ID: 969436831

View in Genome Browser
Species Human (GRCh38)
Location 4:7193433-7193455
Sequence CAGAACCTTCGGAAGCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 132}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969436819_969436831 16 Left 969436819 4:7193394-7193416 CCCACTGGCCTCCAGGTCTTGGG 0: 1
1: 0
2: 3
3: 23
4: 272
Right 969436831 4:7193433-7193455 CAGAACCTTCGGAAGCCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 132
969436823_969436831 8 Left 969436823 4:7193402-7193424 CCTCCAGGTCTTGGGTTACGGAG 0: 1
1: 0
2: 0
3: 4
4: 69
Right 969436831 4:7193433-7193455 CAGAACCTTCGGAAGCCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 132
969436813_969436831 29 Left 969436813 4:7193381-7193403 CCTCCGATACTCCCCCACTGGCC 0: 1
1: 0
2: 0
3: 8
4: 133
Right 969436831 4:7193433-7193455 CAGAACCTTCGGAAGCCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 132
969436825_969436831 5 Left 969436825 4:7193405-7193427 CCAGGTCTTGGGTTACGGAGGAG 0: 1
1: 0
2: 1
3: 8
4: 101
Right 969436831 4:7193433-7193455 CAGAACCTTCGGAAGCCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 132
969436821_969436831 15 Left 969436821 4:7193395-7193417 CCACTGGCCTCCAGGTCTTGGGT 0: 1
1: 0
2: 2
3: 28
4: 305
Right 969436831 4:7193433-7193455 CAGAACCTTCGGAAGCCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 132
969436817_969436831 17 Left 969436817 4:7193393-7193415 CCCCACTGGCCTCCAGGTCTTGG 0: 1
1: 0
2: 4
3: 49
4: 510
Right 969436831 4:7193433-7193455 CAGAACCTTCGGAAGCCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 132
969436816_969436831 18 Left 969436816 4:7193392-7193414 CCCCCACTGGCCTCCAGGTCTTG 0: 1
1: 0
2: 4
3: 34
4: 382
Right 969436831 4:7193433-7193455 CAGAACCTTCGGAAGCCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 132
969436814_969436831 26 Left 969436814 4:7193384-7193406 CCGATACTCCCCCACTGGCCTCC 0: 1
1: 0
2: 0
3: 27
4: 493
Right 969436831 4:7193433-7193455 CAGAACCTTCGGAAGCCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969436831 Original CRISPR CAGAACCTTCGGAAGCCTGC AGG Intronic
900201603 1:1410091-1410113 CAGAAACTGCGGAAGGCCGCAGG + Intergenic
900368491 1:2321104-2321126 CAGAGCCCTGGGAAGCCTGTGGG - Intergenic
900640972 1:3687906-3687928 CAGAACCTTCGGACACTTGGGGG + Intronic
901120612 1:6890111-6890133 CAGAGCCTCCGGAAGGCTCCTGG - Intronic
902075342 1:13780449-13780471 AAGAACCTTCTGCAGCATGCAGG - Exonic
902483479 1:16725229-16725251 CAGAAGCTGCAGAAGCCGGCGGG - Intergenic
903053493 1:20618831-20618853 TAGAACCTTGGGAAGGCTGATGG - Exonic
907120803 1:52006528-52006550 CAAAAACTGCGGAAGCCCGCAGG + Intergenic
912608243 1:111015220-111015242 CAGAAACTTTGGAAGAGTGCTGG - Intergenic
916009369 1:160691070-160691092 CAAAAACTGCGGAAGCCTGCAGG + Intronic
924796574 1:247297001-247297023 CAGAACTATCTAAAGCCTGCAGG + Intergenic
1063910134 10:10821096-10821118 CAGAAACCTCGGCAGCTTGCTGG - Intergenic
1067111745 10:43406266-43406288 CAGAACCTTGGAAAGCCTGGAGG - Intronic
1069620014 10:69831524-69831546 CAGAAGCTTGAGAAGCTTGCAGG - Intronic
1071494286 10:86157076-86157098 CAGGACCTCTGGAAGCCTGAAGG + Intronic
1072898710 10:99388944-99388966 CAGAAGCTTCTCAAGACTGCTGG - Intronic
1075896212 10:125997281-125997303 CTGCACCTTCAGAAGCCAGCTGG - Intronic
1076349662 10:129807334-129807356 CAGAACATAAGGAAGCCTCCTGG - Intergenic
1077578533 11:3402504-3402526 CCCAACCTTTGGGAGCCTGCAGG + Intergenic
1077919408 11:6631636-6631658 CAGCAGCTCCTGAAGCCTGCAGG + Exonic
1080410213 11:32016267-32016289 CAGAACCCATGGAAACCTGCAGG + Intronic
1082883305 11:58059109-58059131 CAGGTCCTTCGAAAGCCTGTGGG + Intronic
1084235574 11:67786020-67786042 CCCAACCTTTGGGAGCCTGCAGG + Intergenic
1086772708 11:90789100-90789122 CAGAAACTATGGAAGCCTGAAGG - Intergenic
1087084062 11:94198676-94198698 CACAAGATTCTGAAGCCTGCAGG - Intergenic
1088847632 11:113681552-113681574 CAGAACCATCGGCAGGCAGCTGG - Intergenic
1090932167 11:131307748-131307770 CAGAACTTTCGGCAGCTGGCAGG + Intergenic
1091039324 11:132262086-132262108 CAGAATCCACGGAACCCTGCTGG + Intronic
1091746271 12:2995049-2995071 CAGAACCTTGGGGTTCCTGCCGG + Intronic
1091782217 12:3221023-3221045 CTGAACTTTTGCAAGCCTGCTGG + Intronic
1095804700 12:46305837-46305859 CAGAAACTTTGGAAGCCAGAAGG + Intergenic
1099151811 12:79123693-79123715 CAGAACCTTTAGACACCTGCTGG - Intronic
1102518691 12:113466027-113466049 CAGCACATCCGGAAGCCTGAGGG - Intronic
1108135373 13:47351502-47351524 CAGAACTTTGGGAGGCCTGGTGG - Intergenic
1112772922 13:102811407-102811429 CAGAAACTTTGGAAGCCAGAAGG - Intronic
1113550455 13:111189131-111189153 CAGAAGCCTTGGAAGCCTTCAGG - Intronic
1117912801 14:60650305-60650327 CAGAAGCTTCAGGAACCTGCTGG - Intronic
1122657417 14:103271462-103271484 CAAAACCTTGGGAAGGTTGCTGG - Intergenic
1123700215 15:22908775-22908797 CAGCACTTTGGGAGGCCTGCGGG - Intronic
1125430990 15:39593344-39593366 GAGAACCTTCTGAAGGCTGCAGG + Intronic
1125472920 15:40021865-40021887 CAGCAGCTTCAGAAGCCTCCTGG - Intronic
1126702911 15:51383782-51383804 CAGGACCTCCGGGAGCCGGCGGG + Exonic
1136420708 16:30130962-30130984 CAGAAACAACGGAAGCCAGCAGG - Intergenic
1141637651 16:85323287-85323309 CAGAACCTTCTGAGGGTTGCTGG + Intergenic
1143814357 17:9499798-9499820 CTCACCCTTGGGAAGCCTGCTGG - Intronic
1145020120 17:19423579-19423601 CAGATCCTTCTGAATCCTTCTGG + Intergenic
1145040085 17:19571287-19571309 CAGAACCTTCTGGAACCTTCTGG + Intronic
1147654606 17:42081775-42081797 CAGGTACTTGGGAAGCCTGCTGG - Intergenic
1149202335 17:54201858-54201880 CAGAAACTGCGGAAGGCCGCAGG + Intergenic
1149506330 17:57196960-57196982 CAGTACCTTAGGAAGTCAGCAGG - Intergenic
1150417818 17:65001662-65001684 CAGAAACCTGGGCAGCCTGCTGG + Intergenic
1150793832 17:68222133-68222155 CAGAAACCTGGGGAGCCTGCTGG - Intergenic
1155243236 18:23883157-23883179 CAGATCCTGCAGAACCCTGCAGG + Intronic
1155365198 18:25042587-25042609 CAGCATCTTCTGAAGCCAGCAGG - Intergenic
1157605325 18:48922791-48922813 CAGAAGCATCTGGAGCCTGCAGG + Intronic
1159450229 18:68591708-68591730 CAGACCCTTTGGATGTCTGCAGG + Intergenic
1161527125 19:4763217-4763239 CAGAACCTTCTGGAACCTTCCGG - Intergenic
1165221417 19:34319753-34319775 CAGATCCTTCTGAAGCATGGTGG + Intronic
1167050831 19:47077220-47077242 CAGCACTTTGGGAGGCCTGCGGG + Intronic
1168010021 19:53522481-53522503 CAGAACTTTGGGAAGCCGACGGG - Intronic
926051791 2:9749829-9749851 CAGAACCTATGGGAACCTGCAGG - Intergenic
927100938 2:19787301-19787323 GAGAACCTTAGGAAGCATGCAGG + Intergenic
932615621 2:73229514-73229536 CTGAACCTCCAGAGGCCTGCGGG - Exonic
933836796 2:86252329-86252351 CAGAACCTCCTGGAGCCTCCTGG - Intronic
934983061 2:98863211-98863233 CAGAAACTTTGGAAGCCAGAAGG + Intronic
937302983 2:120854530-120854552 AAGAACCTTTGGAACCCTGAGGG + Intronic
938270127 2:129962626-129962648 CAGAAACTGCGGAAGGCCGCAGG - Intergenic
938295103 2:130172972-130172994 CAGCACTTTGGGAAGGCTGCTGG + Intronic
938461523 2:131500863-131500885 CAGCACTTTGGGAAGGCTGCTGG - Intergenic
947930933 2:233964659-233964681 CAGAGTCTTCAGAAGCTTGCTGG - Exonic
1168916483 20:1492430-1492452 CAGAACCTTCTGAAGCATGAGGG - Intergenic
1170695254 20:18652020-18652042 CAGAAGCCATGGAAGCCTGCTGG - Intronic
1170818195 20:19733011-19733033 AAGACACTTCGGAAGCATGCAGG + Intergenic
1171402453 20:24884195-24884217 CAGAAACTTTGGAAGCCAGAAGG + Intergenic
1172481360 20:35273762-35273784 CAGGACCTTTGGGAGCCTTCTGG - Intronic
1175899708 20:62355163-62355185 CATGACCCTCGGAGGCCTGCTGG - Intronic
1175957646 20:62619475-62619497 CAGAACTCTTCGAAGCCTGCAGG - Intergenic
1176164527 20:63665732-63665754 TAGAACCCTCGGGATCCTGCTGG + Intronic
1179183153 21:39062192-39062214 TAGAGCCTGGGGAAGCCTGCAGG + Intergenic
1179901158 21:44395513-44395535 CAGAACCGTCGGGAGCTGGCAGG + Exonic
1181965776 22:26655930-26655952 CAGAACTTTGGGAAGCCTGGGGG - Intergenic
1183051420 22:35264932-35264954 CTGACCCTTCGGGAGCCTGATGG + Exonic
1184840746 22:47051052-47051074 CAGAACCCACGGAAGCCCCCTGG - Intronic
949363961 3:3260693-3260715 CAGAGCCTTTTGAAGCCTGATGG - Intergenic
952124980 3:30290267-30290289 CATGACCTTCGGAAGCATGGTGG + Intergenic
952768525 3:36976482-36976504 CTGAACCTCCAGAGGCCTGCGGG + Intergenic
954448136 3:50557563-50557585 CAAACCCTTCTGAACCCTGCGGG + Intergenic
954896315 3:53978175-53978197 CAAAAACTGCGGAAGGCTGCAGG - Intergenic
961302935 3:125933778-125933800 CCCAACCTTTGGGAGCCTGCAGG - Intronic
961884936 3:130090799-130090821 CAGAACCTTCTGGAACCTTCTGG - Intronic
963843927 3:150135525-150135547 GAGAACATTCTGTAGCCTGCTGG - Intergenic
968468241 4:764010-764032 CAGAACCATCCGGAGGCTGCAGG + Intronic
968986245 4:3876197-3876219 CAGAACTCTTGGAACCCTGCGGG + Intergenic
968994326 4:3936196-3936218 CCCAACCTTTGGGAGCCTGCAGG + Intergenic
969184152 4:5463085-5463107 CAGAGGCTTTGGAAGCCTCCGGG - Intronic
969436831 4:7193433-7193455 CAGAACCTTCGGAAGCCTGCAGG + Intronic
969453016 4:7285727-7285749 CAGAAGCTTCCGGAGCATGCTGG + Intronic
975819740 4:78258090-78258112 CAGCACTTTGGGAAGCCTACAGG + Intronic
979722986 4:123924810-123924832 CATAACCATGGGTAGCCTGCTGG + Intergenic
982385180 4:154793622-154793644 TTGAACCGTAGGAAGCCTGCAGG + Intronic
985671563 5:1209445-1209467 CCTGCCCTTCGGAAGCCTGCAGG + Intronic
988380007 5:30487314-30487336 CAAAAACTGCGGAAGGCTGCAGG - Intergenic
990789729 5:59464071-59464093 CAAAAACTGCGGAAGGCTGCAGG + Intronic
992909827 5:81385198-81385220 CAGCACCTTGGGAAGCCAGTGGG + Intronic
995450114 5:112291178-112291200 CAGAGCCTACAAAAGCCTGCTGG + Intronic
1004621857 6:17337610-17337632 CAGCACTTTGGGAAGCCTGGGGG + Intergenic
1016622939 6:146133785-146133807 CAGATCCTTCTGAAGGCAGCAGG - Intronic
1016829149 6:148416591-148416613 CAGACCCCTCAGAGGCCTGCAGG + Intronic
1018945220 6:168343242-168343264 CAGAACATTAGGAAGCAAGCTGG - Intergenic
1019752007 7:2736677-2736699 CAGAAACTGCTGAAGGCTGCAGG - Intronic
1020318312 7:6922814-6922836 CAGAACCTTCTGGAACCTTCTGG - Intergenic
1020318609 7:6924560-6924582 CCCAACCTTTGGGAGCCTGCAGG + Intergenic
1022088127 7:27088357-27088379 CAGGACCTTCGCGACCCTGCGGG - Intergenic
1022164328 7:27742314-27742336 CAAAAACTGTGGAAGCCTGCAGG - Intronic
1023826942 7:44015922-44015944 CAGCACTTTGGGAAGCCGGCAGG + Intergenic
1029738095 7:102475673-102475695 CAGCACTTTGGGAAGCCGGCAGG + Intronic
1029755228 7:102569323-102569345 CAGCACTTTGGGAAGCCAGCAGG + Intronic
1029773176 7:102668403-102668425 CAGCACTTTGGGAAGCCAGCAGG + Intronic
1036382015 8:8241843-8241865 CAGAACCTTCTGGAACCTTCTGG + Intergenic
1036530879 8:9585592-9585614 AATAACCTTCTAAAGCCTGCTGG + Intronic
1037799588 8:22025125-22025147 CAGTACCTGCCGATGCCTGCTGG + Exonic
1040031500 8:42828746-42828768 CAGAAACTTTGGAAGCCAGAAGG - Intergenic
1042189646 8:66172672-66172694 CAGAACCTTTGGGAAACTGCTGG - Intronic
1045239258 8:100384599-100384621 CAGAGCCTGGGGAAGCCTGGCGG - Intronic
1045516280 8:102863582-102863604 CAGGACCTTCGGGCGGCTGCTGG - Intronic
1048072899 8:131040360-131040382 CAGAACCTTGGGGAGGCAGCCGG + Exonic
1049683692 8:143930829-143930851 CAGTACCTTCTGCAGCCCGCAGG - Intronic
1052088934 9:24303001-24303023 CAGAAACTTTGGAAGCCCGAAGG - Intergenic
1052678197 9:31653985-31654007 CATCTCCTTTGGAAGCCTGCAGG + Intergenic
1055345254 9:75328707-75328729 CCGAACCTTCGGCTGCCTTCAGG + Intergenic
1056050355 9:82762225-82762247 CAGGACATTCAGAAGCCTCCAGG - Intergenic
1061116111 9:128613389-128613411 CATAATCTTCGGATGCCAGCAGG - Exonic
1190679327 X:52811434-52811456 CCGACCCTCCGGAAGCCCGCTGG - Intergenic
1192634397 X:72804131-72804153 GAGAACAGTCGGAAGACTGCTGG - Intronic
1192647313 X:72916670-72916692 GAGAACAGTCGGAAGACTGCTGG + Intronic
1195837589 X:109134966-109134988 CAGAAACATTGGAGGCCTGCAGG + Intergenic
1195930047 X:110065348-110065370 CAGAAGCTCAGGAAGGCTGCTGG + Intronic
1199614028 X:149640877-149640899 CACCACTTTCGGAAGCCTGAAGG + Intergenic
1200731627 Y:6749172-6749194 CAAAAACTGCGGAAGGCTGCAGG + Intergenic