ID: 969423147

View in Genome Browser
Species Human (GRCh38)
Location 4:7108796-7108818
Sequence CACCACCCGCCACTGCTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969423147_969423151 14 Left 969423147 4:7108796-7108818 CCGGGCAGCAGTGGCGGGTGGTG No data
Right 969423151 4:7108833-7108855 CCAGCTTACTGCCTGCTCCCTGG No data
969423147_969423152 20 Left 969423147 4:7108796-7108818 CCGGGCAGCAGTGGCGGGTGGTG No data
Right 969423152 4:7108839-7108861 TACTGCCTGCTCCCTGGTGCAGG No data
969423147_969423149 -9 Left 969423147 4:7108796-7108818 CCGGGCAGCAGTGGCGGGTGGTG No data
Right 969423149 4:7108810-7108832 CGGGTGGTGTCTGACTTTGAGGG No data
969423147_969423148 -10 Left 969423147 4:7108796-7108818 CCGGGCAGCAGTGGCGGGTGGTG No data
Right 969423148 4:7108809-7108831 GCGGGTGGTGTCTGACTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969423147 Original CRISPR CACCACCCGCCACTGCTGCC CGG (reversed) Intergenic
No off target data available for this crispr