ID: 969441881

View in Genome Browser
Species Human (GRCh38)
Location 4:7222058-7222080
Sequence GCCCTTTCCCCTTGTCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 185}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969441881_969441888 9 Left 969441881 4:7222058-7222080 CCCACCAGACAAGGGGAAAGGGC 0: 1
1: 0
2: 0
3: 17
4: 185
Right 969441888 4:7222090-7222112 CCTCAGATGATGGAATGAACTGG 0: 1
1: 0
2: 0
3: 14
4: 145
969441881_969441886 -1 Left 969441881 4:7222058-7222080 CCCACCAGACAAGGGGAAAGGGC 0: 1
1: 0
2: 0
3: 17
4: 185
Right 969441886 4:7222080-7222102 CGTTTTGGGACCTCAGATGATGG No data
969441881_969441892 21 Left 969441881 4:7222058-7222080 CCCACCAGACAAGGGGAAAGGGC 0: 1
1: 0
2: 0
3: 17
4: 185
Right 969441892 4:7222102-7222124 GAATGAACTGGGCATGTATGGGG 0: 1
1: 0
2: 2
3: 19
4: 217
969441881_969441889 10 Left 969441881 4:7222058-7222080 CCCACCAGACAAGGGGAAAGGGC 0: 1
1: 0
2: 0
3: 17
4: 185
Right 969441889 4:7222091-7222113 CTCAGATGATGGAATGAACTGGG 0: 1
1: 0
2: 1
3: 20
4: 213
969441881_969441891 20 Left 969441881 4:7222058-7222080 CCCACCAGACAAGGGGAAAGGGC 0: 1
1: 0
2: 0
3: 17
4: 185
Right 969441891 4:7222101-7222123 GGAATGAACTGGGCATGTATGGG 0: 1
1: 0
2: 2
3: 13
4: 134
969441881_969441893 22 Left 969441881 4:7222058-7222080 CCCACCAGACAAGGGGAAAGGGC 0: 1
1: 0
2: 0
3: 17
4: 185
Right 969441893 4:7222103-7222125 AATGAACTGGGCATGTATGGGGG No data
969441881_969441890 19 Left 969441881 4:7222058-7222080 CCCACCAGACAAGGGGAAAGGGC 0: 1
1: 0
2: 0
3: 17
4: 185
Right 969441890 4:7222100-7222122 TGGAATGAACTGGGCATGTATGG 0: 1
1: 0
2: 2
3: 23
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969441881 Original CRISPR GCCCTTTCCCCTTGTCTGGT GGG (reversed) Intronic
901209123 1:7514689-7514711 GCTCATGCCCCTTGGCTGGTTGG - Intronic
901211335 1:7527753-7527775 ACCCTTTCCCCTTAGCTGGTTGG - Intronic
901500354 1:9649180-9649202 GCCCTCTCCCCTTTCCTGGCTGG + Intergenic
902160167 1:14523439-14523461 GCCCTTTCCATGTCTCTGGTAGG - Intergenic
903236250 1:21952613-21952635 TCCCTCTCCCCTTGTGGGGTGGG - Intergenic
903539000 1:24086273-24086295 CCCCCTGCTCCTTGTCTGGTGGG - Intronic
905230769 1:36513839-36513861 GCCCTTTCACCTGTCCTGGTCGG + Intergenic
905485470 1:38292810-38292832 CCCCTTTCCCCTTCTCTGTGTGG + Intergenic
906258555 1:44368787-44368809 CCCCTTTCCCCTTGTCTGCCTGG - Intergenic
907422464 1:54356599-54356621 GCACTTTCCAGTTGTCTGATGGG + Intronic
907552410 1:55315483-55315505 GGCCTTTCTCCTTGGCTTGTAGG + Intergenic
912384646 1:109265200-109265222 GCCTTGTCCCCGTGGCTGGTGGG + Exonic
912483932 1:110008882-110008904 GGCCTTCCCCCATTTCTGGTGGG + Intronic
913087023 1:115448533-115448555 GACCTTACCCTTTGGCTGGTTGG + Intergenic
915335271 1:155137196-155137218 GCCCTTTCCCCTTAGCTTGTTGG - Intronic
918142671 1:181732366-181732388 GCCCTTTCCCCTTGGCAGGAGGG + Exonic
918292527 1:183122593-183122615 GCCATTTCCACTTGGATGGTGGG + Intronic
918410542 1:184253914-184253936 GCTTTTTCCTCATGTCTGGTAGG - Intergenic
919040204 1:192377632-192377654 GCCCTATCACTCTGTCTGGTAGG - Intergenic
922949304 1:229544861-229544883 GGCCTTTTCTCTTGGCTGGTAGG - Intronic
923072341 1:230577563-230577585 GCCCATTCCCCTTCCCTGGCGGG + Intergenic
923384350 1:233451777-233451799 ACCCATTCCCCTCGTCTGCTAGG - Intergenic
1063407573 10:5812485-5812507 GCCTTTTCCTTTTGTTTGGTGGG - Intronic
1063958904 10:11290245-11290267 CCCCTTTCCCCTTGTTCAGTGGG - Intronic
1070392027 10:75979652-75979674 CCCTTTTCCCCTTCTCTGTTTGG + Intronic
1071352908 10:84764378-84764400 GCTGTTTCCCCTTGTCTCATGGG + Intergenic
1073115032 10:101087163-101087185 GCCCATTCCTCTGGGCTGGTGGG + Intergenic
1073717477 10:106123637-106123659 GCCCTTTCTCATTGTCTGCCTGG + Intergenic
1075070938 10:119319461-119319483 GCCATTTTCCCTTGCCTGGCGGG + Intronic
1076299510 10:129414458-129414480 TTCCTTTTCCCTTGGCTGGTAGG + Intergenic
1076829456 10:132986670-132986692 GCCCTTTGCCGTTTTCTGGGAGG + Intergenic
1077169024 11:1158230-1158252 GCAGTTTCCCCTTGTGGGGTTGG + Intronic
1077415213 11:2421562-2421584 GCCCTCGGCCCTTGTCTGGCTGG + Intronic
1079249429 11:18776292-18776314 CCCCTTTTCCCTTCTCTGCTTGG + Intronic
1079393963 11:20045509-20045531 TGCCTTTCTCCTTGTCTGTTTGG - Exonic
1082201509 11:49376643-49376665 GTCTTTTCCCCTAGTCTGTTTGG + Intergenic
1083225805 11:61283784-61283806 GCCTTTCCCTCTTGTCTGGCTGG + Intronic
1083904375 11:65660497-65660519 GGCCTTTGCACTTGTTTGGTCGG + Intronic
1084449833 11:69229937-69229959 GCCATCTCCCCATGTCAGGTAGG - Intergenic
1084661748 11:70550276-70550298 GCCCTTTCCCCATGTCAGTTAGG + Intronic
1085521624 11:77142586-77142608 TCTCTTCCCCCTTGTGTGGTTGG + Intronic
1088846058 11:113669064-113669086 GCCCTTTCCCTTTCTCTGTCTGG - Intergenic
1089667624 11:120030446-120030468 GCCCTTTCCCCTGTTCAGGTTGG - Intergenic
1095105863 12:38232196-38232218 GCACTCTCCCCTTGTCTGCAAGG + Intergenic
1096612388 12:52811157-52811179 TCCATTTCCCTTTGTTTGGTGGG + Intronic
1098163495 12:67670122-67670144 GCGCTCTCTCCTTGTGTGGTTGG + Intergenic
1102299128 12:111758367-111758389 GCCCTTTCTTCTTGTCAGGCAGG - Intronic
1103250664 12:119497239-119497261 GTCCTTCCCCCTGGCCTGGTGGG - Intronic
1103569249 12:121833565-121833587 GCCGTTTCCCCCTGTCAGGTTGG + Intergenic
1106118415 13:26837343-26837365 GCCCTTGCCTCTTGGCTTGTGGG + Intergenic
1107760089 13:43669022-43669044 GCCATTCCTCCTTGTCTTGTAGG - Intronic
1108687498 13:52833421-52833443 GCACATTCCTTTTGTCTGGTTGG + Intergenic
1111371768 13:87328565-87328587 GGTCTTTCTCCTTGTCTTGTAGG + Intergenic
1112749544 13:102567985-102568007 GCTGCTTCCCCTTGTCTGGGAGG + Intergenic
1115956558 14:38787379-38787401 GACCTTTCCTCTTATCTGGTTGG + Intergenic
1118706765 14:68487225-68487247 GGCCTCTCCCCTTGTCTTGCAGG + Intronic
1119386223 14:74259525-74259547 GCCCTTACCCCTTGTAGGCTTGG - Intronic
1123110303 14:105864049-105864071 GCCCTTGCCCCTCGTCTGTGTGG + Intergenic
1123666357 15:22611793-22611815 GCCCTTTCCCCTTGTGCTTTGGG - Intergenic
1124320176 15:28706207-28706229 GCCCTTTCCCCTTGTGCTTTGGG - Intronic
1124482336 15:30089210-30089232 GCCCTTTCCCCTTGTGCTTTGGG + Intronic
1124488794 15:30141312-30141334 GCCCTTTCCCCTTGTGCTTTGGG + Intronic
1124537418 15:30558221-30558243 GCCCTTTCCCCTTGTGCTTTGGG + Intronic
1124543877 15:30610276-30610298 GCCCTTTCCCCTTGTGCTTTGGG + Intronic
1124754734 15:32397011-32397033 GCCCTTTCCCCTTGTGCTTTGGG - Intronic
1124761238 15:32449366-32449388 GCCCTTTCCCCTTGTGCTTTGGG - Intronic
1124777396 15:32599697-32599719 GCCCTTTCCCCTTGTGCTTTGGG + Intronic
1124887109 15:33697390-33697412 GCCCATTCCCCTTCTCTTGAGGG - Intronic
1129056740 15:72825889-72825911 GCCATTTGTCCTTGTCTGGAAGG + Intergenic
1129424020 15:75451823-75451845 CCCCTTCCCCCTCGACTGGTAGG + Intronic
1129687452 15:77694860-77694882 GCCCTCTCTGCCTGTCTGGTAGG - Intronic
1129694405 15:77732546-77732568 ACCCTTTCCCCATGCCTGCTGGG + Intronic
1130079520 15:80720275-80720297 GGCCTTTCCCCTTTCTTGGTGGG + Intronic
1131282862 15:91034785-91034807 GCCCTTTCCCCCTGTATTTTGGG - Intergenic
1131514091 15:93065995-93066017 GCCCGTTCCCCTTCTCTGCCAGG + Intronic
1132991811 16:2799264-2799286 GCCCTCTCTCCTTTTCTGCTAGG + Intergenic
1133303132 16:4795302-4795324 GCCCTCTCCCCTGGGCTGGGCGG + Intronic
1136188168 16:28600427-28600449 GCCTTTTCCCTTTGACTGGAAGG - Intergenic
1136190640 16:28613421-28613443 GCCTTTTCCCTTTGACTGGAAGG - Intronic
1136318465 16:29467296-29467318 GCCTTTTCCCTTTGACTGGAAGG + Exonic
1136433040 16:30206645-30206667 GCCTTTTCCCTTTGACTGGAAGG + Exonic
1138428639 16:56953195-56953217 GACCTTTCGCCTTGACTGGAAGG + Intergenic
1140263634 16:73401621-73401643 GCCCTGTCCCCTTGGCTGGCCGG + Intergenic
1141104639 16:81223392-81223414 GCCCTTTCCCATTCTCTGTCTGG - Intergenic
1141951715 16:87343999-87344021 CCCCTTTCCCTCTGTCTGGTCGG - Intronic
1143523945 17:7461977-7461999 GCCCTTTCCCCTTCTCCCTTAGG + Exonic
1144016985 17:11205626-11205648 GTCCTTTGCCCTTGTCTTTTTGG + Intergenic
1144958057 17:19029552-19029574 GCCCTTTTCCCTAGCCTGGCTGG + Intronic
1144977101 17:19144968-19144990 GCCCTTTTCCCTAGCCTGGCTGG - Intronic
1145862377 17:28221690-28221712 AACCATTCCCCTTGTCCGGTGGG - Intergenic
1147168227 17:38604557-38604579 GCGCTTTGCCCTGGCCTGGTGGG - Intronic
1150130557 17:62666664-62666686 GCCCTTTCCGCTTGTGGGTTGGG + Intronic
1152028009 17:77824256-77824278 TCCCTTACCCTTTGTCTGCTTGG - Intergenic
1152095058 17:78267913-78267935 GGCCATTGCCCTTTTCTGGTGGG + Intergenic
1152987600 18:334704-334726 GCCCTGTCCCCCTGGCTGGAGGG + Intronic
1153339517 18:3960263-3960285 GCCTTTTCCTATTGTCTGCTAGG + Intronic
1153535667 18:6098951-6098973 GCCCTCTCTCCTTATCTGATAGG - Intronic
1155256238 18:24000384-24000406 GGCCTCTCTCCTTGGCTGGTAGG - Intronic
1155467392 18:26152853-26152875 GCCCTTTCACCTTCTGTGATGGG + Intronic
1156244658 18:35285951-35285973 CCCATTTCCCCTTGTCGGATAGG - Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1159932113 18:74323813-74323835 ACCTTCTCCCCTTGTCTGGGTGG + Intronic
1165131607 19:33635718-33635740 GCCTTATGCCCTTGTGTGGTGGG - Intronic
1167240192 19:48338911-48338933 GCCCTTTCCTCTTGTTGGGCTGG - Intronic
1167304697 19:48700960-48700982 GCCATTTCCCCTTTTCTCCTTGG - Intronic
1167444150 19:49527689-49527711 TCCCTTTCCCTTTGTCAGGATGG - Exonic
925710876 2:6739128-6739150 GGCCTCTCTCCTTGGCTGGTAGG - Intergenic
926137290 2:10345875-10345897 GTCCTTGCCCCTTTTGTGGTGGG - Intronic
926637163 2:15194104-15194126 GCTCTTTCTCCTTTTCTTGTGGG - Intronic
927936271 2:27078548-27078570 TCCCTTCCCCCCTGTCTGGCTGG - Exonic
928779839 2:34805416-34805438 ACCCTTTCCCCTTTTCTAGAAGG - Intergenic
931226009 2:60332878-60332900 GGCCTTTCTCCTTGGCTTGTGGG - Intergenic
933694944 2:85210648-85210670 GCCCTTTGTCCTTGTCTGTTAGG + Intronic
935103622 2:100019810-100019832 GCCCTTTCCTCCTCTCTGGGGGG + Intronic
936242648 2:110801163-110801185 GCTATTTTCCCTTGTCTTGTAGG + Intronic
941233881 2:162944894-162944916 TCTCTTTCCCCTAGTCAGGTTGG - Intergenic
945212415 2:207397490-207397512 GCCCCTTCCACTTGACTGGGAGG - Intergenic
946147298 2:217740741-217740763 GAACTTTCCCCTTGGCTGCTGGG - Intronic
1169321330 20:4635445-4635467 GCCCTTTCTCCTGGTCAGGACGG + Intergenic
1171339214 20:24413942-24413964 GCCCTTTCCCATTGGTTAGTTGG - Intergenic
1172589077 20:36105051-36105073 GCCCTTTCTCCTTTTCCGGAAGG - Intronic
1172777425 20:37415596-37415618 GCCCTGGTCCCTGGTCTGGTGGG + Intergenic
1174392194 20:50224540-50224562 GCCCTTTCTCCTGGACTAGTAGG - Intergenic
1176281822 20:64317582-64317604 TCCCTTTCACCTTCTCTGATGGG + Intergenic
1176514737 21:7775420-7775442 ACCCTTTCCCTGTGTATGGTGGG - Intergenic
1176952892 21:15065860-15065882 CTCCTTTTCCCTTGTCTTGTTGG - Intergenic
1178639195 21:34332619-34332641 GGCCTCTCACCTTGGCTGGTAGG + Intergenic
1178648850 21:34405944-34405966 ACCCTTTCCCTGTGTATGGTGGG - Intronic
1183575260 22:38684133-38684155 TCACTTTCCCCTTGTGGGGTAGG + Exonic
1184788699 22:46685707-46685729 GCCCTTTCACCTGATCTGGGTGG + Exonic
1185077276 22:48690168-48690190 GCCCCGTCCCCTTGCCTGGCAGG - Intronic
950062803 3:10086279-10086301 TTTCTTTCCCCTTGTCTTGTAGG + Intronic
953405075 3:42655962-42655984 GCCCTTTCCCTGTGGCAGGTGGG + Intronic
954452277 3:50578218-50578240 CCCCTTTCCCCCTGCCTGGCAGG + Intronic
954636003 3:52071221-52071243 GCCTCTTCCCATTGCCTGGTAGG - Intergenic
957259826 3:77886560-77886582 ATCCTTTCCCCTTGTCTGAATGG - Intergenic
959190569 3:103105320-103105342 TCCCATTCCTCTTGTCTGGAAGG + Intergenic
959332462 3:105023277-105023299 GCCCTCTGCCCTTCCCTGGTTGG - Intergenic
960578618 3:119253081-119253103 GGGCTTTCCCCTTTTCTGCTTGG - Intergenic
962252391 3:133843803-133843825 TCCCTTTCCCACTGTCCGGTGGG + Intronic
962340366 3:134577110-134577132 GCCATCTCCCCTTGTCTGCAGGG + Intergenic
963947566 3:151162885-151162907 TCTGTTTCCCCGTGTCTGGTTGG + Intronic
968468792 4:767070-767092 TCCCCTTCCCCTTTGCTGGTGGG + Exonic
969441881 4:7222058-7222080 GCCCTTTCCCCTTGTCTGGTGGG - Intronic
976283006 4:83343957-83343979 GCCCTTTCCCCATGACTATTAGG + Intergenic
978713092 4:111809320-111809342 GGCCTTTGCCCTTGTCTCCTGGG + Intergenic
980135754 4:128857218-128857240 GCCCCTTGCCACTGTCTGGTAGG + Intronic
981134630 4:141196102-141196124 AAGCTTTCCTCTTGTCTGGTTGG + Intronic
982078252 4:151760854-151760876 GCTCTCTCCCCTAATCTGGTTGG + Exonic
982091655 4:151884782-151884804 GCCCTTGTCCCTTGTCTGCCTGG - Intergenic
988706205 5:33728275-33728297 CCCCTTTCCACTTCTCTCGTAGG - Intronic
990525603 5:56623994-56624016 GCCATTTCCCCTTGTCTACAGGG + Intergenic
990620378 5:57552669-57552691 GCCTTTTCCTTTTGTATGGTTGG + Intergenic
991929537 5:71739017-71739039 GTCCTTTCCCCACGTTTGGTTGG + Intergenic
995920012 5:117300471-117300493 GTACTTTACCCTTGTCTGTTAGG + Intergenic
999296230 5:150461244-150461266 GCTCTGTCTCTTTGTCTGGTTGG + Intergenic
1002537303 5:179883892-179883914 GGCCTTTCCCCTGCTGTGGTCGG + Intronic
1003877306 6:10450316-10450338 GCCCTTTCCCTTCTTCAGGTTGG + Intergenic
1003919137 6:10815595-10815617 GCTCTTTCACCTTGGCTGGAGGG - Intronic
1003980989 6:11389602-11389624 GCCCTTTCTCCTTGTCTTTCTGG + Intergenic
1004519731 6:16350663-16350685 GCCCTTTGCCCTTGGCTCCTGGG + Intronic
1004582426 6:16966927-16966949 GCCACTTCCCTTTGTCTGGGTGG - Intergenic
1006472071 6:34235217-34235239 GGCCTGCCCCTTTGTCTGGTGGG - Intergenic
1007377734 6:41468115-41468137 GCCCTTTCTTCCTGGCTGGTTGG + Intergenic
1007473632 6:42105707-42105729 CCCCTCTCCCCTTGCCTGGGAGG + Exonic
1012999112 6:106004121-106004143 GCCCCTTTCCCTTTTCAGGTAGG - Intergenic
1017245635 6:152221828-152221850 GCCCTTGTCCATTGTCTGGTAGG + Intronic
1017978564 6:159378423-159378445 CACCTTTCACCTTGACTGGTAGG - Intergenic
1019885235 7:3898505-3898527 GCACTTTGCCCTTTTCTGATTGG + Intronic
1019985938 7:4655698-4655720 GCTCTGTCACCTTGTCTGGCAGG - Intergenic
1020052319 7:5089997-5090019 GCCCTTTCCCCTTTAATGGTGGG - Intergenic
1020268452 7:6577569-6577591 TCCCTTTCCCCTTGTGTGTAGGG + Exonic
1021870667 7:25002868-25002890 CCCATTTCCCCTCTTCTGGTGGG - Intergenic
1022397808 7:30006543-30006565 GCTCTTTTCCTTTTTCTGGTAGG + Intergenic
1022791744 7:33696066-33696088 GGCCTTTCTCCTTGGCTTGTAGG - Intergenic
1029280140 7:99430113-99430135 GCCCTTTCCCCTTGACGGGGTGG - Intronic
1030099174 7:105930079-105930101 GCCCATTCCCCCTTTCTGGATGG + Intronic
1030271300 7:107671034-107671056 GCCCTTTCTCCTTTTTTGGTGGG - Intronic
1030946323 7:115726167-115726189 GCACTTTCCCCTGGACTGGATGG + Intergenic
1033767540 7:144510564-144510586 TTCCTTTCCCCTTGTCTGTCTGG - Intronic
1033825488 7:145185077-145185099 TCCCTTTCCCCATTTCTGCTGGG - Intergenic
1033940518 7:146647051-146647073 GCCCTATGCCCTTGTCTCATCGG + Intronic
1034497211 7:151430272-151430294 GCCCCTTCCCCTTTCCTGGGCGG + Intronic
1034513254 7:151553350-151553372 ACCCTCTCCCCTTGCCTGGCGGG + Intergenic
1035889682 8:3329796-3329818 GCCTTCTCTCCTTGTCTGCTAGG + Intronic
1036471460 8:9056319-9056341 GCCTTTTCCCCTTATCTGTTGGG + Intronic
1037497196 8:19451247-19451269 CCCCTTTCTCCTTGCCTGTTGGG + Intronic
1044743104 8:95347606-95347628 GCTCTTTCCTCATGTCTAGTAGG + Intergenic
1044744426 8:95358302-95358324 TCCTTTTCCCCTTGTTTCGTTGG + Intergenic
1050277770 9:4017956-4017978 GGCCTGCCCCCTTGGCTGGTAGG - Intronic
1056829763 9:89906282-89906304 GACCTGTCCCCTTCTCAGGTTGG + Intergenic
1056964102 9:91151939-91151961 GCTCAGTCCCCTTGTGTGGTTGG - Intergenic
1057025259 9:91730289-91730311 GCCCTTTTCCCATGTATGGATGG - Intronic
1057665155 9:97039038-97039060 GCCCTGTCCCTCGGTCTGGTCGG + Intronic
1058111026 9:101030372-101030394 GCCCCTTCTGCTTGTATGGTTGG + Intronic
1059325925 9:113503991-113504013 CCCCCTTCCCCTTGTCTGTCAGG + Intronic
1061964132 9:134003711-134003733 GCCCTGGCCTCTTGTCTGCTAGG + Intergenic
1062393878 9:136344880-136344902 GGCCTTGCCCCTTCTCTGCTGGG - Intronic
1062570468 9:137182778-137182800 GCCCACTCCCCTTGCCTGGTCGG + Intronic
1185986928 X:4845238-4845260 GGCCTCTCCCCTTGACTTGTAGG - Intergenic
1191607232 X:63076131-63076153 GACATTTCCCTTTGGCTGGTGGG + Intergenic
1195292686 X:103444294-103444316 GCCCCCTCCCCTTGTCTGAAGGG - Intergenic
1200121688 X:153794126-153794148 GCCCTTTCCCCGCCCCTGGTGGG + Exonic