ID: 969443163

View in Genome Browser
Species Human (GRCh38)
Location 4:7229022-7229044
Sequence TCGTGGCCTGGTCTGTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 124}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969443153_969443163 24 Left 969443153 4:7228975-7228997 CCTGCCCCGAGTGGACTTGCGTG 0: 1
1: 0
2: 0
3: 3
4: 71
Right 969443163 4:7229022-7229044 TCGTGGCCTGGTCTGTGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 124
969443150_969443163 30 Left 969443150 4:7228969-7228991 CCCGTCCCTGCCCCGAGTGGACT 0: 1
1: 0
2: 0
3: 17
4: 151
Right 969443163 4:7229022-7229044 TCGTGGCCTGGTCTGTGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 124
969443151_969443163 29 Left 969443151 4:7228970-7228992 CCGTCCCTGCCCCGAGTGGACTT 0: 1
1: 0
2: 1
3: 8
4: 159
Right 969443163 4:7229022-7229044 TCGTGGCCTGGTCTGTGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 124
969443157_969443163 18 Left 969443157 4:7228981-7229003 CCGAGTGGACTTGCGTGAGGCCT 0: 1
1: 0
2: 2
3: 13
4: 72
Right 969443163 4:7229022-7229044 TCGTGGCCTGGTCTGTGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 124
969443155_969443163 20 Left 969443155 4:7228979-7229001 CCCCGAGTGGACTTGCGTGAGGC 0: 1
1: 0
2: 0
3: 4
4: 34
Right 969443163 4:7229022-7229044 TCGTGGCCTGGTCTGTGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 124
969443159_969443163 -6 Left 969443159 4:7229005-7229027 CCGCGCCTTGCTCTGCTTCGTGG 0: 1
1: 0
2: 0
3: 13
4: 142
Right 969443163 4:7229022-7229044 TCGTGGCCTGGTCTGTGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 124
969443158_969443163 -2 Left 969443158 4:7229001-7229023 CCTGCCGCGCCTTGCTCTGCTTC 0: 1
1: 0
2: 0
3: 25
4: 225
Right 969443163 4:7229022-7229044 TCGTGGCCTGGTCTGTGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 124
969443156_969443163 19 Left 969443156 4:7228980-7229002 CCCGAGTGGACTTGCGTGAGGCC 0: 1
1: 0
2: 0
3: 10
4: 66
Right 969443163 4:7229022-7229044 TCGTGGCCTGGTCTGTGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 124
969443152_969443163 25 Left 969443152 4:7228974-7228996 CCCTGCCCCGAGTGGACTTGCGT 0: 1
1: 0
2: 0
3: 2
4: 34
Right 969443163 4:7229022-7229044 TCGTGGCCTGGTCTGTGTTGAGG 0: 1
1: 0
2: 0
3: 15
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969443163 Original CRISPR TCGTGGCCTGGTCTGTGTTG AGG Intronic
900572925 1:3368272-3368294 TCGGAGCCTGGCCCGTGTTGCGG - Intronic
900615393 1:3563384-3563406 GCGTGGCCTGGTCTGTGGACAGG - Intronic
900897580 1:5494371-5494393 TCTTGGGCTGTACTGTGTTGGGG + Intergenic
901642325 1:10699005-10699027 CCATGGCCTGGCCTGGGTTGGGG + Intronic
902226514 1:14999753-14999775 TCCAGGCCTGGCCTGAGTTGGGG - Intronic
902376962 1:16034484-16034506 CCTTGGCCTGGTCTCTGCTGGGG - Intergenic
902382132 1:16057743-16057765 CCTTGGCCTGGTCTCTGCTGGGG - Intergenic
907066122 1:51484819-51484841 TGGTGGCCTAGTGTGTCTTGTGG - Intronic
912099707 1:106190416-106190438 TCATGGCCTGGGCTGGTTTGTGG + Intergenic
913647331 1:120871014-120871036 CTGTGGCCTGCTCTGTGGTGGGG - Intergenic
914790786 1:150876226-150876248 TCGGCGTCTGGTCTGTGATGTGG - Intronic
919467863 1:197944247-197944269 TCCAGGCCTGGTCTATCTTGGGG + Intergenic
922347962 1:224712376-224712398 TCTTGTCCTGCTGTGTGTTGTGG + Intronic
1062979162 10:1707564-1707586 CCGTGGCCTGGTCTGTTAGGTGG + Intronic
1064457020 10:15497183-15497205 TGGTAGCCTGGTCAGTCTTGGGG + Intergenic
1067047122 10:42991095-42991117 TCGTGGCCTGTGCAGGGTTGGGG + Intergenic
1069620293 10:69833333-69833355 TCCTGGCCTGGGCTGAGGTGAGG - Intronic
1075323097 10:121508150-121508172 TCGTCGCTTGGTATGCGTTGGGG - Intronic
1076271042 10:129152445-129152467 TCGTGGCATGCTCTGTGGTGGGG + Intergenic
1076769332 10:132654484-132654506 CAGTGGCCTGGTCTTTGCTGGGG + Intronic
1076781435 10:132726936-132726958 TCATGCCTTGCTCTGTGTTGAGG + Intronic
1077182495 11:1222998-1223020 GCGTGGCCTGGCCTGGCTTGGGG + Intergenic
1077425142 11:2472535-2472557 TCGTGGCCTGGGCTACTTTGTGG + Intronic
1083963278 11:66026270-66026292 CTGTGGCCTGGCCTGTGGTGTGG + Exonic
1099542645 12:83932346-83932368 TGCTAGACTGGTCTGTGTTGTGG - Intergenic
1101039491 12:100739996-100740018 GTGTGGCCTGGTCAGTCTTGCGG - Intronic
1102299024 12:111757912-111757934 TCGTGGCCTGGCCTGTCTCATGG + Intronic
1106313763 13:28576323-28576345 TCTTGGTCAGCTCTGTGTTGGGG + Intergenic
1107679839 13:42836623-42836645 TAGTGGCCTTGTCTGTGTCTTGG - Intergenic
1114524107 14:23357447-23357469 TCATCGCCTGGTGTTTGTTGGGG - Exonic
1115077716 14:29412042-29412064 TCGGGGCCTGTTGTGGGTTGGGG - Intergenic
1118039729 14:61903754-61903776 TCCTGGCCAGGTCTTTGCTGTGG + Intergenic
1118270425 14:64338227-64338249 GCGTGGCCCCCTCTGTGTTGGGG - Intergenic
1118276091 14:64387593-64387615 GCGTGGCCTCATCGGTGTTGGGG - Intergenic
1118665562 14:68065407-68065429 TGCTGGCCTGGTCTGTGCTCAGG + Intronic
1120146303 14:80982413-80982435 TGGTGCCCAGGTCTGTGCTGAGG + Intronic
1121635789 14:95453096-95453118 TCCAGGCCAGCTCTGTGTTGTGG - Intronic
1122597199 14:102902043-102902065 TGGTGGCCCAGTCTGTGTTAAGG - Intronic
1202899829 14_GL000194v1_random:28571-28593 GCCTGCCCAGGTCTGTGTTGAGG - Intergenic
1124349865 15:28947355-28947377 GCGTGGCCTGGTGTGTGTGCAGG + Intronic
1124411132 15:29438237-29438259 TGGAGGCCTGCTATGTGTTGGGG - Intronic
1125535361 15:40439052-40439074 GGCTGGCCTGGTGTGTGTTGGGG + Intergenic
1128494646 15:68188247-68188269 TCGTGGGCTTTTCTTTGTTGTGG + Exonic
1130017596 15:80199818-80199840 AGGTGGCCTGGGCTGTGGTGGGG + Intergenic
1131278017 15:90998570-90998592 TCTTGGCCTGGACTTTGTAGTGG - Exonic
1133734312 16:8602475-8602497 ACCTGGCCTGGTGTGTTTTGGGG - Intergenic
1135100533 16:19601279-19601301 TTGTGGGCTGTTGTGTGTTGTGG + Intronic
1139766660 16:69236284-69236306 GAGTGGCCTGGTATGAGTTGGGG + Intronic
1140135934 16:72205522-72205544 GCCAGGCCTGGGCTGTGTTGGGG - Intergenic
1140813250 16:78598595-78598617 TCCTGGCTTGGTGTGTTTTGTGG + Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142428831 16:90015180-90015202 TGGTGCCGTGGTCTGTGTTGGGG + Intronic
1144249929 17:13406094-13406116 TCCTGGCTTGGTCTCTGCTGGGG - Intergenic
1148318126 17:46722315-46722337 TCCTGGCATCTTCTGTGTTGGGG + Intronic
1151884651 17:76916381-76916403 CTCTGGCCTGGCCTGTGTTGGGG + Intronic
1152320542 17:79606715-79606737 GCGGGGCCTGTTCTGGGTTGGGG - Intergenic
1154030759 18:10751981-10752003 TCGGGGCCTGGTGCGGGTTGTGG + Intronic
1157165157 18:45352052-45352074 TCGTGGACAGGGCTGTGGTGGGG + Intronic
1160811146 19:1013450-1013472 CCCTGGCCTGGTCAGTGGTGGGG - Intronic
1161071912 19:2266669-2266691 ACGTGGCCTGGCCAGTGTGGGGG + Intronic
1161381313 19:3966546-3966568 TCCTGGCCTGGTCTGTTCTTAGG - Intronic
1162341773 19:10095611-10095633 ACGTGTCCTGGTCTGGGTTTGGG - Intronic
1163612407 19:18308298-18308320 TCCAGGCCTGGCCTGTGGTGAGG - Intronic
1163928714 19:20368591-20368613 TGGTGGCCTGGGCTGGGTTTAGG - Intergenic
929595707 2:43174380-43174402 ACGTGGCCTGATCTGTGTTCTGG + Intergenic
931080011 2:58758293-58758315 TCGAGGCCTGGTCTGTGGGTAGG - Intergenic
931688530 2:64815520-64815542 TCATGTGCTTGTCTGTGTTGGGG + Intergenic
935062760 2:99622651-99622673 TATTGGCCTGTTCTGTGATGTGG - Intronic
935666547 2:105517714-105517736 TAGAGGCCTTGTCTGTTTTGAGG + Intergenic
939118789 2:138091368-138091390 TCATGGCCTGGTCTTTGGTTAGG - Intergenic
939913406 2:148010706-148010728 TCCTGGCCTTTTCTGTGATGGGG - Intronic
945053827 2:205850524-205850546 TAGGGGCCTGCTCTTTGTTGGGG - Intergenic
948729784 2:239955681-239955703 TCCTGCCCTGGTCTGTCCTGCGG - Intronic
1171431766 20:25087385-25087407 TCATGGTCTGTTCTGTGCTGCGG - Intergenic
1172608307 20:36230634-36230656 TCAGGGCCTGGTCTGTGCTCAGG + Exonic
1173408528 20:42788689-42788711 TAATGCCTTGGTCTGTGTTGAGG - Intronic
1174581293 20:51573739-51573761 TCCTGGGCTGGACTGTGCTGAGG - Intergenic
1175678501 20:60967452-60967474 GCGCGTCCTGTTCTGTGTTGCGG + Intergenic
1175678558 20:60967652-60967674 GCGCGTCCTGTTCTGTGTTGCGG + Intergenic
1176170973 20:63696257-63696279 TCGTGGCCTGGGCTTGGTGGTGG + Intronic
1176238616 20:64065673-64065695 GCCTGGCCTCGTCAGTGTTGAGG + Intronic
1176619203 21:9043345-9043367 GCCTGCCCAGGTCTGTGTTGAGG - Intergenic
1179544196 21:42103645-42103667 GCCTGGCCTGGTGTGTGCTGGGG - Exonic
1180946719 22:19698465-19698487 TAGTGGCCTGGACTGGGGTGGGG + Intergenic
1182712261 22:32330361-32330383 TTGGGGACTGGTGTGTGTTGGGG + Intergenic
1183674487 22:39291959-39291981 TCGGGGCCTCGTCTGTGTAAGGG - Intergenic
1184367820 22:44063706-44063728 TCGTGGCCTGCTCGGTGCTGGGG + Intronic
1184890300 22:47375142-47375164 CCGTGGCCTGGTCTCTGGTTGGG - Intergenic
1185005833 22:48276552-48276574 TCAGGGCCTGGCCTGTGTTGTGG + Intergenic
1185296525 22:50057695-50057717 TCGGGGTCAGGTCTGGGTTGGGG + Intergenic
1203290359 22_KI270735v1_random:31517-31539 TCATGTCCTAGTCTGTCTTGAGG - Intergenic
950117901 3:10463279-10463301 TGGAGGCCTGTTCTGTGCTGGGG - Intronic
950961252 3:17110372-17110394 TCGTCCCCTGGTGTCTGTTGGGG - Intergenic
954718283 3:52538131-52538153 CAGTGGCCTGGTCTAGGTTGGGG + Intronic
959063928 3:101638755-101638777 CAGTGGCCTGGTCTGGGTTTAGG - Intergenic
962053940 3:131848770-131848792 TCTTGGCCTGGTTTGTGCTTGGG - Intronic
969443163 4:7229022-7229044 TCGTGGCCTGGTCTGTGTTGAGG + Intronic
974342016 4:60626406-60626428 TCGGGGCCTGCTGTGGGTTGCGG - Intergenic
983158204 4:164378478-164378500 TCTTGTCCTGGCTTGTGTTGAGG + Intronic
984954238 4:185030019-185030041 TGGTAGCCTGGCCTGTGGTGAGG - Intergenic
992890630 5:81200935-81200957 TGGGGGCGTGGTGTGTGTTGGGG + Intronic
997632225 5:135377534-135377556 TCGTGGGCTGCACTGTGTTGGGG + Intronic
1000569546 5:162895329-162895351 TCGTGGCCTGGAATGTGTCCTGG - Intergenic
1001955832 5:175847606-175847628 TCCTGCCCTGGGCTGAGTTGAGG - Intronic
1006337370 6:33427772-33427794 GGGTGGCCTGGTTTGTTTTGGGG + Intronic
1006583896 6:35092899-35092921 CCGTGGCCTGGTCATTGCTGAGG - Intergenic
1007375314 6:41452271-41452293 CAGTGGCCTGGTCTGTCTAGTGG - Intergenic
1008941415 6:57049827-57049849 TTATGGCCTGGTCTATGATGAGG + Intronic
1014657901 6:124130968-124130990 TCTTGGCCTGGTGTCTGTTGAGG + Intronic
1017523197 6:155220135-155220157 TGTTGGCATGGTCTGTGCTGTGG + Intronic
1024218982 7:47273249-47273271 TCCTGGCCTGGTGTGTGTTCTGG + Intergenic
1026140283 7:67699757-67699779 TTGTGTCTTGGTCTTTGTTGAGG + Intergenic
1029201670 7:98843369-98843391 TGGTGCCTTGTTCTGTGTTGAGG - Intergenic
1029406830 7:100380211-100380233 TCTTGGCCTCATCTGTGTTTGGG + Intronic
1029814136 7:103075872-103075894 TCGCAGCCTGGTGTGTGTTTTGG + Exonic
1031961168 7:127991257-127991279 TGGTGGCCTGGGATGTGTGGTGG + Intronic
1032162024 7:129518334-129518356 CCGTGGCCTCGTCTCTGTTGGGG - Intergenic
1034202246 7:149289927-149289949 TGGTGGCCTGGCCTGTGGGGAGG - Intronic
1036710676 8:11076641-11076663 TCGGGGCCTGCCCTGTGCTGGGG - Intronic
1036814199 8:11888853-11888875 ACGAGGCCTGGTCTGTGGTATGG + Intergenic
1040108542 8:43554583-43554605 TGGTGGCCTGGGCTGGGTTTGGG + Intergenic
1057070059 9:92089895-92089917 TCATGGCCTGGCCTGTGTTATGG - Intronic
1059313017 9:113401330-113401352 GCGTGGCCTGGACTGTGGAGGGG - Exonic
1059390832 9:113998761-113998783 TCGTGGCGTGGCCTGTCCTGGGG - Intronic
1059449676 9:114362533-114362555 TCCTGGCCTGGTCTGGTTTCAGG - Exonic
1061055539 9:128220565-128220587 TCTTGGCCTTCTCTGTGTTGGGG - Intronic
1062353759 9:136152323-136152345 TCAGGGCCTGGTCTGTGACGGGG + Intergenic
1062353767 9:136152347-136152369 TCGGGGCCTGGTCTGTGACGGGG + Intergenic
1062353775 9:136152371-136152393 TCGGGGCCTGGTCTGTGACGGGG + Intergenic
1062353783 9:136152395-136152417 TCGGGGTCTGGTCTGTGATGGGG + Intergenic
1062353790 9:136152419-136152441 TCGGGGTCCGGTCTGTGATGGGG + Intergenic
1062353824 9:136152532-136152554 TCAGGACCTGGTCTGTGATGGGG + Intergenic
1062353831 9:136152556-136152578 TCAGGGCCTGGTCTGTGATGGGG + Intergenic
1062353849 9:136152628-136152650 TCAGGGCCTGGTCTCTGATGGGG + Intergenic
1062542852 9:137049200-137049222 TCGTGTCCGGGCCTGTGTGGTGG - Intronic
1190036949 X:47034223-47034245 TCATGTCTTGGTCTGAGTTGTGG - Intronic
1190626218 X:52340958-52340980 TCATGGCCTGGTCAGTCTAGGGG + Intergenic
1194553644 X:95331561-95331583 TAGTGTCCTTGTGTGTGTTGGGG + Intergenic
1195221615 X:102749421-102749443 TGGTGCCCAGGTCTGTGCTGAGG + Exonic
1195711798 X:107778917-107778939 TGGAGGCCTGGTGTGTGTAGGGG + Intronic