ID: 969437560

View in Genome Browser
Species Human (GRCh38)
Location 4:7197388-7197410
Sequence GCATCTCCTGAGTTTAGAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969437558_969437560 10 Left 969437558 4:7197355-7197377 CCTAATAGCAGGGAAGGGGTCTC 0: 1
1: 0
2: 1
3: 3
4: 114
Right 969437560 4:7197388-7197410 GCATCTCCTGAGTTTAGAAGTGG 0: 1
1: 0
2: 0
3: 12
4: 165
969437557_969437560 11 Left 969437557 4:7197354-7197376 CCCTAATAGCAGGGAAGGGGTCT 0: 1
1: 0
2: 0
3: 8
4: 217
Right 969437560 4:7197388-7197410 GCATCTCCTGAGTTTAGAAGTGG 0: 1
1: 0
2: 0
3: 12
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969437560 Original CRISPR GCATCTCCTGAGTTTAGAAG TGG Intronic
901570950 1:10160110-10160132 GCATCTCCAGAGTCTAACAGAGG + Intronic
905548808 1:38819592-38819614 GCCTCTCCTGAGTTGACAGGAGG + Intergenic
905928424 1:41768714-41768736 GCAACTCCTCAGTGTAGAGGAGG - Intronic
906717389 1:47980237-47980259 GCATGTCCTGGGTTCAGGAGTGG - Intronic
908040156 1:60103980-60104002 TCTTCTCCTGAGTTTCAAAGGGG + Intergenic
908310900 1:62882055-62882077 GCATCTGCTGAAATTAAAAGTGG + Intergenic
908416903 1:63922019-63922041 GCATCTCCTGAATACAGAATAGG - Intronic
913385070 1:118250614-118250636 GAATTTCCTGAGTGGAGAAGGGG + Intergenic
913404759 1:118477200-118477222 TCATCTACTAAGTTTCGAAGTGG + Intergenic
914258470 1:145979306-145979328 GCATCTCCAGAGTCTGGAAGAGG - Intergenic
916039763 1:160951924-160951946 TCATCTCCTGGGTTCTGAAGAGG + Intronic
919012917 1:191988422-191988444 GCAGCTGCTGAGGTTGGAAGGGG - Intergenic
922496358 1:226061682-226061704 GCTTCTGCATAGTTTAGAAGAGG - Intergenic
922604467 1:226880885-226880907 AGGTCTCCTGAGGTTAGAAGTGG - Intronic
923415702 1:233757685-233757707 GCCTCTCTTGGTTTTAGAAGAGG + Intergenic
1063154863 10:3369584-3369606 ACATCTCCTGCCTTTAGAAACGG + Intergenic
1063818987 10:9812744-9812766 GCATCTCTTGAATTTGGAGGTGG - Intergenic
1067131370 10:43568547-43568569 TCAACTACTTAGTTTAGAAGAGG - Intronic
1067133052 10:43583734-43583756 GTATCTCCTGATAATAGAAGTGG + Intergenic
1067789346 10:49276097-49276119 GCATCACCTGAGGGCAGAAGAGG - Intergenic
1068787806 10:60996039-60996061 CCATCTCCTGAGTTGTGAATTGG - Intronic
1069843674 10:71355877-71355899 GCATTTCCTGAGTTTCCAAGGGG - Intronic
1070568612 10:77623218-77623240 TCATCTCCTGACTTTAAAAAGGG + Intronic
1074119176 10:110480679-110480701 GCACCTGCTGAGATTAGAGGGGG - Intergenic
1076469375 10:130708040-130708062 GCAGCTCCTGAGATTGGAACAGG + Intergenic
1078427841 11:11265899-11265921 TCATATCCTGAGTACAGAAGGGG + Intergenic
1081044329 11:38252029-38252051 GCAACACCTGAATTTTGAAGGGG + Intergenic
1082786036 11:57317349-57317371 GCCTTTTCTGAGTTCAGAAGAGG - Intronic
1083105015 11:60348931-60348953 TCTTCTCCTGAGTATAGAAGTGG - Intronic
1084071050 11:66735108-66735130 GCATCACCTGAGGTCAGGAGTGG + Intergenic
1084254910 11:67934107-67934129 TCTTCTCCTGACTTTAGATGTGG - Intergenic
1084817976 11:71661807-71661829 TCTTCTCCTGACTTTAGATGTGG + Intergenic
1084936899 11:72591687-72591709 GCAGGTCCTGATTTTAGAATTGG + Intronic
1085026287 11:73238434-73238456 TCACCCCCTGAGGTTAGAAGAGG + Intergenic
1085193377 11:74648933-74648955 TCCTCTCCTGAGTTTCCAAGGGG - Intronic
1086341901 11:85855445-85855467 TCATCTCCTGGGTGGAGAAGAGG - Exonic
1088226784 11:107629309-107629331 GCATCACCTTATTTTAGAACTGG + Intronic
1088266318 11:107991255-107991277 GAGTCTACTGACTTTAGAAGAGG - Intergenic
1090932234 11:131308404-131308426 ACATATTTTGAGTTTAGAAGAGG + Intergenic
1092424968 12:8367556-8367578 TCTTCTCCTGACTTTAGATGTGG - Intergenic
1093198013 12:16151655-16151677 TAATCCCCTGAGCTTAGAAGGGG - Intergenic
1094435075 12:30412388-30412410 GCATCTCCTCACTTAAGCAGGGG + Intergenic
1094563581 12:31579250-31579272 GCACATCCTGAGGATAGAAGAGG - Intronic
1097003899 12:55901352-55901374 GTATCTCCTGAGTTTGGCACAGG - Intergenic
1098673984 12:73266179-73266201 GGAGCTCCTGAGGTGAGAAGTGG + Intergenic
1098871931 12:75826193-75826215 GCATTGCCTGAGTGTAGAATCGG - Intergenic
1099261270 12:80385700-80385722 GTAACTCCTGAGGTTAGAAGCGG + Intergenic
1099875571 12:88401790-88401812 GCATAACCAGAGTTTATAAGAGG + Intergenic
1100460540 12:94795172-94795194 CCTTCTCCTGAGTTAAGACGGGG + Intergenic
1102232906 12:111275838-111275860 GCCTCTCCTGAGGTTCAAAGGGG - Intronic
1102741293 12:115209677-115209699 GCATCACCTGTGCTTAAAAGTGG + Intergenic
1103046708 12:117741578-117741600 ACATCTCTTGAGTCCAGAAGTGG + Intronic
1105982405 13:25532091-25532113 GCACTCCCTAAGTTTAGAAGTGG - Intronic
1106798484 13:33231889-33231911 GCATCTGCAGATTTTAGAATGGG - Intronic
1108886810 13:55195942-55195964 ACATGTCTTGAGTTTAGATGTGG - Intergenic
1111757947 13:92422233-92422255 GCATCTCCTGAGGTTTACAGGGG - Intronic
1112205783 13:97322145-97322167 GCACCTCCTGAGGGTGGAAGCGG - Intronic
1118708948 14:68504054-68504076 GCATCTACCGACTTCAGAAGGGG - Intronic
1120077277 14:80173072-80173094 GCATCTCAGCAGTGTAGAAGTGG + Intergenic
1120623150 14:86791079-86791101 ACATCTACTGATTTTAAAAGTGG + Intergenic
1120704368 14:87732051-87732073 TCATCTCCTGAGCGGAGAAGAGG + Intergenic
1121027917 14:90630036-90630058 CCATGTCCTGAGATTAGGAGTGG - Intronic
1121160119 14:91730336-91730358 GTCTCTCCTGAGTTTATAGGTGG - Intronic
1123689703 15:22827784-22827806 GCATCTCCAAAGTCTAGAACTGG - Exonic
1123824456 15:24067484-24067506 GCATCTCCTCTGTTTTCAAGTGG - Intergenic
1124142646 15:27090389-27090411 GCAGCACCTGCGTTTAGGAGTGG + Intronic
1124243919 15:28053941-28053963 GACCCTCATGAGTTTAGAAGGGG - Intronic
1124820282 15:33038319-33038341 GCATCTTCTGTGTTTAAAAATGG + Intronic
1125136158 15:36345731-36345753 GCAACACCTGAATTTTGAAGGGG - Intergenic
1126285859 15:47009667-47009689 GCATGTCCTGGGGTTGGAAGAGG + Intergenic
1128465903 15:67911037-67911059 GCATCAGATGAGTCTAGAAGAGG - Intergenic
1131365136 15:91832732-91832754 GCAACTCCTGAATTTTAAAGGGG - Intergenic
1132514381 16:359455-359477 GCAGCTCCCGAGTTGGGAAGTGG - Intergenic
1133373270 16:5262474-5262496 TCTTCTCCTGAGTTTAGATGTGG + Intergenic
1139197753 16:64940727-64940749 GCATCTCTGGTGGTTAGAAGAGG - Intergenic
1140469641 16:75206880-75206902 CCATCTCCTGAGCTCAGAGGCGG + Intronic
1141535099 16:84673639-84673661 GCATCTCCTGTATTTAGATGGGG + Intergenic
1143276929 17:5718561-5718583 GCTTCACCTGAAATTAGAAGTGG - Intergenic
1143422059 17:6801172-6801194 GCATCTCCTGTGGGTAGATGAGG - Intronic
1145000935 17:19304225-19304247 GGCTCTCCTGTGTTGAGAAGTGG + Intronic
1145124501 17:20289146-20289168 ACATCTCATGAGTTTATCAGGGG - Intronic
1148898192 17:50852974-50852996 GCATCTCCTGCGTTAGGAACTGG - Intergenic
1149287553 17:55181781-55181803 GTATCTGCTGATTCTAGAAGGGG + Intergenic
1149993001 17:61393172-61393194 CCATCTTCTGAGTTAAAAAGAGG - Intergenic
1150700922 17:67446272-67446294 GCATGTCCTGAGGTCACAAGTGG + Intronic
1152597071 17:81242992-81243014 GCAACTCCTGAATTTTGGAGGGG + Intergenic
1153022761 18:646382-646404 GCATCTACTAAGTTTAGATACGG + Intronic
1153716394 18:7853651-7853673 GCATCTCCATTGATTAGAAGTGG + Intronic
1155631499 18:27899050-27899072 ACATCTGATGAGTTTAGCAGAGG - Intergenic
1156529248 18:37799010-37799032 GCAACACCTGAATTTTGAAGGGG - Intergenic
1161099306 19:2413396-2413418 AGATCTACTGAGTTAAGAAGAGG + Intronic
1167188056 19:47961762-47961784 GCTTCTCCTGCATTTAGAATGGG + Intergenic
926488573 2:13495027-13495049 TCATCTCTTGAGGTTAGAAATGG + Intergenic
926991392 2:18684431-18684453 GCAGCTCATGAATTTAGAGGAGG + Intergenic
927633163 2:24791970-24791992 GACTCCCCTGAGTTTAAAAGAGG - Intronic
931018073 2:58009110-58009132 GCAACTCCTGAATTTTGTAGGGG + Intronic
934902286 2:98170031-98170053 GAATCGCTTGAGTTGAGAAGTGG + Intronic
935119077 2:100165057-100165079 ACATCTCCAGAGTTAAGGAGAGG + Intergenic
937149388 2:119675248-119675270 TCCTCTCCTGAGTGCAGAAGTGG - Intergenic
939226415 2:139370481-139370503 GCATCAGTTGAGTTTAGATGTGG + Intergenic
940714234 2:157201098-157201120 GCAACACCTGAATTTTGAAGGGG + Intergenic
940905383 2:159164574-159164596 CCCTGTGCTGAGTTTAGAAGAGG + Intronic
941206408 2:162578750-162578772 GTAATTCCTGAGTGTAGAAGTGG + Intronic
943949545 2:194114598-194114620 ACATCACCAGAGTTTGGAAGAGG - Intergenic
944638533 2:201698077-201698099 GCATCTTCTGAGTCAAGAACTGG - Intronic
945201871 2:207289899-207289921 GAATCTCCTGAGTCAAGGAGAGG + Intergenic
1168974894 20:1957349-1957371 GCATCCTCTAAGTTTAGCAGAGG - Intergenic
1170749660 20:19134263-19134285 CCTTCTCTTGAGTTTAGAGGTGG - Intergenic
1181639677 22:24189995-24190017 GCATCTCAGGAGTGTTGAAGAGG + Intergenic
1181744811 22:24948646-24948668 GCTTCACCTGAGCCTAGAAGAGG - Intergenic
1182248387 22:28979295-28979317 GCAACTCCTGAGGTTGGACGTGG + Intronic
1182376316 22:29850980-29851002 GCAACACCTGAATTTTGAAGGGG + Intergenic
1184544999 22:45161891-45161913 GCATCACCTGAGGTCAGGAGTGG - Intergenic
950221691 3:11201177-11201199 GGATCCCCTCAGTCTAGAAGGGG + Intronic
950446062 3:13039385-13039407 GCACACCCTGTGTTTAGAAGTGG + Intronic
951552196 3:23885368-23885390 TCATTTCCTGAGGTTAGAACCGG - Intronic
952490647 3:33869037-33869059 GCAACTCCTTAGTTTTGAAGGGG - Exonic
955914376 3:63892062-63892084 GCATGTACAGAGTTTAGCAGAGG + Intronic
956395678 3:68823676-68823698 GCATGTCCTCACTTTATAAGTGG - Intronic
958475801 3:94580004-94580026 ACATCTCTAGAGTTGAGAAGTGG - Intergenic
959933968 3:112011116-112011138 GCATCTTCTCAGTTTAGGACAGG + Intronic
961284431 3:125789670-125789692 TCTTCTCCTGACTTTAGATGTGG + Intergenic
961914137 3:130352682-130352704 GCATCTCCTTAGTGGAGAGGGGG + Intronic
962327370 3:134447185-134447207 GAATCTTCTAACTTTAGAAGTGG - Intergenic
963932492 3:151018200-151018222 TGATCACATGAGTTTAGAAGAGG - Intergenic
969013318 4:4085207-4085229 TCTTCTCCTGAATTTAGATGTGG - Intergenic
969420978 4:7095685-7095707 GCATCTCCCGTGTTTGCAAGTGG - Intergenic
969437560 4:7197388-7197410 GCATCTCCTGAGTTTAGAAGTGG + Intronic
969740532 4:9022599-9022621 CCTTCTCCTGAGTTTAGATGTGG + Intergenic
969799877 4:9555428-9555450 TCTTCTCCTGAGTGTAGATGTGG + Intergenic
972519226 4:39838053-39838075 TCCTCTCCTGGGTTTGGAAGGGG + Exonic
978905200 4:113997033-113997055 GAACCTCCTGAGGTGAGAAGGGG + Intergenic
980755460 4:137153602-137153624 GCTTCAAGTGAGTTTAGAAGCGG - Intergenic
980908379 4:138971546-138971568 GCATCACCTGAGGCTGGAAGAGG + Intergenic
981746687 4:148058958-148058980 GCATTTCCTGTGTTTAGGTGGGG - Intronic
983203595 4:164888270-164888292 GCATCTCTTGAGTTTGGCAGAGG + Intronic
983431271 4:167654734-167654756 GCAGCACCTGAATTTCGAAGGGG - Intergenic
983574733 4:169248879-169248901 GCAACACCTGAGTTTTGGAGCGG - Intronic
984363204 4:178764677-178764699 GCATCTACTGAGTAGAGAAGAGG - Intergenic
984973720 4:185211343-185211365 GCAACTCCTGTTTTTAGAAGTGG + Intronic
987907686 5:24098726-24098748 GCACTTACTGATTTTAGAAGAGG - Intronic
988417687 5:30966792-30966814 GCATTTCCTGGATTTAAAAGAGG - Intergenic
988717252 5:33840511-33840533 TCATCTCCACAGTTGAGAAGAGG - Intronic
991373858 5:65945098-65945120 AAATCTCCTCAGTTTAGGAGTGG + Intronic
992237472 5:74726073-74726095 GCATCTTGTGACTGTAGAAGTGG - Exonic
993584104 5:89701833-89701855 GGATCTCTTGAGTTCAGGAGTGG - Intergenic
996634348 5:125672028-125672050 GCAACACCTGAGTTTTGAATGGG + Intergenic
997119968 5:131164445-131164467 CGATCTCCTGAGATAAGAAGTGG - Intronic
1002841764 6:912602-912624 TGAAGTCCTGAGTTTAGAAGGGG + Intergenic
1002859859 6:1071057-1071079 GTATCACCGGAGTTCAGAAGAGG + Intergenic
1008151831 6:47962553-47962575 GAATCTCGTGAGGTTATAAGGGG + Intronic
1018249038 6:161849892-161849914 GGATCTTCTGAGTGTAAAAGGGG - Intronic
1024574747 7:50754595-50754617 GCACCTTCTGAATTTAGAAAGGG + Intronic
1029071961 7:97906843-97906865 TCTTCTCCTGACTTTAGATGTGG - Intergenic
1030149782 7:106392389-106392411 TAATCACCTTAGTTTAGAAGTGG + Intergenic
1033240927 7:139679359-139679381 GCAACACCTGAATTTTGAAGGGG + Intronic
1034922835 7:155097932-155097954 GCAACACCTGAGTTTACAGGAGG + Intergenic
1036255055 8:7199305-7199327 TCTTCTCCTGACTTTAGATGTGG - Intergenic
1036362434 8:8088202-8088224 TCTTCTCCTGACTTTAGATGTGG + Intergenic
1036896131 8:12636969-12636991 TCTTCTCCTGACTTTAGATGTGG - Intergenic
1040580470 8:48694906-48694928 GCATCTCACCAGTGTAGAAGAGG + Intergenic
1041797682 8:61762650-61762672 ACATCTCCAGAGTTTACCAGGGG + Intergenic
1046734599 8:117763692-117763714 GCATCTTCTGAGTTTCAAAAAGG - Intergenic
1054863593 9:69977284-69977306 GCACCTTCTAATTTTAGAAGGGG + Intergenic
1056292650 9:85159169-85159191 GAAACTCCTGACTTTAGTAGTGG - Intergenic
1057474075 9:95384164-95384186 GCATCTCCCAAGTATAGAAAAGG - Intergenic
1060587649 9:124796379-124796401 ACATTTCCTGAGGTTACAAGAGG - Intronic
1185958845 X:4524158-4524180 TCATTTCTTGAGTTCAGAAGTGG + Intergenic
1186974709 X:14889230-14889252 GCAACACCTGAATTTAGGAGAGG + Intronic
1189308115 X:40002600-40002622 CCATCTCCTGGCTGTAGAAGAGG - Intergenic
1190484030 X:50906477-50906499 ACAACTCCTGAGGCTAGAAGTGG + Intergenic
1190791399 X:53703827-53703849 GGATCACCTGAGGTTAGGAGTGG - Intergenic
1193492597 X:82167486-82167508 GCATTTCCTGAGTTTGAATGTGG - Intergenic
1194031899 X:88828043-88828065 GCAACTCCTGAATTTAGGAGGGG - Intergenic
1195079327 X:101356123-101356145 GCAGCTGCTGAGTCTGGAAGCGG + Exonic
1195218559 X:102724108-102724130 GGAACTCCTGAATTTATAAGTGG + Intronic
1196444028 X:115736178-115736200 AGATCTCCGGATTTTAGAAGCGG - Intergenic
1201747302 Y:17391672-17391694 TCATTTCTTGAGTTCAGAAGTGG + Intergenic