972-79153994 ATGCTTCTGGGGTGCATCCATGG - Intronic
1142414539 16:89934271-89934293 CTGTTTCTGTGGCGCGTCCACGG - Intronic
1142439034 16:90082488-90082510 TTGTTTCTGGGGAGAGACCCTGG + Intronic
1145290943 17:21545298-21545320 CTGTTTCTGGTGAGGACCCTAGG - Intronic
1146936934 17:36817870-36817892 CTGATTCTGGGGATCAGCCCAGG - Intergenic
1150274266 17:63885798-63885820 CTGTTTCTGCAGACCAACCACGG + Intergenic
1150715811 17:67571859-67571881 AAGGTTCTGGGGGGCAACCAGGG + Intronic
1151403032 17:73868600-73868622 CTGTTCCTGGGGACCAGCCTCGG + Intergenic
1152959846 18:73121-73143 TTGTTTCTGGGGAGAGACCCTGG - Intronic
1152960263 18:75625-75647 TTGTTTCTGGGGAGAGACCCTGG - Intergenic
1153088961 18:1321914-1321936 TTGGTTCTGGGGAGCAGCAAAGG - Intergenic
1153840701 18:9005492-9005514 CTGGTTATGGAGAGCAGCCAGGG + Intergenic
1155203534 18:23537678-23537700 CCGTTCCTGGGGAGCCTCCAGGG - Intronic
1156514589 18:37669412-37669434 CTGTCTCTGGGAGGCAACAAGGG - Intergenic
1158887911 18:61846281-61846303 CTGTCTTTGGGGAGCTTCCATGG + Intronic
1159863888 18:73682137-73682159 CAGTCTCTGTGGAGCAAACAAGG + Intergenic
1161655595 19:5512671-5512693 CTGCCTCTGGGAAGAAACCAGGG + Intergenic
1162399380 19:10435708-10435730 CTGTGTCTGGGTTGCAACCTTGG + Intronic
1162794456 19:13079296-13079318 CTTTTCCTGGGGAGCAGCCCAGG - Intronic
926505646 2:13711895-13711917 CTATTTCAGGGTGGCAACCACGG - Intergenic
926911620 2:17857040-17857062 CTGTTTGCAGGGAGCACCCAAGG - Intergenic
929898425 2:45981488-45981510 CTGTCTCTGGAAAGCAACAAAGG + Intronic
931041735 2:58308655-58308677 CTGTTTCAGGGGAGGAACAATGG - Intergenic
931233796 2:60396350-60396372 CTGTTTCTGGGGAGCCCACCTGG - Intergenic
932536015 2:72596325-72596347 CTGTTACTGGGTAGGCACCAGGG - Intronic
933280058 2:80323073-80323095 CTGTCTCTGAGGAGTGACCAGGG + Intronic
933294499 2:80473681-80473703 CTGTTGTTGGGGAGCAATAATGG - Intronic
933933308 2:87177923-87177945 CTGTCTCTGGGGAGACAACATGG - Intergenic
934940639 2:98499314-98499336 CTGTTTGAGGGGAGGAAACAGGG - Intronic
935376904 2:102409118-102409140 CTGTTTGGGGGGTGCACCCAAGG - Intergenic
935591581 2:104850683-104850705 CTGTGTCTGGGGAGCAGGCGGGG - Intergenic
936359806 2:111787523-111787545 CTGTCTCTGGGGAGACAACATGG + Intronic
936528866 2:113261183-113261205 CAGTTTCTGGAGAGGAAACAGGG + Intronic
937798079 2:126049385-126049407 ATGTTTTTGGGCAGAAACCAAGG + Intergenic
938602387 2:132855476-132855498 CTGTTTGTGTGGACCAGCCATGG - Intronic
941624229 2:167812820-167812842 CTGTTTCTGCTGATCAAACAGGG - Intergenic
942395117 2:175538970-175538992 CTGTTTCCTTGGGGCAACCATGG - Intergenic
943832182 2:192477262-192477284 CTGCTTCTGGGGAGCTCTCAGGG - Intergenic
945191545 2:207193217-207193239 CTGTGTCTGTGGAGCCACGAAGG + Intergenic
945488145 2:210422741-210422763 GTGTTTCTGTGGAGAAACAAGGG + Intergenic
948151484 2:235747970-235747992 CTCTTTCTGGGCAGTAGCCAAGG + Intronic
948159555 2:235812884-235812906 CTGCTTCTGGGGAGCAAAACGGG - Intronic
948508844 2:238449416-238449438 ATGCTTCTGGGATGCAACCAGGG - Exonic
948666825 2:239540163-239540185 GTCTTCCTGGGGAGCAACCGTGG + Intergenic
1169919949 20:10724625-10724647 CTGTTTCTGAGCAGAAAACAAGG + Intergenic
1169936245 20:10886563-10886585 CCATTTCTGAAGAGCAACCAGGG + Intergenic
1172266349 20:33618294-33618316 CTCTTTCTGGGGAGCAAGCAGGG + Intronic
1172486663 20:35302451-35302473 CTGTGGCTGGGGAGCTACCCTGG + Intergenic
1173293476 20:41734702-41734724 CTTTTTCTCTGGAGCATCCATGG - Intergenic
1175289012 20:57860836-57860858 CTGCTTCTGGAGAGCCACCCTGG + Intergenic
1175370435 20:58484863-58484885 CTGTTTGAAGGAAGCAACCAAGG - Intronic
1177206358 21:18016039-18016061 ATCTTTCTGGGGAGGAATCAAGG + Intronic
1177569834 21:22872842-22872864 GTGTTTCTGGGAAAGAACCAAGG - Intergenic
1179544674 21:42106179-42106201 CAGAGTCGGGGGAGCAACCATGG + Intronic
1183327192 22:37200694-37200716 GGGATTCTGGGGAGGAACCAAGG + Intergenic
1183415901 22:37681696-37681718 CTGTTTCTGGGTGGCCACCTGGG - Intronic
1184414954 22:44346868-44346890 CTGTTGTTGGGGGGAAACCAGGG - Intergenic
1185393861 22:50577097-50577119 CTGTCTCAGGGGAGACACCAAGG + Intronic
949092278 3:42327-42349 CTGTTTCTGGGGATTAGCTATGG + Intergenic
950667911 3:14508387-14508409 GTGATTCTGAGGAGCAGCCAGGG + Intronic
952744622 3:36764902-36764924 CTGAATCTGGGGGGCAACAAGGG - Intergenic
953800613 3:46019867-46019889 CTGTTTCAGGGATGAAACCATGG + Exonic
954458774 3:50614209-50614231 GGGTTTCTAGGGAGCAGCCAGGG - Intronic
955173402 3:56587411-56587433 CTGCTTCTGGGGAGGCCCCAGGG + Intronic
956705364 3:71994699-71994721 CTCATTCTGGGGAGAATCCAGGG - Intergenic
956865787 3:73367276-73367298 CTGTTACTGCAGAGCAAACAAGG + Intergenic
957032541 3:75258282-75258304 CTGTTTCTGGGGATTAGCTATGG + Intergenic
957638586 3:82818885-82818907 CTGTTTCTGGGGATCAAAATGGG - Intergenic
957694205 3:83613104-83613126 CTGTTTCTGGGGAGGCTTCAGGG + Intergenic
958528968 3:95299707-95299729 CAGCTTCTGGGGAGGAATCAGGG - Intergenic
958908629 3:99968930-99968952 TGGTTTCTGGGGTGCAACCCAGG + Intronic
960150780 3:114246682-114246704 CTGCTTCTGGGGAGGTATCAGGG - Intergenic
960620340 3:119630950-119630972 CTGTCTCTAGGGAGGAACCTGGG - Intergenic
960996832 3:123345705-123345727 CTGTGACTGAGGAGCCACCAGGG - Intronic
961093130 3:124132645-124132667 TTGTGTCTGGGAAGGAACCAGGG + Intronic
961394725 3:126578793-126578815 CTGGTTCTGGGCAGCAGCTAAGG + Intronic
961414922 3:126750223-126750245 TTGCTTCTGGGGACCAAGCAGGG + Intronic
963511713 3:146255897-146255919 CTGCTTCTGGGGAGGACTCAGGG + Intergenic
964176722 3:153832491-153832513 CTGCTTCTGGGGAGGCACAAGGG + Intergenic
965076703 3:163988632-163988654 CTGTTCCTGGGTAGTAACTAGGG + Intergenic
967531629 3:190554343-190554365 CTGTTCCTGGGTAGTAACCAGGG - Intronic
969421890 4:7102329-7102351 CTGTTTCTGGGGAGCAACCAGGG + Intergenic
970279758 4:14441811-14441833 CTGTTTCTGGGGAGGCCTCAGGG - Intergenic
970957034 4:21824757-21824779 CTCTATCTGGGCAGCAATCAAGG + Intronic
971058448 4:22939961-22939983 CTGATTCTGATGTGCAACCAGGG - Intergenic
973012873 4:45098672-45098694 CTGTTTTTGGAGAGAAACTAAGG - Intergenic
973884167 4:55303976-55303998 CTGTTTCTGGGCAGTCTCCAGGG + Intergenic
975221307 4:71815483-71815505 CTTTTTCTGGGGAGCAAGAGAGG - Intergenic
975979234 4:80137230-80137252 CTGTTTCTGGTGAACACCAAAGG + Intergenic
977184684 4:93921839-93921861 CTGTTTCTGTAAAACAACCATGG - Intergenic
979675887 4:123410052-123410074 CTGGTTGTGGGGAGCAATTAAGG + Intergenic
982230814 4:153206672-153206694 CTGTTTCCAGGGAGCAAAGAGGG - Intronic
985007121 4:185544956-185544978 ATGCTTCTGGGGAGCCCCCAAGG - Intergenic
986162437 5:5242056-5242078 CTGTTTCAGGGAAGGAACCCGGG + Exonic
986450420 5:7857879-7857901 CTGATTCTGATGAGCAAACAGGG + Intronic
990560868 5:56981538-56981560 CTGCTTCTGGGGAGCTGTCAGGG - Intergenic
990791578 5:59486338-59486360 CTATTTCTGGAGAGCAACCATGG - Intronic
991044392 5:62208103-62208125 CTGTTTCCAGGGAGAAAACAGGG - Intergenic
992034522 5:72759444-72759466 TTGTTTCTTGGGAGCAAAGAGGG - Intergenic
994596556 5:101845103-101845125 GTGTTTCTGTGGAGAAACAAGGG - Intergenic
995735704 5:115297180-115297202 CTGGTTCTGTGGAGCAAGCTGGG - Intergenic
996921687 5:128775479-128775501 TTTTTTCTGGGGATCAAACAGGG + Intronic
997940937 5:138157018-138157040 CTGTTTTAGGGCAGAAACCATGG - Intronic
998445040 5:142191913-142191935 CAGGCTCTGGGGAGGAACCAGGG - Intergenic
1001061849 5:168497602-168497624 CAGTTTCTGGGGAGGACTCAGGG + Intronic
1001997007 5:176170228-176170250 CTGTGTTTGGGGAACAGCCAGGG - Intergenic
1002057699 5:176608265-176608287 CTGTTGCTTGGGAGGAACCTTGG - Intronic
1003440803 6:6139795-6139817 CTCTTTCTGGGCAGGAACCATGG + Intergenic
1003555978 6:7140915-7140937 CTGTTTCTGGGGAGGGGCGAGGG + Intronic
1005600304 6:27420102-27420124 CTGGTTGTGGAGAGTAACCAGGG - Intergenic
1008976838 6:57437052-57437074 CTGCTTCTGGGGAGGCATCAGGG + Intronic
1009871770 6:69461524-69461546 GTGTCTCTGGGGAGAGACCAAGG + Intergenic
1012625321 6:101398373-101398395 CTACTTCTGGGTAGCAATCAAGG + Intergenic
1014673337 6:124334314-124334336 CTCTGTCTGGGGAGCAGGCAAGG - Intronic
1014898040 6:126927918-126927940 CTGTTTCTGCGCAGCCTCCAGGG + Intergenic
1015608978 6:134993862-134993884 TTGTTTAAGGGGAGTAACCATGG - Exonic
1016346758 6:143121608-143121630 GTGTGTCTGGTTAGCAACCAGGG + Intronic
1016669170 6:146681352-146681374 CTGTTTCTGGGGAGGCCTCAGGG - Intronic
1019341550 7:511074-511096 CTGGGCCTGGGGGGCAACCAGGG + Intronic
1022549645 7:31227023-31227045 CATTTTCTGGGGAGAAATCAAGG + Intergenic
1022971212 7:35519089-35519111 CTGCTTCTGGCGAGCATCCAAGG + Intergenic
1023156298 7:37255984-37256006 CTGTTTCTGGGGAGCAGAGGAGG - Intronic
1024041814 7:45561749-45561771 CTGCTTCTGGGGAGCCCTCAGGG + Intergenic
1025026770 7:55522726-55522748 CTGTCTCTGCGGAGCAGCCCTGG - Intronic
1029111170 7:98213674-98213696 CTGCTCTTGGGGAGCAACCCAGG - Intergenic
1036660879 8:10707739-10707761 CTGTTTTTGAGGAGAAACCTAGG + Intronic
1037779208 8:21856159-21856181 CTGTACCTGGGGAGCAGCCATGG + Intergenic
1038224061 8:25638505-25638527 AGGTTTCTGGGGAGCAAAAAAGG - Intergenic
1039439794 8:37587175-37587197 CTGAGTCTGAGGAGGAACCAAGG - Intergenic
1039638552 8:39193861-39193883 CTGCTTCTGTGGAGGAGCCATGG + Intronic
1040580787 8:48697112-48697134 CTGTAAATGGGGAGCAGCCACGG - Intergenic
1041148481 8:54905907-54905929 GTGTTTGTGGGGAGAAACCATGG + Intergenic
1041454979 8:58049176-58049198 ATGTTTCTGGGGAGTAAGCTTGG + Intronic
1041683507 8:60619404-60619426 CTGCAACTGGGGAGAAACCAGGG - Intronic
1042197260 8:66241697-66241719 CTGCTTCTGGGGAGGACTCAGGG - Intergenic
1051608340 9:18938358-18938380 CTGTTTCTGGGGAGGCCTCAGGG + Intronic
1051869188 9:21716675-21716697 CTGCTTCTGGGGAGGCCCCAGGG - Intergenic
1055680870 9:78713941-78713963 TTGTTTCTGGGGAACAAACAGGG - Intergenic
1056109187 9:83377695-83377717 CTGCTTCTGGGGAGGCATCAGGG - Intronic
1056137916 9:83647470-83647492 CTGACTCTGGTGAGCAGCCAGGG + Intergenic
1058701064 9:107600630-107600652 CTTTCTCTGGGGAACCACCAGGG + Intergenic
1061397852 9:130353197-130353219 ATGTTTATGGTGAGCAGCCAGGG + Intronic
1062366744 9:136213486-136213508 ATGTTTTTGGGGAGAAACCTTGG - Intronic
1062737837 9:138148089-138148111 TTGTTTCTGGGGAGAGACCCTGG + Intergenic
1062738253 9:138150539-138150561 TTGTTTCTGGGGAGAGACCCTGG + Intergenic
1203655874 Un_KI270752v1:24173-24195 TTGTTTCTGGGGATCAACCCAGG + Intergenic
1188621167 X:32225801-32225823 CTGTTTCTGGGGAGGCCTCAGGG - Intronic
1190261632 X:48801462-48801484 CGGTGTCTGGAGAGCAAGCAAGG - Intronic
1192635670 X:72814249-72814271 CTATTTCTGGGAAGCAAGCAAGG - Intronic
1192646044 X:72906554-72906576 CTATTTCTGGGAAGCAAGCAAGG + Intronic
1197728246 X:129790728-129790750 CTGTTTCTGTGAGGTAACCAGGG + Intronic
1200286600 X:154828721-154828743 CTGTGTCTAGGAAGCAACCTTGG - Intronic
1200779862 Y:7204945-7204967 CTGTTTCTGGGGAATTTCCAGGG - Intergenic
1200968195 Y:9120555-9120577 TTGTTTCTGGGGAGAAATCCTGG + Intergenic
1201929004 Y:19320628-19320650 CTGCTTCTGGTTAGCAAACAAGG - Intergenic
1202142548 Y:21743519-21743541 TTGTTTCTGGGGAGAAATCCTGG - Intergenic
1202144310 Y:21762099-21762121 TTGTTTCTGGGGAGAAATCCTGG + Intergenic