ID: 969443929

View in Genome Browser
Species Human (GRCh38)
Location 4:7233496-7233518
Sequence CAGGGTGAGCAGACACTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 203}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969443920_969443929 20 Left 969443920 4:7233453-7233475 CCCGGACACTGGGCCACAGTGCA 0: 1
1: 0
2: 0
3: 32
4: 268
Right 969443929 4:7233496-7233518 CAGGGTGAGCAGACACTTGCTGG 0: 1
1: 0
2: 2
3: 28
4: 203
969443921_969443929 19 Left 969443921 4:7233454-7233476 CCGGACACTGGGCCACAGTGCAG 0: 1
1: 0
2: 1
3: 40
4: 273
Right 969443929 4:7233496-7233518 CAGGGTGAGCAGACACTTGCTGG 0: 1
1: 0
2: 2
3: 28
4: 203
969443922_969443929 7 Left 969443922 4:7233466-7233488 CCACAGTGCAGTACAGACCCTCG 0: 1
1: 0
2: 0
3: 10
4: 108
Right 969443929 4:7233496-7233518 CAGGGTGAGCAGACACTTGCTGG 0: 1
1: 0
2: 2
3: 28
4: 203
969443919_969443929 27 Left 969443919 4:7233446-7233468 CCAGGGGCCCGGACACTGGGCCA 0: 1
1: 0
2: 2
3: 24
4: 227
Right 969443929 4:7233496-7233518 CAGGGTGAGCAGACACTTGCTGG 0: 1
1: 0
2: 2
3: 28
4: 203
969443927_969443929 -10 Left 969443927 4:7233483-7233505 CCCTCGCTGGGCTCAGGGTGAGC 0: 1
1: 0
2: 2
3: 15
4: 190
Right 969443929 4:7233496-7233518 CAGGGTGAGCAGACACTTGCTGG 0: 1
1: 0
2: 2
3: 28
4: 203

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969443929 Original CRISPR CAGGGTGAGCAGACACTTGC TGG Intronic
900230148 1:1552576-1552598 CATGGAGAGCAGTCACTTGCAGG - Intronic
900940454 1:5795321-5795343 CAGGCTGACCAGATATTTGCGGG - Intergenic
901055308 1:6446406-6446428 GAAGGTGAGCAGGCACTAGCAGG + Intronic
901638939 1:10683538-10683560 CTGTGTAAGCAGAGACTTGCTGG - Intronic
902479065 1:16702207-16702229 GAAGGTGAGCAGGCACTAGCAGG - Intergenic
903342361 1:22662377-22662399 CAGGGTGAGGAGCCAAATGCTGG - Intergenic
905819925 1:40980890-40980912 CAGGGTGAACAGGCAGGTGCAGG - Intronic
906566003 1:46801540-46801562 CAGGTTGAGCAGACAAAGGCTGG + Intronic
910067832 1:83174629-83174651 TAGGGTGAGAGGACACATGCAGG + Intergenic
910862994 1:91761551-91761573 TTAGGTGAGCAGGCACTTGCAGG - Intronic
910938359 1:92505665-92505687 CAGGTTGAGCAGAGACCTGGTGG + Intergenic
912936167 1:114005315-114005337 CAGGCTGGGCAGACACCTGAGGG + Intergenic
913113192 1:115674116-115674138 CAGTGTGAGCAGAAACAGGCTGG - Intronic
913115505 1:115692686-115692708 CTGGGGGAGCAGACACTGACTGG + Exonic
916391147 1:164332153-164332175 CGCAGTGAGCAGACACTTGCCGG + Intergenic
917539578 1:175899763-175899785 AAGTGTGAGCAGAGACTTGAAGG + Intergenic
919899733 1:202034993-202035015 CAGGGAGAGGTGAAACTTGCGGG - Intergenic
922187894 1:223292619-223292641 CGGGGTCAGCACACACTTGAAGG + Exonic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1063798817 10:9546540-9546562 AAGGTTGACCAGGCACTTGCTGG + Intergenic
1065563833 10:26989597-26989619 CAGGGTTGACAGACAATTGCTGG + Intergenic
1068932904 10:62609895-62609917 GAGGGTGTGTAGACACCTGCAGG + Intronic
1068936529 10:62640348-62640370 CAGAGAGAGAAGACACTTACAGG + Intronic
1073036063 10:100564997-100565019 CAGAGAGAGCAGACACTTGAAGG + Intergenic
1074733604 10:116403907-116403929 CAGGAGGAGCACAGACTTGCCGG - Intergenic
1076110316 10:127855089-127855111 CAGGGTGGGCAGACACAGGTTGG - Intergenic
1076366983 10:129927525-129927547 CAGGCTAAGCAGCCACCTGCAGG - Intronic
1076838438 10:133032803-133032825 CCCGGGGAGCAGACACCTGCAGG + Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079521584 11:21333756-21333778 CAGGGACAGCAGTCACTTACTGG - Intronic
1080521297 11:33069968-33069990 CAGGATGAGTAGCAACTTGCTGG - Intronic
1084231141 11:67754161-67754183 CAGGGAGAGCTGACACTTCCCGG - Intergenic
1084399231 11:68934082-68934104 CAGGGTGAGCAGACCGCTCCTGG + Intronic
1084579329 11:70013111-70013133 AAGGATGAGTAGAAACTTGCCGG + Intergenic
1085511770 11:77091765-77091787 CAGGGTGAGCTGACCCTTCCTGG + Intronic
1087488886 11:98796713-98796735 CAGGGTCATCAGATACTTACTGG - Intergenic
1089138112 11:116265667-116265689 CAGAGTGAGCAGGCACTTCTGGG - Intergenic
1091544134 12:1489331-1489353 CAGGGTGAGCAGACACTCTTAGG + Intronic
1094177169 12:27552922-27552944 CAGGGTGATCGGACACCTGGGGG + Intronic
1096048154 12:48582475-48582497 AAGGCTGAACAGACAGTTGCTGG + Intergenic
1097159002 12:57032519-57032541 CAGGGTGAGCAAAAATTAGCTGG + Intronic
1099297770 12:80851127-80851149 CAGTGTGAACAAAAACTTGCAGG + Intronic
1101410466 12:104463748-104463770 CACTGAGAGCAGACACCTGCAGG + Intronic
1101768926 12:107730407-107730429 CAGGGTGAGGAGGCAGGTGCTGG + Intergenic
1101943969 12:109121758-109121780 CAGGGTCAGTGAACACTTGCTGG - Intronic
1103227470 12:119300614-119300636 CAGGCTGAGCAGCCTCTTCCTGG + Intergenic
1104721707 12:131048112-131048134 CAGGGAGAGCAGATGCTTGTCGG + Intronic
1105370293 13:19796168-19796190 CAGGGTGACCAGACCCCTGGGGG + Intergenic
1105984561 13:25552830-25552852 CAGGGGGAGCAGGCATATGCTGG - Intronic
1106330082 13:28732145-28732167 AAGCTTGAGCAGAGACTTGCCGG + Intergenic
1111996222 13:95168391-95168413 AAGGGTGAGAATTCACTTGCCGG + Intronic
1113225505 13:108154929-108154951 CAGGGTGAGAATAAAGTTGCAGG + Intergenic
1113304631 13:109064305-109064327 AAGGGTGACCAGCCTCTTGCTGG - Intronic
1113590402 13:111494942-111494964 CAGGGTGAGGAGGCACTTGGCGG + Intergenic
1116789778 14:49327986-49328008 CTGGAAGATCAGACACTTGCTGG - Intergenic
1118735134 14:68695697-68695719 CAGGGTGACCAGAGGCTTGTGGG - Intronic
1118767598 14:68920634-68920656 AAGGGTGTGCAGACACAGGCTGG - Intronic
1119553544 14:75535730-75535752 TAGGGTGACCAGACATTTACTGG - Intronic
1120793664 14:88608085-88608107 CAGGGTGAGATGATACTTGCAGG - Intronic
1121314673 14:92953777-92953799 CCAGGTGAGCAGACACTGGCCGG - Intronic
1121485375 14:94310504-94310526 CAGGGTGAGAAGACTCCTTCAGG + Intronic
1122286063 14:100653624-100653646 CAGGGTGAGAAGAGGCTCGCTGG - Intergenic
1123003640 14:105310693-105310715 CAGGGTGAGCTGCCGCTGGCTGG - Exonic
1123129701 14:105975013-105975035 CAGGGGGCTCAGACACTAGCAGG + Intergenic
1123449343 15:20350281-20350303 CAGGGTGACCAGATGCTGGCCGG - Intergenic
1128444670 15:67747775-67747797 GATTGTGAGCAGACACTGGCAGG + Intronic
1128753359 15:70164570-70164592 GAGGGTGAGAGGACACTTGGAGG - Intergenic
1130192567 15:81750603-81750625 TAGAGTGAGCAGACTCTGGCGGG - Intergenic
1130209736 15:81912207-81912229 CAGAGAGAGCTGGCACTTGCTGG - Intergenic
1130738263 15:86572153-86572175 CAGTGGGAGCAGGCACTTCCGGG + Intronic
1131188700 15:90295491-90295513 CAGGGTGAGCAGGCAGGAGCAGG + Intronic
1131973913 15:97921781-97921803 CTGTGTGAGCTGACACCTGCTGG + Intergenic
1134456224 16:14397542-14397564 CAGGGTGGCCAGAAACCTGCTGG - Intergenic
1136265552 16:29115513-29115535 CACAGTGAGCAGTCACGTGCCGG - Intergenic
1139281003 16:65770422-65770444 CAGGGTGATCAGACACCAGATGG - Intergenic
1140648946 16:77065852-77065874 CAGGGTGAGCAGACATTCCCTGG - Intergenic
1142238148 16:88932281-88932303 CAGGCAGAGCACACACTTCCAGG + Intronic
1143080066 17:4375093-4375115 CAGGGTCAGCAGCAACTTCCCGG - Intergenic
1143428728 17:6862957-6862979 CAGGGTGTGCACACATGTGCTGG + Intergenic
1144052975 17:11513885-11513907 CAGGCAGACCAGACAATTGCGGG + Intronic
1147140939 17:38460411-38460433 CGGGGTGTGCAGACGCTGGCTGG - Intronic
1147486334 17:40818768-40818790 CAAGGTCAGCAGAAACTAGCTGG - Exonic
1148102708 17:45102463-45102485 CTGGGTGGGCAGACCCTGGCTGG + Intronic
1150855241 17:68745914-68745936 CATGGTCTGCAGACACTTGTAGG + Intergenic
1152339300 17:79715585-79715607 CAGGGCGACCAGACGCTGGCTGG + Intergenic
1152426337 17:80220539-80220561 CAGGGGGAGCGGACAGTGGCCGG + Intronic
1152696720 17:81801279-81801301 CAGGGTTAGCAGACACGGCCTGG + Intergenic
1152696734 17:81801357-81801379 CAGGGTTAGCAGACACGGCCTGG + Intergenic
1152696747 17:81801435-81801457 CAGGGTGAGCAGATATTGCCTGG + Intergenic
1156508220 18:37612640-37612662 CAGGGAGAGCAGAGACTTGCTGG + Intergenic
1157091814 18:44645090-44645112 CAGGGAGAGCTGAGACTTGATGG + Intergenic
1160731906 19:645035-645057 CAGGGTGAGCAGAAGCTCTCGGG - Intergenic
1161596663 19:5154208-5154230 CAGGGTGTGCAGGCCCTTGTGGG + Intergenic
1161772326 19:6237436-6237458 CAGGGTTCACAGACACATGCTGG + Intronic
1163745187 19:19042656-19042678 AAGGGTGAGCAGGCAATGGCAGG - Intronic
1163848470 19:19650489-19650511 CAGGGTGAGCAGGCAGTGCCAGG - Intronic
1164867589 19:31617637-31617659 CCGAGTGAGGAGACACTTGCAGG - Intergenic
1165289732 19:34873641-34873663 AAGAGTGAGCAGAAAGTTGCTGG + Intergenic
1165340444 19:35207759-35207781 CAGTGTGAGGAGGCATTTGCTGG + Intergenic
1165354012 19:35292551-35292573 CCAGGTGATCAGACACCTGCAGG + Intronic
1165850174 19:38845553-38845575 CGTGGTCAGCAGACACATGCTGG + Intronic
1167606655 19:50484864-50484886 CAGAGTGAGCATACAGTTTCTGG - Exonic
1202713106 1_KI270714v1_random:28114-28136 GAAGGTGAGCAGGCACTAGCAGG - Intergenic
925224454 2:2171038-2171060 CCGGGTGAGCAGACCCTTCTGGG - Intronic
925286537 2:2719951-2719973 CAGCGTGAGCCGCCACTTGGAGG + Intergenic
925333692 2:3077706-3077728 CAGGTTGAGGGGACACTTTCTGG - Intergenic
925862112 2:8189033-8189055 CAGGTTCAGCAGACACTCTCAGG + Intergenic
926895036 2:17677517-17677539 CAAGGTAAGCTGACAATTGCTGG - Intronic
928443937 2:31316412-31316434 CAGAGTGTGCAGACACTTGAAGG - Intergenic
929609180 2:43257265-43257287 CAGTGGGAGCAGACACTTGAAGG - Intronic
931804066 2:65787872-65787894 CAGGGTGATCAGACATTACCTGG - Intergenic
932822262 2:74911612-74911634 CAGGGTCAGCAGGCAGCTGCAGG - Intergenic
933152633 2:78933388-78933410 CAGGGTGAGTTGACAATTACAGG - Intergenic
935185976 2:100733328-100733350 CAGGGTGAGCTGACCTTTCCCGG + Intergenic
936267756 2:111023418-111023440 CAGGATGAGCAGAAACCTGAGGG - Intronic
937970472 2:127545414-127545436 CTGGGTGAGCAGCCGCATGCTGG + Intronic
938585210 2:132683706-132683728 CCAGGTGAGGTGACACTTGCTGG - Intronic
940933812 2:159468098-159468120 CAGGGTCAGCACAAACTAGCTGG + Intronic
943623829 2:190178356-190178378 CAGTGTGAACAGGTACTTGCAGG - Intronic
944178230 2:196857791-196857813 GAGGTTGAGCAGGCAGTTGCTGG - Intronic
946891723 2:224283610-224283632 CTGCGTGAGCTGAGACTTGCAGG - Intergenic
947929991 2:233956623-233956645 CAGGGTCAGAAAACACTTTCAGG + Intronic
948569322 2:238907411-238907433 CAGGGGGAGGAGACACAGGCAGG - Intronic
948616619 2:239203228-239203250 CTGGGTGGGCACCCACTTGCTGG - Intronic
948619373 2:239224505-239224527 GAAGGTGAGCAGACATTTGCAGG - Intronic
1168891819 20:1299932-1299954 CAGGGAGGGCAGACACGCGCAGG - Intronic
1169427657 20:5509320-5509342 CAGGCTGAGCACAAACTTCCAGG - Intergenic
1171245397 20:23606433-23606455 TCGGGGGAGCAGACACCTGCAGG - Intergenic
1171385490 20:24766983-24767005 CAGGGTGAGTGCACACCTGCTGG - Intergenic
1172275567 20:33677112-33677134 CAGGCTGAGTAGAGACTGGCTGG + Exonic
1172640990 20:36440380-36440402 CAAAGTGAGCAGTCACTTGCTGG - Intronic
1174554858 20:51386776-51386798 CAGGCTCAGAAGCCACTTGCCGG - Intergenic
1174904520 20:54536628-54536650 CAGGGAGAGCAGGCTTTTGCTGG - Intronic
1174905568 20:54546868-54546890 CAGGGAGACCAGACATTTGGTGG + Intronic
1175143066 20:56874735-56874757 CATGCTGGCCAGACACTTGCTGG + Intergenic
1175498894 20:59435417-59435439 CAGGATGAGGAGGGACTTGCCGG + Intergenic
1179262678 21:39772361-39772383 CCGTGTGAGCAGCCACTTGGAGG + Intronic
1179710424 21:43210073-43210095 CAGGAGGCGCAGACACTTCCCGG - Intergenic
1180215107 21:46318624-46318646 CAGGGTGGGGAGACACTGGGAGG + Intronic
1180646356 22:17342322-17342344 CAGGGTCAGCAGACACACGGAGG + Intergenic
1180895805 22:19331327-19331349 TAGGGGGAGGAGACACTGGCAGG - Exonic
1181934787 22:26430227-26430249 GAGGGTGAGCAGACACTCTTTGG + Intronic
1182281506 22:29220186-29220208 CAGGCAGAGCAGCGACTTGCCGG - Intronic
1182304712 22:29359805-29359827 GAAGGTGAGCAGACGCTTGGTGG - Exonic
1183168091 22:36162695-36162717 GAGAGTGAGCAAACAATTGCAGG - Intronic
1183227170 22:36558487-36558509 CTGGGGGAGCAGGCAGTTGCTGG + Intergenic
1183350700 22:37333135-37333157 CAGTGGGAGCAGAGACTGGCGGG + Intergenic
1183730394 22:39615237-39615259 TAGGGTGAGCAGACACTCGGGGG + Intronic
950262788 3:11554498-11554520 CAGGATGAGCAGAGGCTGGCTGG + Intronic
950770026 3:15303879-15303901 CAGGGAGAGCACCCACTTGCAGG + Intronic
954456040 3:50600386-50600408 CAGGGCGAGGGGACACTTCCTGG - Intergenic
955238456 3:57160229-57160251 CAGCAGGAGCAGACACCTGCTGG + Intronic
959579770 3:107971413-107971435 CAAGGTGTGCATACATTTGCTGG + Intergenic
959766190 3:110032148-110032170 CAGGGTGATCTGGCACTTCCTGG + Intergenic
959964216 3:112335258-112335280 CAGGGTGAGCAGATCTTTGTAGG + Intronic
961649342 3:128409749-128409771 CTGCCTGAGCAGACACTTCCTGG + Intergenic
961867771 3:129966508-129966530 CATGTTGAGCAGCCAATTGCAGG - Intergenic
961879763 3:130053172-130053194 CAGGGAGAGCTGACACTTCCCGG - Intergenic
966073309 3:175905763-175905785 CAGGGTCACAAGACAATTGCGGG + Intergenic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
968746020 4:2360617-2360639 CACTGTGAGCAGACACCTTCAGG + Intronic
968991971 4:3920281-3920303 CAGGGAGAGCTGACACTTCCCGG - Intergenic
969443929 4:7233496-7233518 CAGGGTGAGCAGACACTTGCTGG + Intronic
970174935 4:13330223-13330245 CAGGGTGACCAGCCAGTTGCGGG + Intergenic
970619107 4:17798696-17798718 CACAGTGACCTGACACTTGCTGG - Intergenic
970858616 4:20676556-20676578 AAGGGTATGCAGACACTTGAGGG + Intergenic
973269576 4:48248525-48248547 CAAGGTGAGCAGACACTGGGAGG + Intronic
974167747 4:58225549-58225571 CTTGGTGAGCAGACACCAGCAGG + Intergenic
975349124 4:73326693-73326715 GAGTGTGAGCAGACTCTTGAAGG + Intergenic
981462150 4:145025888-145025910 CAGTGTGAGCAGGCAGTTGATGG + Intronic
985477916 5:90271-90293 CAGGCTGAGCAGACACTGAGAGG - Intergenic
986101310 5:4614173-4614195 CAGAGTGAGCAGTCACTGGGTGG + Intergenic
986364930 5:7020513-7020535 CAGGAAGAGGAGACACTTTCAGG - Intergenic
987661383 5:20882644-20882666 CAAGGTGGGCAGACACTGTCAGG + Intergenic
988762202 5:34322681-34322703 CAAGGTGGGCAGACACTGTCAGG - Intergenic
991492366 5:67195635-67195657 CTGGGTGAGCAGAGCCTTGTTGG - Intronic
994447161 5:99891006-99891028 CAGGGTGAGCATGCTGTTGCAGG - Intergenic
995950145 5:117702048-117702070 CAGGGAGAGCTGTCACTTCCAGG - Intergenic
996576095 5:124977663-124977685 CAGGGTGATCAGACACCATCTGG + Intergenic
997254736 5:132419816-132419838 CAGGGTGTGCTGCCACCTGCAGG - Exonic
998371505 5:141664903-141664925 CATGGTGAGTAGGCACTGGCTGG - Exonic
998383652 5:141743462-141743484 CGGGGCCAGCAGACACCTGCCGG - Intergenic
998752591 5:145339729-145339751 CAGCGGGAGCAGATAATTGCGGG - Intergenic
999243981 5:150143727-150143749 GAGGGTGAGGAGACAGTTACAGG + Intronic
1002901415 6:1412627-1412649 CAGGATGAGCCGTCACTTGCTGG - Intergenic
1005059566 6:21763054-21763076 CAGGGTGAGGAGGCACTTTCAGG + Intergenic
1005349914 6:24924061-24924083 CAGGCTGAGCAGACCCACGCTGG + Intronic
1006059868 6:31411809-31411831 CAGAGTGAGGACAGACTTGCAGG + Intronic
1007287572 6:40758586-40758608 CAAGGTGAGCAGACAGGTGCTGG + Intergenic
1008138904 6:47809115-47809137 CAGGGTGAGTAAAGACTTGGGGG + Intronic
1008583032 6:52923405-52923427 CAGGGTCACAAGACAATTGCGGG - Intergenic
1015595474 6:134862078-134862100 CATTGTGACCAGAGACTTGCAGG - Intergenic
1019074900 6:169379283-169379305 CAGGGAATGCAGACACTTGAAGG - Intergenic
1019083004 6:169448820-169448842 CACAGTGAGGAGACACCTGCAGG + Intergenic
1019758398 7:2790090-2790112 CAGAGGGAGCAGACACAGGCAGG - Intronic
1020180992 7:5922425-5922447 CAGGGTTAGCAGCCACGTTCTGG - Intronic
1020301941 7:6802463-6802485 CAGGGTTAGCAGCCACGTTCTGG + Intronic
1021475635 7:21057722-21057744 CAGAGTGTGCAGGCAGTTGCAGG - Intergenic
1022204498 7:28150255-28150277 CAGGGTGAGCAAAGATGTGCTGG + Intronic
1024324940 7:48102101-48102123 CAGGGTGAGCCCACAGTAGCTGG + Intronic
1025199625 7:56954155-56954177 CAGGGTGAGCTGCCACCTCCTGG + Intergenic
1025672320 7:63622778-63622800 CAGGGTGAGCTGCCACCTCCTGG - Intergenic
1026015241 7:66666838-66666860 CAGGATGGGCAGAAATTTGCAGG + Intronic
1026466888 7:70662027-70662049 AAGGGTGAGCAGACAATGGGGGG + Intronic
1026891640 7:73985976-73985998 CAGGATGGGCAGAAATTTGCAGG + Intergenic
1027276263 7:76560132-76560154 TAGGGTGAGAGGACACATGCAGG - Intergenic
1033305358 7:140221561-140221583 CAGAGTGAGCAGGAAGTTGCTGG - Intergenic
1037689798 8:21172214-21172236 CAGGATAGGCAGACACTGGCTGG + Intergenic
1038285637 8:26204056-26204078 CAGTGGGAGCAGACTCTAGCAGG - Intergenic
1040489766 8:47909086-47909108 CAGGGTGACCAGACACTGCCTGG - Intronic
1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG + Intergenic
1041198077 8:55421435-55421457 CAGGGAGAGCTGACATTTGCAGG - Intronic
1041256476 8:55983463-55983485 CAGGGGGAGGAGACACCTGGAGG - Intronic
1042735897 8:71988068-71988090 AAGAGTGAGAAGACACTTACTGG - Intronic
1048996107 8:139794593-139794615 CTGGGGGAGCACACAGTTGCTGG - Intronic
1051604908 9:18909259-18909281 CAGGGTGAGCAGGGGCTTCCAGG + Exonic
1056676323 9:88679611-88679633 CAGGGTGACCAGACACCACCGGG + Intergenic
1059350299 9:113659543-113659565 CAGGGAGATCAGACATCTGCTGG + Intergenic
1060981656 9:127795863-127795885 CAGGGTGACCAGACAGGTGGTGG + Intronic
1062102809 9:134737374-134737396 CGTGGGGAGCAGACACTTGAGGG + Intronic
1187288810 X:17932292-17932314 CAGGGTGAGCAAAGGCTTGCTGG - Intergenic
1188759019 X:34002387-34002409 CAGGGTGATCAGATACCTCCTGG + Intergenic
1192537447 X:71940420-71940442 AAGGGTGAGCAGATGATTGCAGG + Intergenic
1192765366 X:74134219-74134241 CAGGGAGGGGAGACACTTGGAGG + Intergenic
1192993947 X:76492501-76492523 GAGGGTGAGCAGAAACTGGGTGG + Intergenic
1194015977 X:88622283-88622305 AAGGTTGAGCTGCCACTTGCTGG - Intergenic
1198278195 X:135117249-135117271 CAGTGTGAGTAGACACCTGTAGG + Intergenic
1198292767 X:135255267-135255289 CAGTGTGAGTAGACACCTGTAGG - Intronic
1198307933 X:135401027-135401049 CAGTGTGAGTAGACACCCGCAGG - Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200247348 X:154533231-154533253 CAGGGTGAGCAGAGCCAAGCAGG - Intronic
1202332578 Y:23770471-23770493 CAAAGAGGGCAGACACTTGCAGG + Intergenic
1202538191 Y:25899592-25899614 CAAAGAGGGCAGACACTTGCAGG - Intergenic