ID: 969423151

View in Genome Browser
Species Human (GRCh38)
Location 4:7108833-7108855
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969423147_969423151 14 Left 969423147 4:7108796-7108818 CCGGGCAGCAGTGGCGGGTGGTG No data
Right 969423151 4:7108833-7108855 CCAGCTTACTGCCTGCTCCCTGG No data
969423144_969423151 16 Left 969423144 4:7108794-7108816 CCCCGGGCAGCAGTGGCGGGTGG No data
Right 969423151 4:7108833-7108855 CCAGCTTACTGCCTGCTCCCTGG No data
969423143_969423151 17 Left 969423143 4:7108793-7108815 CCCCCGGGCAGCAGTGGCGGGTG No data
Right 969423151 4:7108833-7108855 CCAGCTTACTGCCTGCTCCCTGG No data
969423138_969423151 26 Left 969423138 4:7108784-7108806 CCAGCCTGTCCCCCGGGCAGCAG No data
Right 969423151 4:7108833-7108855 CCAGCTTACTGCCTGCTCCCTGG No data
969423140_969423151 22 Left 969423140 4:7108788-7108810 CCTGTCCCCCGGGCAGCAGTGGC No data
Right 969423151 4:7108833-7108855 CCAGCTTACTGCCTGCTCCCTGG No data
969423146_969423151 15 Left 969423146 4:7108795-7108817 CCCGGGCAGCAGTGGCGGGTGGT No data
Right 969423151 4:7108833-7108855 CCAGCTTACTGCCTGCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type