ID: 969441203

View in Genome Browser
Species Human (GRCh38)
Location 4:7217805-7217827
Sequence CTCCGACCTGTGGGAGCCGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 80}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969441199_969441203 -9 Left 969441199 4:7217791-7217813 CCTGTGGGGTGAAGCTCCGACCT 0: 1
1: 0
2: 1
3: 2
4: 77
Right 969441203 4:7217805-7217827 CTCCGACCTGTGGGAGCCGTGGG 0: 1
1: 0
2: 1
3: 7
4: 80
969441198_969441203 3 Left 969441198 4:7217779-7217801 CCACGTGGGAAGCCTGTGGGGTG 0: 1
1: 0
2: 1
3: 13
4: 164
Right 969441203 4:7217805-7217827 CTCCGACCTGTGGGAGCCGTGGG 0: 1
1: 0
2: 1
3: 7
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969441203 Original CRISPR CTCCGACCTGTGGGAGCCGT GGG Intronic
901809918 1:11761813-11761835 TTCCTACCAGTGGGAGCCGGGGG + Exonic
904041801 1:27589843-27589865 CTCCGCCCTGGGGGAGCCAGTGG + Intronic
905804168 1:40863858-40863880 CCCCGACCTGTGGCATCCTTGGG + Intergenic
907133604 1:52118863-52118885 CTCAGTCCTGTGGGACCTGTGGG + Intergenic
917034706 1:170735652-170735674 CCCCAGCCTGTGGGAGCAGTGGG - Intronic
917632199 1:176901491-176901513 CTTCTCCCTGTGGGAGCAGTTGG + Intronic
919797197 1:201328039-201328061 CACCGACCTGTGGGAACAGGAGG - Intronic
1064031504 10:11885987-11886009 CCCCGAACTGTGGGAGGCCTGGG + Intergenic
1073693220 10:105834856-105834878 CTCCCATCTGTGGGAGTTGTGGG + Intergenic
1076722282 10:132397903-132397925 GTACAAGCTGTGGGAGCCGTGGG + Intronic
1076869951 10:133188357-133188379 CTCCAGCGTGTGGGGGCCGTGGG - Intronic
1077473954 11:2777720-2777742 CTCTGACCTCTGAGAGCCCTAGG - Intronic
1077884765 11:6378851-6378873 CCCCGCCCTGTGGAAGACGTAGG - Intergenic
1080902494 11:36509729-36509751 CCCCGACCTGTGGGAAGCGTGGG + Intronic
1080937739 11:36881690-36881712 CTACACCCTGTGGGAGCAGTTGG - Intergenic
1081809466 11:45906936-45906958 CTGAGACCTGTGGGAGATGTCGG + Exonic
1084961157 11:72717399-72717421 CTCAGACCTGGGGGAGCTTTGGG - Intronic
1085937099 11:81159885-81159907 CTCCCGCCTGTGGGAGGCCTAGG - Intergenic
1088579321 11:111299969-111299991 CTCCGACCTCTGCGTGCCCTTGG - Intronic
1088597995 11:111454220-111454242 CTCCCACCTGTGGGGGTCGGAGG - Exonic
1090379868 11:126318973-126318995 CTCCCACCTCTGAGAGCAGTTGG + Intronic
1099599237 12:84711315-84711337 CTGGGACCTTTGGGAGGCGTGGG - Intergenic
1104197826 12:126558141-126558163 CTCCCACCTGTGTGGGCCGCAGG - Intergenic
1107448585 13:40489078-40489100 CTGCGCCCTCTGGGAGCCGGTGG - Intergenic
1112966444 13:105202313-105202335 CTCTGACCTGTGTGGGCCTTAGG - Intergenic
1114702520 14:24693527-24693549 CTGGGACCTGTGGGACCTGTGGG + Intergenic
1123006105 14:105324691-105324713 CTCCGGCCTGTGGAGGCCGGTGG + Intronic
1124125770 15:26937221-26937243 CACCGACTTGGTGGAGCCGTTGG - Exonic
1126466214 15:48963471-48963493 CCCCGCCCTGTGAGAGCCGAAGG - Intergenic
1138188555 16:54995891-54995913 CTCTTACCTGTGGGAGAAGTAGG + Intergenic
1141608793 16:85170034-85170056 CTCCGACCTGTCGGAGCTGTCGG + Intergenic
1143521655 17:7447552-7447574 CTCCGAGCTGTCGTAGCTGTAGG - Exonic
1146404938 17:32528788-32528810 CTCCGGCCTCTGGGAGCTGCCGG - Intronic
1160841339 19:1148161-1148183 CTCTGCCCAGTGGGAGCCGGAGG + Intronic
1163529845 19:17842789-17842811 GTCCGACCTGTGGGCGCCAATGG - Intronic
1163786153 19:19275918-19275940 CTCAGACCTGTGGGGGCAGGTGG - Intergenic
1165699522 19:37926682-37926704 CTCGGTCCTGTGGGAGCGGGTGG + Intronic
1167148260 19:47695065-47695087 CTCCTACCTGTGGCGGCCATGGG - Exonic
1168333186 19:55581075-55581097 CTCCGCCCTCTGGGAGCCCGGGG - Intergenic
925082319 2:1080072-1080094 CACCGCCCTGGGGGACCCGTGGG - Intronic
927844430 2:26464100-26464122 CTCTGACCTGTGGGTGCCGGCGG + Exonic
929699609 2:44150706-44150728 CAGAGACCTGTGGCAGCCGTGGG - Intergenic
937203914 2:120223681-120223703 CGCAGACCTGTGGGGGCCGGCGG + Intergenic
942276407 2:174326836-174326858 CGCCGACCTGGGGGAGGCGGAGG - Intergenic
942601474 2:177644750-177644772 CTACGACATGTGGGAGTTGTGGG - Intronic
943785612 2:191875336-191875358 CTCTGACCTTGGGGAGCCATAGG + Intergenic
948387638 2:237591478-237591500 CTCCGCCCTGTGGGAGTGGGGGG + Intronic
1169131506 20:3168324-3168346 CTCCCACCTGTGGGAAACGCAGG - Intronic
1170588037 20:17750343-17750365 CTCCACCCTGTGTGAGCCCTGGG - Intergenic
1172624344 20:36338661-36338683 CTCTGTCCTTGGGGAGCCGTCGG + Intronic
1175953004 20:62593502-62593524 CTAGGACCTGTGGGACCCGAGGG - Intergenic
1176207082 20:63895066-63895088 CTCCGGCGTGTCGGAGCCGCGGG - Intergenic
1176213034 20:63934518-63934540 TTCCGACCTGCAGGAGGCGTAGG + Exonic
1178366980 21:31996428-31996450 CTCCCACCTGTTGGAGCTGTTGG + Intronic
1179621209 21:42617520-42617542 CACCGACCTGTGGAAGGGGTGGG - Intergenic
1180004411 21:45013420-45013442 CTCACACCTGGGGGAGCTGTGGG + Intergenic
1184769516 22:46589273-46589295 CTCTGATATGGGGGAGCCGTGGG + Intronic
1184769550 22:46589379-46589401 CTCTGATATGGGGGAGCCGTGGG + Intronic
1185229280 22:49670943-49670965 CTCAGCCCTGTGGGAGCAGATGG - Intergenic
1185294942 22:50048561-50048583 CACGGACCTGTGGGAGCCGCTGG + Intronic
1185395207 22:50583176-50583198 CTCTGCCCCGTGGGAGCCGGCGG + Intronic
950620251 3:14199834-14199856 CTCCTACCTGTGTGAGCCTGTGG + Exonic
951981893 3:28575652-28575674 CTCCGACCTGTGCGAGGTGGTGG - Intergenic
955301510 3:57784248-57784270 CTCCAACCTGTGAGAGCTGCTGG + Intronic
958609975 3:96412376-96412398 CTCCCACCTGTGGAGGCCATGGG - Intergenic
961772583 3:129260829-129260851 CTCCTTCCTCTGGGGGCCGTGGG - Intronic
963824107 3:149932723-149932745 CTCCAACCTGTGAGAGCCACAGG - Intronic
969441203 4:7217805-7217827 CTCCGACCTGTGGGAGCCGTGGG + Intronic
971022965 4:22557093-22557115 CTCCAACCTGTGGGAGCTGCTGG + Intergenic
972346039 4:38193121-38193143 CTCAGACCTATGGAACCCGTGGG + Intergenic
993928320 5:93900934-93900956 CTCAGACCAGTGGGTGCTGTCGG - Intronic
1000779615 5:165464820-165464842 CTCCGAGCTGTTGGAGCGGGGGG + Intergenic
1002426481 5:179179690-179179712 ATCCGCCCTGTGGGTGCCTTCGG + Intronic
1002427600 5:179185403-179185425 CTCCGCCCTGTGGGAGCTGCCGG - Intronic
1006670248 6:35725894-35725916 CCCCGAGCTGTGGGAGAAGTGGG - Intronic
1018658247 6:166061325-166061347 CTCCAACCTGTGAGAGCTGCAGG - Intergenic
1019272034 7:155580-155602 CTCTGAGCTCTGGGAGCCATTGG + Intergenic
1020111621 7:5451098-5451120 CTCCAAGCTCTCGGAGCCGTTGG - Intronic
1024530720 7:50390246-50390268 CCCTGACCTCTGGGAGCCCTGGG + Intronic
1029318885 7:99739606-99739628 CTCCTGCCTGTAGGAGCTGTTGG - Intergenic
1030326315 7:108222476-108222498 CTCCAACCTTTGGGAGCAGAAGG - Intronic
1044496801 8:92896541-92896563 CTCCAACCTGTGAGAGCTGCTGG + Intronic
1049176057 8:141193394-141193416 CTCCGATGTGGGTGAGCCGTGGG + Intronic
1049215373 8:141405380-141405402 CTCCGACCTCAGGGACCCGGAGG - Intronic
1050057599 9:1672023-1672045 CTCCAACCTGTGGGAGCTGCTGG - Intergenic
1057547833 9:96031391-96031413 CACAGACCTGTGGGTGCCCTTGG - Intergenic
1062423609 9:136496137-136496159 CTCGGACCAGTCGGAGACGTTGG + Exonic
1195168111 X:102240015-102240037 CTCCAACCTGTGAGAGCTGCTGG - Intergenic
1195190746 X:102447072-102447094 CTCCAACCTGTGAGAGCTGCTGG + Intronic