ID: 969444972

View in Genome Browser
Species Human (GRCh38)
Location 4:7239501-7239523
Sequence CTTTCACCCAGGGAAGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 238}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969444972_969444979 17 Left 969444972 4:7239501-7239523 CCAGACCCTTCCCTGGGTGAAAG 0: 1
1: 0
2: 1
3: 21
4: 238
Right 969444979 4:7239541-7239563 CTGACTGCTGACTGTGAGCCTGG 0: 1
1: 1
2: 2
3: 62
4: 557
969444972_969444981 24 Left 969444972 4:7239501-7239523 CCAGACCCTTCCCTGGGTGAAAG 0: 1
1: 0
2: 1
3: 21
4: 238
Right 969444981 4:7239548-7239570 CTGACTGTGAGCCTGGGATCTGG 0: 1
1: 0
2: 4
3: 14
4: 251
969444972_969444980 18 Left 969444972 4:7239501-7239523 CCAGACCCTTCCCTGGGTGAAAG 0: 1
1: 0
2: 1
3: 21
4: 238
Right 969444980 4:7239542-7239564 TGACTGCTGACTGTGAGCCTGGG 0: 1
1: 0
2: 2
3: 17
4: 235
969444972_969444982 30 Left 969444972 4:7239501-7239523 CCAGACCCTTCCCTGGGTGAAAG 0: 1
1: 0
2: 1
3: 21
4: 238
Right 969444982 4:7239554-7239576 GTGAGCCTGGGATCTGGAGAAGG 0: 1
1: 0
2: 1
3: 41
4: 514
969444972_969444977 -9 Left 969444972 4:7239501-7239523 CCAGACCCTTCCCTGGGTGAAAG 0: 1
1: 0
2: 1
3: 21
4: 238
Right 969444977 4:7239515-7239537 GGGTGAAAGCTACTGTCACCAGG 0: 1
1: 0
2: 1
3: 14
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969444972 Original CRISPR CTTTCACCCAGGGAAGGGTC TGG (reversed) Intronic
900325700 1:2107787-2107809 ATTTCCCCCAGGGCAGTGTCGGG + Intronic
900456668 1:2778267-2778289 CTTTTACCCAGCGAAGCATCAGG + Intronic
900534560 1:3170555-3170577 CTCGCAGCCAGGGCAGGGTCTGG - Intronic
902948114 1:19858294-19858316 CTTTAACACAGGGCAGGGTGTGG - Intergenic
904532783 1:31180403-31180425 CTTGCCCCCAAGGAAGGGTGAGG + Exonic
905371419 1:37484494-37484516 CTTCCTTCCAGAGAAGGGTCAGG - Intergenic
907688539 1:56638314-56638336 CTATTACCCAGGGAATGGTGTGG - Intronic
907937319 1:59054092-59054114 CTTGCACCCAGTGAAGTGTCTGG - Intergenic
912450227 1:109763810-109763832 CTGGCACCCAGGTAAGGGCCTGG - Exonic
912953439 1:114136147-114136169 CTTACACCCCAGGAAGGGTCTGG - Intronic
914665499 1:149829222-149829244 CTCTCACCCAGCCTAGGGTCAGG - Intergenic
914670266 1:149864572-149864594 CTCTCACCCAGCCTAGGGTCAGG + Intronic
914703895 1:150156050-150156072 CTTTTACCTAGGGGAGGGTTGGG - Exonic
918062749 1:181076205-181076227 CTCTGACCCAGAGCAGGGTCAGG - Intergenic
918400104 1:184154392-184154414 CTTTTACCCAGGGAGGGGTGAGG - Intergenic
919362153 1:196609013-196609035 CCTCCTCCCAGAGAAGGGTCTGG - Exonic
919745171 1:201004306-201004328 CCAACACCCAGGGAAGGGACAGG - Intronic
920424219 1:205860607-205860629 ATATCTCCCAGGGAAGGGACTGG + Intergenic
924754702 1:246931186-246931208 CTTTCCCCGAGGGAAGCGGCCGG - Intronic
1062903966 10:1167061-1167083 CTTTGACCCAGGGAGGAGCCTGG + Intergenic
1063052399 10:2467222-2467244 CTTCCTCACTGGGAAGGGTCAGG - Intergenic
1063256045 10:4328586-4328608 CTGTCACCCAGGCTAGGGTGTGG - Intergenic
1063957801 10:11282327-11282349 CAGGCACCCAGGGAAGGGGCGGG + Intronic
1065673321 10:28146084-28146106 GTATCACCCAGGGGAGGGTGAGG - Intronic
1065859478 10:29859436-29859458 ATTCCAGCCAGGGAAGGGACAGG + Intergenic
1070729360 10:78814583-78814605 CTTTGACCCAGGTCAAGGTCGGG + Intergenic
1070813759 10:79311167-79311189 CTTACATCCAGCGAAGGCTCCGG - Exonic
1070960431 10:80495932-80495954 CCATCACCCAGGGAAGGGGTAGG - Intronic
1072633910 10:97165182-97165204 CATTCACCCAGGGAAGAATCCGG + Intronic
1073048580 10:100654117-100654139 CATTCATCAAGGGAAGGATCAGG - Intergenic
1073352275 10:102828377-102828399 GTTTACCCCAGGGAAGGGTGAGG + Intergenic
1077061964 11:621448-621470 CTGGCACCCTGGGGAGGGTCAGG + Exonic
1077120902 11:907983-908005 GTCTCACCCAGGGAAGAGACAGG - Intronic
1077273472 11:1692620-1692642 CTCTCACCCCGGGGAGGGGCAGG + Intergenic
1078065402 11:8075815-8075837 CTTGGACCCTGGAAAGGGTCAGG - Intronic
1079376228 11:19894584-19894606 CCTTTGCCCAGGGCAGGGTCAGG - Intronic
1081975699 11:47233325-47233347 CTTCCACCCAGGAACAGGTCAGG - Intronic
1082050611 11:47767536-47767558 TTTTGACCCAGAGAAGGGACCGG + Intergenic
1083134541 11:60659533-60659555 ATTTCACCCAGAGAAGGGCCTGG + Intergenic
1083739083 11:64698363-64698385 TTTTCACCCCTGGGAGGGTCAGG - Intronic
1083993679 11:66261641-66261663 CTGGCACCCAGTGAAGGGCCAGG - Intronic
1084171317 11:67402139-67402161 CTTCCACCCAGGGAAGGGGTGGG - Intronic
1084396194 11:68912159-68912181 CTGTCACCCAGGCTAGAGTCTGG + Intronic
1084412335 11:69012195-69012217 CTTGCTCCGAGGGGAGGGTCAGG - Intronic
1084490760 11:69476918-69476940 CCTTCAGCCTGGGAATGGTCTGG - Intergenic
1085712226 11:78840659-78840681 CTTCCGCCCAGAGAAGTGTCAGG + Intronic
1089555185 11:119312188-119312210 ATGTCACCCAGGGCAGGGTGGGG + Intronic
1090623612 11:128585589-128585611 CTCTCACCTAGGGGAGGGTGAGG - Intronic
1092514258 12:9192127-9192149 CTGTCACCGAGGGAAGGGTAAGG + Intronic
1092616202 12:10218160-10218182 TTTTCACCGGAGGAAGGGTCAGG - Intronic
1092688010 12:11072791-11072813 TTTTCACCCACGGGTGGGTCGGG + Intronic
1092886381 12:12927736-12927758 CCTACACCAAGGGAAGAGTCAGG + Intergenic
1096071024 12:48775619-48775641 CTTGCACCCTGGGATGGGGCTGG - Intronic
1096092373 12:48911518-48911540 CTGTCACCCAGGCTGGGGTCAGG - Intronic
1096505148 12:52087947-52087969 TTTTCATCCAGGGAAGGGCAGGG - Intergenic
1098495963 12:71135801-71135823 TCATCACCCTGGGAAGGGTCTGG + Intronic
1101222162 12:102652875-102652897 CCTTCTCCCATGGAAGTGTCAGG - Intergenic
1102617328 12:114165970-114165992 CTCTCACCCAAGGGAGGTTCAGG + Intergenic
1103408193 12:120690732-120690754 CTTTCACCTGGGGAAGGATTTGG + Intronic
1103902388 12:124310216-124310238 ATTTCACTCAGGGCAGGGCCAGG - Intronic
1104684293 12:130774565-130774587 ATTTTAGCCAGGGAAGGGGCCGG + Intergenic
1106157223 13:27170955-27170977 CTTTCCCCCAGCGCGGGGTCGGG + Intronic
1106919517 13:34548640-34548662 TGTTCTCCCAAGGAAGGGTCAGG + Intergenic
1108282781 13:48876180-48876202 CTACCACCCAGGGAAGGGTGAGG - Intergenic
1110481042 13:75976561-75976583 ATTATACCCAGGGAAGAGTCTGG + Intergenic
1111119428 13:83825817-83825839 CTTTCACACAGTTATGGGTCTGG - Intergenic
1112304491 13:98261331-98261353 CTTTCCCCCAAGGATGGGCCAGG - Intronic
1113316382 13:109184251-109184273 CTTTCACACAGCCAAGGTTCAGG + Intronic
1113515174 13:110889055-110889077 TTTTCACTCATGGAAGGGACTGG + Intronic
1113792996 13:113040660-113040682 CTTTGTCCCAGGGCAGGGGCAGG - Intronic
1113932798 13:113977025-113977047 CTTTCTCCCAGGGAAGGGTGAGG - Intergenic
1116539084 14:46075518-46075540 CTTTCACCCAGGTAAGAGCATGG + Intergenic
1117972715 14:61268158-61268180 CTGTCAGCCAGGTAATGGTCAGG - Intronic
1118276738 14:64392266-64392288 CTTCTGCCCAGGGCAGGGTCAGG - Intronic
1118693262 14:68360296-68360318 ACTTCAGCCAGGGAAGGGTGGGG - Intronic
1118745515 14:68770297-68770319 CCTTCACCAAGAGAAGGCTCGGG + Intergenic
1119323790 14:73746695-73746717 CTTTGGCCCAGGGCAGAGTCTGG - Intronic
1119545898 14:75471227-75471249 GTCTGACCCAGGGAAGGGTGTGG + Intronic
1119770870 14:77219983-77220005 CTGCCAGCCAGGGAAGGGGCAGG - Intronic
1120652255 14:87149050-87149072 CTTCCACCTAGGGAAGGGAAAGG - Intergenic
1121052380 14:90828012-90828034 CTTTCAACCAGCCAAGGGACTGG - Intergenic
1124220347 15:27845669-27845691 CTCACACCCAGGGAAGGCCCAGG + Intronic
1124248662 15:28093958-28093980 CTGTCTCCCAGGGAAGAGGCAGG - Intronic
1124954581 15:34351763-34351785 CTTTATCCCAGGGAGGGGGCTGG + Intronic
1125134754 15:36328626-36328648 CTCTCACCCAGGGAGTGGTGAGG + Intergenic
1125295887 15:38202882-38202904 CTCTTACTCAGGGGAGGGTCAGG + Intergenic
1126373845 15:47974959-47974981 CTGTCACCCAGGAAAGTGACTGG - Intergenic
1126452026 15:48818839-48818861 CATTCACCCATGGAAGGATCTGG + Intergenic
1126847634 15:52776013-52776035 CTTGTACCCAGGGAAGTGGCTGG + Intronic
1129176212 15:73841507-73841529 CTTTCTCCCAGGTCAGGGGCAGG - Intergenic
1129220265 15:74128319-74128341 CTTTCCCCCAGGGCAGCCTCCGG + Exonic
1129919755 15:79310604-79310626 CTTTCACCTTGGGAAGGGTATGG + Intergenic
1130548760 15:84875584-84875606 ATTTACCCCAGGGCAGGGTCTGG + Intergenic
1132396672 15:101479794-101479816 TCTCCACCCAGGGAAGAGTCCGG + Intronic
1133465222 16:6020937-6020959 CTTGCTGCCAGGGAATGGTCAGG + Intronic
1133774994 16:8889151-8889173 CTTTGTCCCAGGGAAGCCTCAGG + Intergenic
1134162334 16:11901753-11901775 CTTTCACCCAGGCTAGAGTGCGG - Intronic
1135711477 16:24721016-24721038 CTGTCACCCAGGCTAGGGTGCGG - Intergenic
1136736755 16:32473925-32473947 CTTTCCCCCACGGAAGGGCTTGG + Intergenic
1137899618 16:52252791-52252813 CTTGCACCCAGGTAAAGCTCAGG - Intergenic
1141630787 16:85286953-85286975 CTTCCACCCTGGAAAGCGTCGGG + Intergenic
1203016313 16_KI270728v1_random:355652-355674 CTTTCCCCCACGGAAGGGCTTGG - Intergenic
1203034648 16_KI270728v1_random:628810-628832 CTTTCCCCCACGGAAGGGCTTGG - Intergenic
1143200672 17:5111328-5111350 CTTTCACACAGGGAAGGAGGTGG + Intronic
1143579696 17:7818290-7818312 CCTGCATCCACGGAAGGGTCAGG - Exonic
1143832245 17:9661812-9661834 GGATCACCCAGGGAAGGGTATGG - Intronic
1144655792 17:17035665-17035687 CTTGCTTCCAGGGAAGGGTGGGG + Intergenic
1145310306 17:21697654-21697676 CCTACACCCAGGGCAGGGCCTGG + Intronic
1147414985 17:40282141-40282163 CTTTAACCGAAGGAAGGGTTTGG + Exonic
1147872614 17:43598258-43598280 CTTTCACCCAGGAGAGAGTTTGG - Intergenic
1148194628 17:45704448-45704470 CTGGCACACAGGGAAGGGTGTGG + Intergenic
1148546922 17:48526287-48526309 GATTCCCCCAGGGAAGGGTGAGG - Intergenic
1148758373 17:49986446-49986468 CTGACACCCAGGGAAGGATGTGG + Intergenic
1151571360 17:74927448-74927470 CTTTCTCCCAGGGGAGGGAGTGG + Intronic
1152419674 17:80185663-80185685 CTTTCCCCCAGCCCAGGGTCGGG + Intronic
1154176115 18:12087964-12087986 GTTTCAAGCAGGGAAGGGCCAGG - Intergenic
1158399990 18:57113434-57113456 ATTTCACCCAGAGGAGGGCCTGG + Intergenic
1158446723 18:57528565-57528587 CTATCACCCAGGGCTGGATCAGG + Intergenic
1159046975 18:63378167-63378189 CTGTCACCCAGGCTAGGGTGTGG + Intergenic
1161200520 19:3012214-3012236 CTGTCACCCAGGGAGGAGTGTGG - Intronic
1161574585 19:5048565-5048587 CTCCAACCCAGGGAAGGGCCAGG - Intronic
1162565562 19:11444422-11444444 CCTTCACCCACAGAAAGGTCAGG + Intronic
1162646372 19:12053050-12053072 CTGTCACTCAGGGAAGGGGGCGG - Intergenic
1163323682 19:16589228-16589250 CTGTCACCCAAGAAAGAGTCTGG + Intronic
1163651934 19:18522688-18522710 CTTCCACCCAGGGAAGGTGCTGG + Intergenic
1164167138 19:22690769-22690791 CTGTCACCCAGGCTAGGGTGCGG + Intergenic
1164428953 19:28170070-28170092 CTTCCAGCCAGGGAAGGGGAGGG - Intergenic
1165894205 19:39131713-39131735 CTCCCAGCCTGGGAAGGGTCGGG - Intronic
1166766171 19:45252853-45252875 CTTGAAACCAGAGAAGGGTCTGG - Intronic
1168282585 19:55313326-55313348 CCCTGACCCAGGGAAGGGCCTGG + Intronic
1168413798 19:56156458-56156480 CTTTCCTCCAGGGTAGGGGCAGG + Intronic
925877596 2:8326312-8326334 CTTCCACCAAAGGAGGGGTCTGG - Intergenic
926060786 2:9803422-9803444 CTTCCACACAGGAGAGGGTCTGG + Intergenic
927550947 2:23998764-23998786 CTTTCATCCAGGTTAGGGTACGG + Intronic
928327976 2:30335121-30335143 GTTTCACCCAGGGGAGGATGAGG + Intergenic
929939235 2:46319234-46319256 ATTTTACCCAGGGTAAGGTCTGG - Intronic
931693898 2:64858217-64858239 CTGTCACCCAGTGTAGGGCCAGG - Intergenic
932296897 2:70632239-70632261 CTGTCTCCCAGGAATGGGTCTGG - Intronic
933132625 2:78691256-78691278 CTTTCACCCAGGCTGGGGTGCGG - Intergenic
933990915 2:87633252-87633274 TATTTACCCAGGCAAGGGTCCGG + Intergenic
935515081 2:104026645-104026667 CTTTCACCAAAGGCAGGGCCCGG + Intergenic
936302927 2:111317571-111317593 TATTTACCCAGGCAAGGGTCCGG - Intergenic
936615978 2:114048163-114048185 CCTGCACATAGGGAAGGGTCTGG + Intergenic
938273604 2:129996285-129996307 CTTTCACCCAGGCTAGAGTAGGG - Intergenic
938274464 2:130005772-130005794 CTTTCACACAGGGAAGCCTGGGG + Intergenic
938440909 2:131331508-131331530 CTTTCACACAGGGAAGCCTGGGG - Intronic
941974192 2:171385545-171385567 CTTTCACCCAGGGAAGAGGAAGG - Intronic
943742150 2:191421507-191421529 CTGTCACCCAGGTCAGAGTCCGG + Intronic
944574709 2:201080739-201080761 CTGTCACCCAGGCTAGGGTGTGG + Intronic
945048239 2:205800421-205800443 CTTCCACTCAGGGAGGGGACGGG + Intergenic
945477607 2:210303934-210303956 CTGTCATCAAGAGAAGGGTCTGG - Intronic
946390513 2:219413300-219413322 CTTTCCCCCACTGAATGGTCTGG - Intergenic
947394918 2:229676836-229676858 CTGTCACCCAGTGTAGGGTTTGG + Intronic
947722515 2:232378538-232378560 GTGTCCCCCAGGGAAGGGTGCGG - Exonic
947915462 2:233829407-233829429 CCCTCACCCAGGGAAGAGGCGGG + Intronic
948578457 2:238968946-238968968 TTTTCATCCAGGGAACTGTCAGG - Intergenic
1168877166 20:1179936-1179958 CTTTTACACAGGAAAGGGTGAGG - Intronic
1169415625 20:5413626-5413648 CTTTTACCCAAGAGAGGGTCAGG - Intergenic
1170442119 20:16389765-16389787 ATTTCACCCAGGGTAGGCTCTGG + Intronic
1172234045 20:33357788-33357810 CTGTCACCCAGGCTAGGGTGTGG + Intergenic
1172237192 20:33385701-33385723 CTTTCACCCGGGGCAGGGAGAGG - Exonic
1172880665 20:38197868-38197890 CTTCCACCCAGAGAAGTTTCTGG - Intergenic
1175395990 20:58662068-58662090 CTCTTACCCAGGGAAGTGTCTGG + Intronic
1175465030 20:59185065-59185087 CTTTGAGCGAGGGAAGGGTCCGG - Intergenic
1175993449 20:62801402-62801424 CCTGCAGCCAGGGAAGGGTGGGG + Exonic
1179808611 21:43855843-43855865 ATGTCACCCAGGGAAAGGCCTGG + Intergenic
1180789505 22:18567152-18567174 CTTTACCCCAGGGGAGGGTGTGG + Intergenic
1181232237 22:21428160-21428182 CTTTACCCCAGGGGAGGGTGTGG - Intronic
1181246414 22:21506697-21506719 CTTTACCCCAGGGGAGGGTGTGG + Intergenic
1181497400 22:23295241-23295263 CTTGCACCCAGGGTGGGGTGGGG + Intronic
1181696159 22:24593748-24593770 CTGTCACCCAGGGTAGAGTGCGG - Intronic
1184235906 22:43182933-43182955 CTTTCACCAAGTGAAGGTTGTGG + Intronic
1184711759 22:46254630-46254652 CTTAACCCCTGGGAAGGGTCAGG + Intergenic
1185213654 22:49586321-49586343 CTTCCAGCCAGGGCAGGCTCAGG + Intronic
949187710 3:1213212-1213234 CTTTCACTCAGAGAAAAGTCTGG - Intronic
950757297 3:15186329-15186351 CTTTCCTCCAGAGAAGGGTAAGG + Intergenic
953033404 3:39192095-39192117 CTTCCTCCCAGGGAAGCTTCAGG - Intronic
954629791 3:52041593-52041615 GTTCCAGCCAGAGAAGGGTCTGG - Intergenic
954815034 3:53273566-53273588 CTGTCACCCCAGGAAGGGACAGG - Intergenic
954881367 3:53838113-53838135 CTAACACCCAGGCAAGGGTGGGG + Intronic
956532031 3:70231423-70231445 CTTTCACTCAGGAAGGCGTCGGG - Intergenic
956782872 3:72618217-72618239 ATCTCACCCAGGCAAGGGACAGG - Intergenic
958161029 3:89817252-89817274 CTTCCAACCAGGGAAAGCTCAGG + Intergenic
960000973 3:112731518-112731540 CTTTCTCCCAGGTATGGGGCAGG + Intergenic
961658071 3:128454103-128454125 GTTTAACCCTGGGAATGGTCTGG - Intergenic
962724473 3:138209108-138209130 CTCTCAGCCAGGGAAGAGTGAGG - Intronic
962747967 3:138411573-138411595 CCATAACCCAGGGAAGGGCCTGG + Intergenic
963776985 3:149449835-149449857 CTTTCCCCCAGAGAAGCCTCTGG + Intergenic
964179425 3:153865565-153865587 CTTTGGCCCAGGGAAGGTCCAGG - Intergenic
968083581 3:195863819-195863841 CTGTCACCCAGGGCAGGGCCTGG + Exonic
968215292 3:196884273-196884295 CTCTCACCCAGTGATGGTTCTGG + Intronic
968447447 4:658819-658841 CTTTCACCCTGGGAAGGCCCTGG - Intronic
968497778 4:927790-927812 CGCTCACCCAGGGAGGGGTGCGG - Intronic
968497789 4:927819-927841 CGCTCACCCAGGGAGGGGTGCGG - Intronic
969065960 4:4481269-4481291 CTATCATCCTGGGAAGGGTGAGG - Intronic
969337063 4:6517245-6517267 CTTTCACACAGGGCAGGTGCCGG - Intronic
969444972 4:7239501-7239523 CTTTCACCCAGGGAAGGGTCTGG - Intronic
969705966 4:8791796-8791818 CTCACAGCCAGGGAAGGGCCAGG + Intergenic
976776672 4:88714138-88714160 CTGTCACCCAGGCTAGAGTCTGG + Intergenic
977187028 4:93951508-93951530 GTTTCACCTAGGGAAGGGAAGGG + Intergenic
977214828 4:94269277-94269299 TTTGCACACAGGGAAGGGTCTGG - Intronic
979011050 4:115368955-115368977 CTTTCACCAAGGGAGTGCTCAGG + Intergenic
981555564 4:145989596-145989618 CTTTCACCCAGGTTAGAGTGCGG - Intergenic
985067948 4:186142002-186142024 CTTTCCTCCAGGGAAGGCTGGGG - Intronic
986645866 5:9915469-9915491 ATTTCACCCAGGGATGCTTCCGG + Intergenic
988497630 5:31758450-31758472 CTGTCCCCCAGGGTAGGGCCTGG - Intronic
990672685 5:58150450-58150472 GTATCACCCAGGGAGGGCTCTGG - Intergenic
990906306 5:60806995-60807017 CTGTGGCCCAGGAAAGGGTCGGG + Intronic
995581925 5:113611534-113611556 ATTTTAGCCAAGGAAGGGTCAGG + Intergenic
995793666 5:115920465-115920487 CTCTCACTCTGGGAAGGATCAGG + Intergenic
997182912 5:131850556-131850578 CTTTCCCCCATTGAATGGTCTGG - Intronic
998359342 5:141571832-141571854 TCTTCACCCAGGGAAGGGAAGGG + Intronic
998986494 5:147763667-147763689 CTTTCACCCAGGTAATGGAGAGG + Intronic
1001558685 5:172655088-172655110 TCTTCACCTAGGGAAGGGACCGG + Intronic
1003144403 6:3497719-3497741 CTTTCACCCAGGCCAGAGTGCGG - Intergenic
1006257120 6:32840757-32840779 ATTTCCCCCAGGGAAGTTTCTGG - Exonic
1011172750 6:84524095-84524117 CTTCCACCTAGTGAAAGGTCAGG - Intergenic
1014267131 6:119292439-119292461 CTATCACCTAGGACAGGGTCTGG - Intronic
1016283721 6:142449439-142449461 CTGTCACCCAGGTTAGAGTCAGG + Intergenic
1016550398 6:145273292-145273314 CTTTTACTTGGGGAAGGGTCAGG + Intergenic
1017942118 6:159062007-159062029 CCTGCCCCCAGGGAAGGGTTTGG - Intergenic
1018610627 6:165644535-165644557 CTGTCACCCAGGGAAGGTGAAGG + Intronic
1018971718 6:168534476-168534498 TCATCACCCAGGGAAGGGCCAGG - Intronic
1020017693 7:4841106-4841128 CCTTCACCCACAGCAGGGTCTGG - Intronic
1021876933 7:25058377-25058399 CTTCCTCCCTTGGAAGGGTCTGG + Intergenic
1024934967 7:54702533-54702555 CTTTAACCCTGGGATGGGACTGG + Intergenic
1029462811 7:100706042-100706064 CTTGCGCTCAGGGAAGGGGCGGG + Exonic
1030223504 7:107123661-107123683 CTTTGGCCCAGGGTAGGGCCAGG + Intronic
1030720909 7:112869070-112869092 CTTTGACCCAAGGAAGGCTTTGG - Intronic
1031881008 7:127198703-127198725 CTGTCACCCAGGATAGAGTCTGG + Intronic
1032074209 7:128828743-128828765 CTTTAAGCCAGGGAAGGTTCTGG - Intergenic
1032837015 7:135683902-135683924 CTTCCTTCCAGGGAAGGGTTGGG + Intronic
1037948983 8:23006749-23006771 CCTGCCCCCAGAGAAGGGTCGGG + Exonic
1039509371 8:38078598-38078620 CTGTCACCCAGGCCAGGGTGCGG - Intergenic
1039517345 8:38145086-38145108 CTGTAAGACAGGGAAGGGTCTGG - Intronic
1040277401 8:46021019-46021041 CTTTCATCCACGGGAGGATCAGG + Intergenic
1045377201 8:101585955-101585977 GTTCCCTCCAGGGAAGGGTCAGG + Intronic
1047772169 8:128038368-128038390 CTCACACCCAGGGAAGTGCCAGG - Intergenic
1048355861 8:133653698-133653720 CTCTCATCCAGGGTGGGGTCTGG + Intergenic
1049949568 9:630916-630938 CTGTCACCCAGGCTAGGGTGTGG - Intronic
1051727319 9:20101664-20101686 CTTTCCCAAAGGGAAAGGTCAGG - Intergenic
1052729165 9:32265087-32265109 CTTACACCCAGGAAAGAGTGAGG + Intergenic
1053142264 9:35689581-35689603 CTCTCACCCAGGGTGGGGGCTGG - Intronic
1054936801 9:70696829-70696851 CTTACAGGCAGAGAAGGGTCTGG - Intronic
1061755859 9:132812268-132812290 CTGTCACCCAGGCAAGAGTGTGG + Intronic
1062149809 9:135012032-135012054 CTTCCACCCAAGGAAGGTTCAGG + Intergenic
1062194441 9:135265138-135265160 CTTTCACAGAGTGAGGGGTCAGG - Intergenic
1062284624 9:135767576-135767598 CATTCACCCAGGGCTGGGTTGGG - Intronic
1062419032 9:136470283-136470305 CTTTCACCAGAGGCAGGGTCAGG - Intronic
1186020789 X:5252842-5252864 CTTTCAAGCTGGGAAGTGTCAGG + Intergenic
1186630643 X:11344861-11344883 CTCTCTCCCAGGTAAGGGTATGG - Intronic
1188885800 X:35547308-35547330 CTTTGCCCCAAGGAAGGGTTTGG - Intergenic
1189606282 X:42681713-42681735 CTTTCTCCCAGGTATGGGGCAGG + Intergenic
1190384535 X:49872205-49872227 CTTTCAGCCAGAGAAGGGCTTGG + Intergenic
1190487056 X:50937958-50937980 CTTTCACACATTGAATGGTCAGG + Intergenic
1192487594 X:71543248-71543270 CTTTCACCCATGGAACAGTTTGG + Intronic
1193006681 X:76626615-76626637 CTTTCCACCAGGAAAAGGTCTGG - Intergenic
1195673223 X:107486189-107486211 ATGGCACCCAGGAAAGGGTCAGG - Intergenic
1196003929 X:110815380-110815402 CTGTCACACTGGCAAGGGTCTGG - Intergenic
1196009895 X:110875576-110875598 CTTTTACCCAGGAAAGGGTGAGG + Intergenic
1198168144 X:134077730-134077752 CTTTGACCCAAGGAGGGGTTTGG - Intergenic