ID: 969423138

View in Genome Browser
Species Human (GRCh38)
Location 4:7108784-7108806
Sequence CTGCTGCCCGGGGGACAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969423138_969423151 26 Left 969423138 4:7108784-7108806 CCAGCCTGTCCCCCGGGCAGCAG No data
Right 969423151 4:7108833-7108855 CCAGCTTACTGCCTGCTCCCTGG No data
969423138_969423149 3 Left 969423138 4:7108784-7108806 CCAGCCTGTCCCCCGGGCAGCAG No data
Right 969423149 4:7108810-7108832 CGGGTGGTGTCTGACTTTGAGGG No data
969423138_969423148 2 Left 969423138 4:7108784-7108806 CCAGCCTGTCCCCCGGGCAGCAG No data
Right 969423148 4:7108809-7108831 GCGGGTGGTGTCTGACTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969423138 Original CRISPR CTGCTGCCCGGGGGACAGGC TGG (reversed) Intergenic