ID: 969423140

View in Genome Browser
Species Human (GRCh38)
Location 4:7108788-7108810
Sequence GCCACTGCTGCCCGGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969423140_969423152 28 Left 969423140 4:7108788-7108810 CCTGTCCCCCGGGCAGCAGTGGC No data
Right 969423152 4:7108839-7108861 TACTGCCTGCTCCCTGGTGCAGG No data
969423140_969423148 -2 Left 969423140 4:7108788-7108810 CCTGTCCCCCGGGCAGCAGTGGC No data
Right 969423148 4:7108809-7108831 GCGGGTGGTGTCTGACTTTGAGG No data
969423140_969423149 -1 Left 969423140 4:7108788-7108810 CCTGTCCCCCGGGCAGCAGTGGC No data
Right 969423149 4:7108810-7108832 CGGGTGGTGTCTGACTTTGAGGG No data
969423140_969423151 22 Left 969423140 4:7108788-7108810 CCTGTCCCCCGGGCAGCAGTGGC No data
Right 969423151 4:7108833-7108855 CCAGCTTACTGCCTGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969423140 Original CRISPR GCCACTGCTGCCCGGGGGAC AGG (reversed) Intergenic