ID: 969435395

View in Genome Browser
Species Human (GRCh38)
Location 4:7186340-7186362
Sequence GTGGCAGGCACTTGGAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969435395_969435414 28 Left 969435395 4:7186340-7186362 CCTGGCTTCCAAGTGCCTGCCAC No data
Right 969435414 4:7186391-7186413 GACGCTGGGCAGACCTGGGGAGG No data
969435395_969435412 24 Left 969435395 4:7186340-7186362 CCTGGCTTCCAAGTGCCTGCCAC No data
Right 969435412 4:7186387-7186409 AGAGGACGCTGGGCAGACCTGGG No data
969435395_969435413 25 Left 969435395 4:7186340-7186362 CCTGGCTTCCAAGTGCCTGCCAC No data
Right 969435413 4:7186388-7186410 GAGGACGCTGGGCAGACCTGGGG No data
969435395_969435408 13 Left 969435395 4:7186340-7186362 CCTGGCTTCCAAGTGCCTGCCAC No data
Right 969435408 4:7186376-7186398 CCTGATGCCTCAGAGGACGCTGG No data
969435395_969435404 6 Left 969435395 4:7186340-7186362 CCTGGCTTCCAAGTGCCTGCCAC No data
Right 969435404 4:7186369-7186391 TGGGACCCCTGATGCCTCAGAGG No data
969435395_969435411 23 Left 969435395 4:7186340-7186362 CCTGGCTTCCAAGTGCCTGCCAC No data
Right 969435411 4:7186386-7186408 CAGAGGACGCTGGGCAGACCTGG No data
969435395_969435409 14 Left 969435395 4:7186340-7186362 CCTGGCTTCCAAGTGCCTGCCAC No data
Right 969435409 4:7186377-7186399 CTGATGCCTCAGAGGACGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969435395 Original CRISPR GTGGCAGGCACTTGGAAGCC AGG (reversed) Intergenic
No off target data available for this crispr