ID: 969442670

View in Genome Browser
Species Human (GRCh38)
Location 4:7226614-7226636
Sequence CGGTCTGGATTAGTGGCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969442670_969442676 1 Left 969442670 4:7226614-7226636 CCCGAGGCCACTAATCCAGACCG 0: 1
1: 0
2: 1
3: 6
4: 69
Right 969442676 4:7226638-7226660 CATCTGTCCCCAGCTTTCATAGG 0: 1
1: 0
2: 1
3: 14
4: 182
969442670_969442682 28 Left 969442670 4:7226614-7226636 CCCGAGGCCACTAATCCAGACCG 0: 1
1: 0
2: 1
3: 6
4: 69
Right 969442682 4:7226665-7226687 CTCCCTCAGAGTCACCGCTGAGG 0: 1
1: 0
2: 0
3: 18
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969442670 Original CRISPR CGGTCTGGATTAGTGGCCTC GGG (reversed) Intronic
907132213 1:52107187-52107209 TGGTCTCGACTCGTGGCCTCAGG - Intergenic
907300421 1:53483371-53483393 CAGCCTGGCTGAGTGGCCTCAGG - Intergenic
910515438 1:88054737-88054759 GGGTCTGGAATGGGGGCCTCAGG + Intergenic
910767241 1:90793930-90793952 CAGTATGAATTAGTGGCCTATGG - Intergenic
911146250 1:94555229-94555251 CGTCCTTGATCAGTGGCCTCTGG + Intergenic
916035279 1:160916480-160916502 AGGTCTGGATCCATGGCCTCAGG + Intergenic
922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG + Exonic
924609243 1:245560125-245560147 CGGTCTGGAGTAGGGGACACAGG - Intronic
1068058739 10:52039641-52039663 TGGTGTGGTTTAGAGGCCTCAGG - Intronic
1078022216 11:7665433-7665455 CCGTCTGGATTAGTGGTGGCGGG + Exonic
1080160809 11:29173346-29173368 AGGTCTGTATTAGTTGCCTCTGG + Intergenic
1083355880 11:62065759-62065781 GGGACTGTATTAGTGTCCTCTGG + Intergenic
1084561267 11:69906598-69906620 GTTTCTGGATTTGTGGCCTCAGG + Intergenic
1084763899 11:71294985-71295007 GGGCCTGGAATAGAGGCCTCAGG + Intergenic
1087611053 11:100434396-100434418 CTGTCTGGATTAGTTTCCTAGGG - Intergenic
1091531803 12:1364468-1364490 TGGTCTGGAATGGTGGCCTAAGG - Intronic
1091629479 12:2148824-2148846 CGGTCTGGAGGAGTTGCCTTGGG + Intronic
1097141499 12:56906024-56906046 CTAACTGGATTACTGGCCTCAGG - Intergenic
1098294442 12:68990351-68990373 TGGTCTGGTTTAGTGGACCCTGG + Intergenic
1111972794 13:94934386-94934408 AGGTCTGGCTCAGTTGCCTCAGG - Intergenic
1126170064 15:45687944-45687966 CAGTCTGGATTGGTAGCCCCAGG - Intronic
1128901104 15:71423499-71423521 CGGCCTGGAATGGGGGCCTCAGG + Intronic
1129081218 15:73042668-73042690 AGGTCTGCAGAAGTGGCCTCGGG - Intergenic
1134294489 16:12933507-12933529 TGGTCTGGATTCCTGACCTCAGG + Intronic
1137423187 16:48353742-48353764 GGGTGTGGATTAGCGCCCTCTGG - Exonic
1141040613 16:80669672-80669694 CTGGCTGGCTTTGTGGCCTCAGG + Intronic
1144598001 17:16587824-16587846 CTGTCTGGACCACTGGCCTCAGG + Intergenic
1146072861 17:29700275-29700297 TGATCAGGATTAGTGTCCTCAGG + Intronic
1148621099 17:49035527-49035549 CGGTCTGGGGCAGTGGCCTGCGG + Intronic
1150482227 17:65519475-65519497 CAGTCTGGATAATTGGCCTCTGG + Intergenic
1152516610 17:80828532-80828554 GGGTCGGGGTTAGGGGCCTCAGG - Intronic
1157425678 18:47582381-47582403 CCATCTGGCTGAGTGGCCTCGGG + Intergenic
1163394753 19:17053274-17053296 TGGTCTGGCTTGGAGGCCTCAGG - Intronic
1164977029 19:32581148-32581170 CGGGCTGGATTGGTGGCGCCTGG + Exonic
1166126029 19:40715929-40715951 CAGTCTGGAATAGAGGCATCTGG + Intronic
1167172000 19:47839593-47839615 CGGGCTGGGCTGGTGGCCTCAGG + Exonic
1167275203 19:48533846-48533868 GGGTCTGGATATGTTGCCTCAGG + Intergenic
930230717 2:48841362-48841384 GGGCCTGGAATAGGGGCCTCAGG + Intergenic
935809899 2:106787465-106787487 CAGTCTTGATTAGTGGCCTAGGG + Intergenic
936940436 2:117878784-117878806 GGATCTGGAATGGTGGCCTCAGG + Intergenic
941746010 2:169087794-169087816 GGGCCTGGAATAGGGGCCTCAGG + Intronic
941853861 2:170210960-170210982 CTATTTGGATTATTGGCCTCTGG + Intronic
942887487 2:180944537-180944559 AGGTCTGAATCAGAGGCCTCAGG - Intergenic
946756158 2:222949875-222949897 CGGTCTGTATTAGTGTGCTAGGG - Intergenic
1169395265 20:5223573-5223595 TGGTCTTTATTGGTGGCCTCTGG + Intergenic
1177105135 21:16945982-16946004 GGGTCTGGAATAGGGGCCTCAGG - Intergenic
1181373930 22:22441103-22441125 AGGTCTGGTTGAGTGGCCCCTGG + Intergenic
1184684614 22:46090494-46090516 CGGCCAGGTTCAGTGGCCTCTGG + Intronic
1185402010 22:50623984-50624006 TGGTCTGAATTCCTGGCCTCAGG + Intronic
950477046 3:13221175-13221197 GGGCCTGGAATAGTGGCCTCAGG - Intergenic
951395403 3:22159445-22159467 CGGTCTGGATTATCAGGCTCAGG + Intronic
956012146 3:64843513-64843535 CGCACTGGTTTTGTGGCCTCAGG - Intergenic
956454175 3:69404626-69404648 CTGCCTGGATTATTGACCTCTGG - Intronic
957810510 3:85215265-85215287 GGGTCTGGAATAGGGCCCTCAGG + Intronic
959971396 3:112413904-112413926 AGGGCTGGATGAGTGGACTCTGG + Intergenic
962378853 3:134880621-134880643 CTGTCTGGCCTTGTGGCCTCTGG - Intronic
965348708 3:167586169-167586191 AAATCAGGATTAGTGGCCTCGGG + Intronic
965691990 3:171367320-171367342 AGGACTGGATTAGTGGCCTCAGG + Intronic
969442670 4:7226614-7226636 CGGTCTGGATTAGTGGCCTCGGG - Intronic
969907287 4:10409082-10409104 CTTTCTGGACAAGTGGCCTCAGG - Intergenic
976817029 4:89160657-89160679 CGTTCTGTATTAGTGAGCTCTGG - Intergenic
982622733 4:157727579-157727601 GGGCCTGGAATAGGGGCCTCAGG - Intergenic
994724459 5:103417684-103417706 CAGTATGGATTAGTGGTTTCTGG - Intergenic
1003132447 6:3406578-3406600 TGGACTGGATCAGTGGCCTCTGG - Intronic
1005514193 6:26538606-26538628 CGGTCATGATTAGGGGCCTTGGG + Intronic
1006152861 6:31998580-31998602 CAGTCTGGAGTGTTGGCCTCTGG + Intronic
1006159169 6:32031317-32031339 CAGTCTGGAGTGTTGGCCTCTGG + Intronic
1009744809 6:67798800-67798822 GGGTCTGGAATGGGGGCCTCAGG - Intergenic
1010698571 6:79010367-79010389 TGTTCTGGATTAGTGGACACTGG + Intronic
1011177120 6:84575974-84575996 TGGTCTGGATTTGGGACCTCTGG - Intergenic
1032875343 7:136032540-136032562 CGGTCTGAATTATTGGCATTAGG + Intergenic
1034918513 7:155060203-155060225 GGGTGTGGATTGGTGGTCTCTGG + Intergenic
1040559338 8:48510398-48510420 CAGCCTGGGATAGTGGCCTCCGG - Intergenic
1045041360 8:98227559-98227581 CGGCCTGGAATGGGGGCCTCAGG + Intronic
1048952997 8:139511466-139511488 CAGTCTGGATATGTGGGCTCAGG + Intergenic
1200877926 Y:8179322-8179344 CAGATTGGATTATTGGCCTCTGG + Intergenic
1202189823 Y:22230401-22230423 CAGATTGGATTATTGGCCTCAGG + Intergenic