ID: 969423135

View in Genome Browser
Species Human (GRCh38)
Location 4:7108776-7108798
Sequence CGGGGGACAGGCTGGACAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969423135_969423141 -9 Left 969423135 4:7108776-7108798 CCTGCTGTCCAGCCTGTCCCCCG No data
Right 969423141 4:7108790-7108812 TGTCCCCCGGGCAGCAGTGGCGG No data
969423135_969423145 -5 Left 969423135 4:7108776-7108798 CCTGCTGTCCAGCCTGTCCCCCG No data
Right 969423145 4:7108794-7108816 CCCCGGGCAGCAGTGGCGGGTGG No data
969423135_969423148 10 Left 969423135 4:7108776-7108798 CCTGCTGTCCAGCCTGTCCCCCG No data
Right 969423148 4:7108809-7108831 GCGGGTGGTGTCTGACTTTGAGG No data
969423135_969423149 11 Left 969423135 4:7108776-7108798 CCTGCTGTCCAGCCTGTCCCCCG No data
Right 969423149 4:7108810-7108832 CGGGTGGTGTCTGACTTTGAGGG No data
969423135_969423142 -8 Left 969423135 4:7108776-7108798 CCTGCTGTCCAGCCTGTCCCCCG No data
Right 969423142 4:7108791-7108813 GTCCCCCGGGCAGCAGTGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969423135 Original CRISPR CGGGGGACAGGCTGGACAGC AGG (reversed) Intergenic
No off target data available for this crispr