ID: 969423323

View in Genome Browser
Species Human (GRCh38)
Location 4:7109652-7109674
Sequence CCCTTGCTATGTGCCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969423311_969423323 30 Left 969423311 4:7109599-7109621 CCCCTGAGCAGGGTTAGGTGGAA No data
Right 969423323 4:7109652-7109674 CCCTTGCTATGTGCCCTGGGAGG No data
969423313_969423323 28 Left 969423313 4:7109601-7109623 CCTGAGCAGGGTTAGGTGGAAGT No data
Right 969423323 4:7109652-7109674 CCCTTGCTATGTGCCCTGGGAGG No data
969423312_969423323 29 Left 969423312 4:7109600-7109622 CCCTGAGCAGGGTTAGGTGGAAG No data
Right 969423323 4:7109652-7109674 CCCTTGCTATGTGCCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969423323 Original CRISPR CCCTTGCTATGTGCCCTGGG AGG Intergenic
No off target data available for this crispr