ID: 969423149

View in Genome Browser
Species Human (GRCh38)
Location 4:7108810-7108832
Sequence CGGGTGGTGTCTGACTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969423138_969423149 3 Left 969423138 4:7108784-7108806 CCAGCCTGTCCCCCGGGCAGCAG No data
Right 969423149 4:7108810-7108832 CGGGTGGTGTCTGACTTTGAGGG No data
969423135_969423149 11 Left 969423135 4:7108776-7108798 CCTGCTGTCCAGCCTGTCCCCCG No data
Right 969423149 4:7108810-7108832 CGGGTGGTGTCTGACTTTGAGGG No data
969423147_969423149 -9 Left 969423147 4:7108796-7108818 CCGGGCAGCAGTGGCGGGTGGTG No data
Right 969423149 4:7108810-7108832 CGGGTGGTGTCTGACTTTGAGGG No data
969423146_969423149 -8 Left 969423146 4:7108795-7108817 CCCGGGCAGCAGTGGCGGGTGGT No data
Right 969423149 4:7108810-7108832 CGGGTGGTGTCTGACTTTGAGGG No data
969423144_969423149 -7 Left 969423144 4:7108794-7108816 CCCCGGGCAGCAGTGGCGGGTGG No data
Right 969423149 4:7108810-7108832 CGGGTGGTGTCTGACTTTGAGGG No data
969423143_969423149 -6 Left 969423143 4:7108793-7108815 CCCCCGGGCAGCAGTGGCGGGTG No data
Right 969423149 4:7108810-7108832 CGGGTGGTGTCTGACTTTGAGGG No data
969423134_969423149 12 Left 969423134 4:7108775-7108797 CCCTGCTGTCCAGCCTGTCCCCC No data
Right 969423149 4:7108810-7108832 CGGGTGGTGTCTGACTTTGAGGG No data
969423140_969423149 -1 Left 969423140 4:7108788-7108810 CCTGTCCCCCGGGCAGCAGTGGC No data
Right 969423149 4:7108810-7108832 CGGGTGGTGTCTGACTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969423149 Original CRISPR CGGGTGGTGTCTGACTTTGA GGG Intergenic
No off target data available for this crispr