ID: 969445329

View in Genome Browser
Species Human (GRCh38)
Location 4:7241573-7241595
Sequence CACCCCAGAAGGGCAGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 538
Summary {0: 1, 1: 0, 2: 5, 3: 46, 4: 486}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969445329_969445340 -3 Left 969445329 4:7241573-7241595 CCCCTCCCTGCCCTTCTGGGGTG 0: 1
1: 0
2: 5
3: 46
4: 486
Right 969445340 4:7241593-7241615 GTGCATGGTTTGGTTGGAGGAGG 0: 1
1: 0
2: 1
3: 23
4: 213
969445329_969445341 30 Left 969445329 4:7241573-7241595 CCCCTCCCTGCCCTTCTGGGGTG 0: 1
1: 0
2: 5
3: 46
4: 486
Right 969445341 4:7241626-7241648 TGAGAAACAAAAGAATCCACAGG 0: 1
1: 0
2: 1
3: 31
4: 415
969445329_969445339 -6 Left 969445329 4:7241573-7241595 CCCCTCCCTGCCCTTCTGGGGTG 0: 1
1: 0
2: 5
3: 46
4: 486
Right 969445339 4:7241590-7241612 GGGGTGCATGGTTTGGTTGGAGG No data
969445329_969445338 -9 Left 969445329 4:7241573-7241595 CCCCTCCCTGCCCTTCTGGGGTG 0: 1
1: 0
2: 5
3: 46
4: 486
Right 969445338 4:7241587-7241609 TCTGGGGTGCATGGTTTGGTTGG 0: 1
1: 0
2: 0
3: 10
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969445329 Original CRISPR CACCCCAGAAGGGCAGGGAG GGG (reversed) Intronic
900110772 1:1004635-1004657 CATCCCAGACAGGCAGGGTGGGG - Intergenic
900191507 1:1354161-1354183 GTCCCCAGGAGGGCCGGGAGGGG + Intronic
900427603 1:2587595-2587617 CACCCCCGCAGGGCAGGGAGGGG - Intronic
900520319 1:3102233-3102255 CTCCCCAGCGGGGCTGGGAGGGG + Intronic
900592886 1:3467756-3467778 GACCCCTGCAGGGCAGGGACGGG - Intronic
900619249 1:3579510-3579532 CCCCCTAGAAAGGCAGGGGGTGG - Intronic
900882036 1:5389313-5389335 ATCCCCAGAGCGGCAGGGAGAGG + Intergenic
900968440 1:5975812-5975834 ATCCCGAGAAGGGCAGAGAGAGG + Intronic
901439999 1:9272102-9272124 CACCACAGAGAAGCAGGGAGGGG - Intergenic
901859257 1:12063754-12063776 CACTCCAGCTGGGCAGGGAACGG - Intronic
902229080 1:15015942-15015964 CAACCCAGCAGAGCAGGGACGGG - Intronic
902459170 1:16559323-16559345 AATCCCTGAAGGGCAGGTAGTGG - Intergenic
902896188 1:19481740-19481762 CACCCCAAAAGGCCTGGGAGTGG + Intronic
903060207 1:20663953-20663975 CAGGCCACAATGGCAGGGAGGGG + Intergenic
903152366 1:21420005-21420027 AATCCCTGAAGGGCAGGTAGTGG - Intergenic
903219214 1:21859751-21859773 CATCCCACTAGGGCAGGGACAGG + Intronic
903258152 1:22116504-22116526 ATCCTCAGAAAGGCAGGGAGAGG - Intergenic
903453614 1:23471416-23471438 AACTCCAGAAAGGCAGGGAATGG + Intronic
903868092 1:26412626-26412648 CACCCAGGCCGGGCAGGGAGGGG + Intronic
904383261 1:30125468-30125490 CACCGCAGAGGGGCAGAGACAGG - Intergenic
904612745 1:31734330-31734352 GAGCCCAGCTGGGCAGGGAGAGG + Intronic
904675303 1:32195564-32195586 GAGCTCTGAAGGGCAGGGAGGGG - Exonic
904711425 1:32433265-32433287 CCCCCCAGAAAGGCAGAGAAGGG - Intergenic
904847536 1:33431166-33431188 CACCCTAGAAGGGCGGGGATTGG + Intergenic
905499564 1:38426039-38426061 CCCCCCAGAAAGGCAGAGAAGGG - Intergenic
905975616 1:42171641-42171663 TGCCCCAGAAGGGCAGGGGGTGG + Intergenic
906113085 1:43337712-43337734 GGCCCCAGAGGGGCAGGGACAGG + Intergenic
906328977 1:44868641-44868663 ACCCACAGAAGGGCAGGGAAAGG + Intronic
906794591 1:48687046-48687068 CAACACAGAGGGGCAGGGGGTGG + Intronic
908430108 1:64048426-64048448 AGCCCCATAAGGGCAGGGATGGG - Intronic
909736221 1:78966211-78966233 CACCCCAGAACAGGAGAGAGAGG - Intronic
909788480 1:79643545-79643567 CCCCCCAGAATGGCAGAGAAGGG + Intergenic
912501711 1:110127038-110127060 TGCCCCAGGAGGGCAGGGAAAGG - Intergenic
912797239 1:112700638-112700660 CTCCCCAGCAGGGGAGGGGGTGG - Exonic
915590085 1:156865747-156865769 GCCCTCAGAAGGCCAGGGAGGGG - Intronic
916023431 1:160814192-160814214 ACCCTCAGAAGGGCAGAGAGGGG + Intronic
916660911 1:166921540-166921562 CACCCCAGAACGTCAAGTAGGGG + Intronic
916731673 1:167572163-167572185 CACCCAAGAAGTGCAAGGAGTGG - Intergenic
918142069 1:181727880-181727902 CACCCCACAAGGCAAGGAAGAGG - Intronic
918448316 1:184635705-184635727 CACTCTGGAGGGGCAGGGAGAGG - Intergenic
919925194 1:202188547-202188569 TATGCCAGAGGGGCAGGGAGGGG - Intergenic
920059651 1:203218475-203218497 CCCCCAAGCAGGGCAGGTAGAGG - Intronic
920217977 1:204375024-204375046 CACCCCAGAAGGCAAGGAAGAGG - Intronic
921020826 1:211234334-211234356 AACCCCAGATGGAGAGGGAGAGG + Intergenic
921037280 1:211393371-211393393 CAACCCAGAAGACCAGCGAGGGG - Intergenic
921509051 1:216008936-216008958 CCCCCCAGAAAGGCAGAGAAGGG - Intronic
921702401 1:218283500-218283522 GAACCCAGAGGGGCGGGGAGGGG - Intergenic
922041027 1:221897633-221897655 CAGGGCAGAAGGGCAAGGAGAGG + Intergenic
922187710 1:223290625-223290647 AGCCCCAGATGTGCAGGGAGGGG - Intronic
922794748 1:228334552-228334574 AGCCCCAGACAGGCAGGGAGAGG + Intronic
922934596 1:229413317-229413339 CCCCCCAGAAAGGCAGAGAAGGG - Intergenic
922980604 1:229823310-229823332 CCTCCCAGGAGGTCAGGGAGTGG - Intergenic
923019314 1:230150726-230150748 CATCCTAGAAGGCCAAGGAGAGG - Intronic
923156156 1:231281200-231281222 CACAGCAGAAGGGCGGGAAGTGG + Intergenic
923541237 1:234889721-234889743 CCCCCCACAAGGGGAGGGCGTGG - Intergenic
924195708 1:241604766-241604788 AACCACAGAAGGGCAGTCAGTGG + Intronic
1062768433 10:82205-82227 CAGCCCAGCAGGGAGGGGAGGGG + Intergenic
1063122738 10:3115912-3115934 CAACACAGAAGGGCGGGCAGTGG - Intronic
1063973589 10:11397979-11398001 CATCCCACATGGTCAGGGAGAGG - Intergenic
1066446101 10:35485213-35485235 CTCCACAGAATGGCAGGGATAGG - Intronic
1066598501 10:37078155-37078177 CACACACGAGGGGCAGGGAGAGG - Intergenic
1066688421 10:38003089-38003111 CACCCCAGAGTGGCTGGGGGTGG - Intergenic
1067030323 10:42875339-42875361 GACCCCAGAAGCACAGGGAGGGG - Intergenic
1067542521 10:47166226-47166248 AAAGCCAGAAGGGGAGGGAGGGG + Intergenic
1067797680 10:49332608-49332630 CTCTCCCGAAGGGCAAGGAGGGG - Intergenic
1067832220 10:49616767-49616789 GATCCCAGAAGGGCCTGGAGGGG + Intronic
1069006273 10:63320932-63320954 CACCCCAGACCTCCAGGGAGAGG + Intronic
1069559755 10:69421076-69421098 CTCCCAAGAGGGGCAGGGCGAGG + Intergenic
1069857395 10:71448874-71448896 CCCACCAGCAGGCCAGGGAGAGG + Intronic
1070154517 10:73825182-73825204 CAGGCCAGGAGGCCAGGGAGGGG + Intronic
1070356201 10:75642739-75642761 CACACCAGAAGGGCAGTAAAGGG + Intronic
1070509894 10:77151470-77151492 CACTTCAGAAGGGCAAGGGGGGG - Intronic
1070813347 10:79309366-79309388 CACCCTGGGAGAGCAGGGAGGGG - Intronic
1071118209 10:82248488-82248510 CAGCATGGAAGGGCAGGGAGAGG - Intronic
1071354932 10:84784538-84784560 CACCCCAGGCAGGGAGGGAGTGG - Intergenic
1073497675 10:103908498-103908520 GAACCCAGAACAGCAGGGAGCGG + Intronic
1075463035 10:122631408-122631430 CACTCCAGAAGAGCATGCAGGGG + Intronic
1075553798 10:123414105-123414127 CTCCAGAGCAGGGCAGGGAGGGG + Intergenic
1075654720 10:124153302-124153324 CACCCCAGCAGAGGAAGGAGAGG + Intergenic
1076105621 10:127820560-127820582 CTCTCCTGAAGCGCAGGGAGGGG + Intergenic
1076809400 10:132878839-132878861 CACCCCAGCAGGGCAGCGCCAGG - Intronic
1077324298 11:1957095-1957117 AACCCGAGAAGGGCCGGGAAGGG + Intronic
1078086680 11:8237678-8237700 CTCCCCACGAGGGCAGGGAGAGG + Intronic
1078302931 11:10152258-10152280 CACCCCATATAGGCCGGGAGCGG + Intronic
1081630733 11:44687944-44687966 CAGCCCAGCAGGGAAGGCAGAGG + Intergenic
1082087441 11:48061684-48061706 CACCCCAGAGGGGCCTTGAGAGG + Intronic
1083479458 11:62934243-62934265 AGCCCAGGAAGGGCAGGGAGGGG + Intergenic
1083510831 11:63208372-63208394 CAACCCAGAATGGCTGGGGGTGG + Intronic
1084205995 11:67593343-67593365 GAAGCCAGAAGGGCATGGAGTGG + Intergenic
1084424353 11:69076608-69076630 CACCGCAGGAGGGCAGGTGGAGG - Intronic
1084463127 11:69307337-69307359 CACCCCAGCAGGTGAGGGCGGGG + Intronic
1084480190 11:69415607-69415629 CACCCCAGACTGGGAGGAAGGGG - Intergenic
1084688068 11:70708918-70708940 TACACAAGAAGGGCAGGGCGTGG + Intronic
1084708589 11:70830174-70830196 TCCCCCAGAAAGGCAGGGATGGG - Intronic
1084813292 11:71629095-71629117 CTCCCCAGAAGGGCAGGAGCGGG + Intergenic
1084945688 11:72637166-72637188 CAGCCCAGAGTGGGAGGGAGGGG - Intronic
1085040180 11:73322292-73322314 CAGGCCAGAAGGGCAGGAGGAGG + Intronic
1085521643 11:77142666-77142688 CAGCCCAGGTGAGCAGGGAGGGG - Intronic
1085785229 11:79442317-79442339 CATCTCAGAAAGGCAGGGATGGG + Intergenic
1085888184 11:80545654-80545676 CACCCTAGAAGGGTGGTGAGAGG - Intergenic
1087053280 11:93907236-93907258 CACCTCAGAAGTGAAGAGAGGGG + Intergenic
1088581897 11:111324751-111324773 CATCCCAGGAGGGCTGGGTGAGG + Intergenic
1089168034 11:116492841-116492863 CACTCCAGAAGGACTGGGGGAGG + Intergenic
1089365657 11:117919481-117919503 CACCCCAGGAGGGAAGGGCAGGG - Intronic
1089631496 11:119787272-119787294 CCTCCCAGGAGGGCTGGGAGCGG - Intergenic
1089987171 11:122825347-122825369 CCCCCCAGAAAGGCAGAGAAGGG - Intergenic
1090204007 11:124875068-124875090 CACACCAGAAGGGGAGGCTGGGG - Intronic
1090808345 11:130216857-130216879 CACCCCAGAAGGCCCCAGAGAGG - Intergenic
1091305179 11:134531949-134531971 CAGCACAGGAGGGCAGGAAGAGG - Intergenic
1202807284 11_KI270721v1_random:12290-12312 AACCCGAGAAGGGCCGGGAAGGG + Intergenic
1091395623 12:152729-152751 GAGCCCAGTGGGGCAGGGAGAGG + Intronic
1091676837 12:2497531-2497553 GATCCCAGAAGGGCATGGGGTGG - Intronic
1091737452 12:2934583-2934605 GACACCAGGAGGGCAGGCAGCGG - Intronic
1091875878 12:3932361-3932383 GACACCATCAGGGCAGGGAGAGG - Intergenic
1092386992 12:8043472-8043494 CAGGTCAGAAGGGAAGGGAGAGG + Intronic
1092727552 12:11500139-11500161 GACCGCAGAAGGACAGGGGGCGG - Intronic
1092793978 12:12092562-12092584 CACCCGAGAGGGACAGGCAGGGG + Intronic
1094392475 12:29966634-29966656 CACCTCTGAATGGCAGCGAGAGG - Intergenic
1096526411 12:52212765-52212787 TACCCCAGGAGGGCAGGTGGGGG - Intergenic
1096652178 12:53067261-53067283 CACCCAGGGAGGGCAGGCAGGGG + Intronic
1096971525 12:55670373-55670395 CAGCTCAGAAGGTCAGGGATAGG - Intergenic
1097695028 12:62767321-62767343 CACCAGTGAAGGGGAGGGAGGGG + Intronic
1097866560 12:64563987-64564009 CACCCCAGCTGGGCATGGAGTGG + Intergenic
1100364696 12:93909330-93909352 CAACGCAGAAGAGCAGGGATCGG - Intergenic
1100390956 12:94146517-94146539 CATTCCAGGAGGGCAGGGAGTGG + Intergenic
1100940081 12:99716110-99716132 CACCCCAGAAAAGCAGAGAAGGG - Intronic
1102509012 12:113401912-113401934 CATCCCAGAAGGCCAGGCAAGGG + Intronic
1102620606 12:114191667-114191689 CACCCCAGAAGATCAGAGGGCGG + Intergenic
1102706445 12:114884886-114884908 CATCCAAGAAGGGAACGGAGAGG - Intergenic
1102924535 12:116816466-116816488 CTCGCCAGAAGAGCAGAGAGAGG + Intronic
1103405245 12:120670406-120670428 CTCCCCAGCAGGGAAGGTAGTGG - Intergenic
1103518786 12:121524201-121524223 TTCCCCAGAAGGGAGGGGAGTGG - Intronic
1103573101 12:121857771-121857793 CAACCCAGAAGGTCACAGAGTGG + Exonic
1103874033 12:124113608-124113630 CACCCCAGCATGGCAGGCACAGG - Intronic
1104146685 12:126040735-126040757 AACCCCAGAGGAGCAGAGAGAGG + Intergenic
1104352172 12:128054305-128054327 GCCCCCAAATGGGCAGGGAGTGG - Intergenic
1104947270 12:132421665-132421687 CATCGCAGAAGGGCATGGAGCGG + Intergenic
1105280031 13:18958020-18958042 CACCCAAGAAGGGCAAGGTAGGG - Intergenic
1105427386 13:20306003-20306025 CACCCCAAAAGTGCTGGCAGGGG + Intergenic
1107654090 13:42574242-42574264 CAGACAAGAAGGGGAGGGAGCGG + Exonic
1107817345 13:44255963-44255985 CATCCCAGAAAGCCAGTGAGAGG - Intergenic
1110127951 13:71971064-71971086 GTCCACAGAAGGGCAGTGAGGGG + Intergenic
1111739646 13:92187593-92187615 CACCTCAGAATGACAGTGAGGGG - Intronic
1112174223 13:97005964-97005986 CAGTCCACAAGGGCAAGGAGAGG - Intergenic
1112374986 13:98830752-98830774 CACTCCATGAGGGCTGGGAGAGG + Intronic
1112727111 13:102317702-102317724 CTCCCCAGTAGTGAAGGGAGGGG - Intronic
1113238578 13:108311579-108311601 CACTGAAGAAGGGCATGGAGAGG + Intergenic
1113476022 13:110582000-110582022 CACCCCAGCAGGTCAGGGGTGGG + Intergenic
1113552646 13:111205031-111205053 CACTCCAGAGGGGCAGGGGCGGG + Intronic
1113785643 13:113000872-113000894 CAGCCGAGAAGGCCTGGGAGGGG - Intronic
1114430474 14:22656419-22656441 CATCCCAGAAGGACAGGAAGTGG + Intergenic
1115652877 14:35415685-35415707 CACCCCAGAAGGGCAGCAGGTGG - Intergenic
1116534995 14:46017162-46017184 CCCCCCAGAAAGGCAGAGAAGGG + Intergenic
1117315431 14:54567204-54567226 CACCCCAGGCGGGCCGTGAGGGG + Intronic
1118593447 14:67418795-67418817 CACCCCTCCATGGCAGGGAGAGG - Intergenic
1121223144 14:92301442-92301464 GAGGCCAGAGGGGCAGGGAGAGG + Intergenic
1121318062 14:92973975-92973997 CACCCCAGAGGGGCATGGAGGGG - Intronic
1122278489 14:100607757-100607779 CAACTCAGAAGGGGCGGGAGTGG + Intergenic
1122367488 14:101202790-101202812 GAGACCACAAGGGCAGGGAGAGG + Intergenic
1122383324 14:101326053-101326075 GACCTCAGAAGGTCAGGTAGAGG + Intergenic
1122641891 14:103164891-103164913 CACCCCAGCCAGGAAGGGAGGGG - Intergenic
1122913480 14:104845025-104845047 AACCCATGAAGGGAAGGGAGAGG + Intergenic
1202895282 14_GL000194v1_random:3022-3044 CCCACCACAAGGGCAGGCAGTGG + Intergenic
1124593989 15:31078656-31078678 CAAAACAGAAGGGCAGGGCGGGG - Intronic
1125439759 15:39689390-39689412 CACCCTAGATGTCCAGGGAGGGG - Intronic
1126234907 15:46372622-46372644 GACTCCAGAAGGGGAGAGAGTGG + Intergenic
1126843527 15:52739502-52739524 CCCCCCAGAAAGGCAGAGAAGGG - Intergenic
1127500200 15:59547894-59547916 CCATCCAGAAAGGCAGGGAGGGG - Intergenic
1128326897 15:66729690-66729712 CACCCAAGAAAGGGAGGGGGCGG - Intronic
1128330321 15:66751415-66751437 CAGCCTGGAAGGGAAGGGAGTGG - Intronic
1128939672 15:71777987-71778009 CATCCCAGAATGGGAGGCAGGGG + Exonic
1129205119 15:74032906-74032928 CACCCCTGCTGGGCTGGGAGTGG - Intronic
1129239753 15:74244382-74244404 CACACCAGTGGGGCAGGGATTGG + Intronic
1129518050 15:76168885-76168907 CAAGCCAGAAGGACAGGAAGGGG + Intronic
1129760431 15:78126087-78126109 CAGCCCAGGAGGGCTGGGAATGG + Intronic
1130901467 15:88209858-88209880 CAGGCCTGAAGGGCAGGGAATGG + Intronic
1131402185 15:92134058-92134080 CACCCCAGTAGGGCAGTGGTTGG + Intronic
1131495242 15:92904083-92904105 TTCCCCAGAAGAGCAGAGAGGGG - Intronic
1132342899 15:101089164-101089186 CACCCCCGGCGGGCAGGCAGAGG + Intergenic
1132457303 16:31228-31250 CAGCCCAGCAGGGAGGGGAGGGG + Intergenic
1132670695 16:1101132-1101154 CAGCCCAGACGGACAGTGAGGGG + Intergenic
1132687643 16:1168941-1168963 CACCCCAGGCGGGCAGGGGGCGG - Intronic
1133225872 16:4340130-4340152 CAGCCCAGAAGGGCCGGGCTGGG - Intronic
1133506769 16:6419950-6419972 CAGGCCAGAAGGGAAGGGATGGG - Intronic
1133977108 16:10607183-10607205 CACCACAAAAGGGCAGAGAGGGG + Intergenic
1134836967 16:17369458-17369480 CAGCCCAGGTGGGCAGGGTGGGG - Intronic
1135736221 16:24933787-24933809 CACCTCAGAGGCGCAGGGGGTGG + Intronic
1135757544 16:25110626-25110648 CACACAAGAGGGGGAGGGAGAGG - Intergenic
1136335237 16:29606394-29606416 CACCCCAGGGGGGCAGATAGAGG + Intergenic
1137588125 16:49676666-49676688 CACCCTAGATGGGCATGGAAAGG + Intronic
1137650371 16:50114763-50114785 CAGGTCAGAAGTGCAGGGAGTGG + Intergenic
1137785691 16:51135327-51135349 CGCCCCAGAACAACAGGGAGAGG + Intergenic
1138182527 16:54951615-54951637 CTGCCCAGAAAGGCTGGGAGGGG - Intergenic
1138183878 16:54961891-54961913 CACCCCAAAAGAGCTGGGAGGGG + Intergenic
1138205137 16:55119072-55119094 TACCCCAGCAGGGCAGGGCCAGG - Intergenic
1138238437 16:55406105-55406127 CATCACAGAGGGGCATGGAGTGG - Intronic
1138379349 16:56589604-56589626 CTCACCAGAAGGGCAGGGGCAGG - Exonic
1138591581 16:58001968-58001990 GACCCCAGCCTGGCAGGGAGTGG - Intronic
1139331632 16:66196858-66196880 CTCCCCAGATTGACAGGGAGAGG + Intergenic
1139432390 16:66918103-66918125 CAGCCCAGGTGGGTAGGGAGGGG + Intronic
1139650005 16:68357513-68357535 CTCCCCAGCTGGGAAGGGAGTGG + Exonic
1139952989 16:70680925-70680947 CACCCCAGCAGGGGAGGGGCAGG - Intronic
1141479623 16:84297779-84297801 GACCAGAGAAGGGCAGCGAGTGG - Intronic
1141687324 16:85577780-85577802 CACCCCAGCAGGGCAGATAAAGG + Intergenic
1141736181 16:85855382-85855404 TACCCCAGAGGGGCAAGGAGTGG + Intergenic
1142142048 16:88476810-88476832 CTTCCCAGAGGGGCAGGGAAAGG + Intronic
1142284186 16:89165053-89165075 CCCCCCCAAAGGGCAGGGTGTGG + Intergenic
1142389742 16:89791344-89791366 CTTCCCAGAAGGCCTGGGAGTGG - Intronic
1142718966 17:1763601-1763623 AACCCTACAAGGGCAGTGAGAGG - Intronic
1143445488 17:7006664-7006686 GTCCCCAGAAGGGCAGGGCTGGG - Intronic
1143498297 17:7324771-7324793 CTCCCAGGAAGGGCAGGGACAGG - Intronic
1143618455 17:8067547-8067569 CATCCCAGTAGCCCAGGGAGGGG - Intergenic
1144634661 17:16897485-16897507 CACCCCAGGAGGATAGGGACCGG - Intergenic
1144723791 17:17491112-17491134 CACCCCCAGAGGGCAGGGACGGG - Intronic
1144733081 17:17539982-17540004 CACCCCAGGAGTGCAGGGACAGG + Intronic
1144784390 17:17823715-17823737 CAGCCCCGAAGGGCGGGGCGGGG - Intronic
1144800368 17:17922068-17922090 CATCCCAGTCTGGCAGGGAGAGG - Intronic
1146164658 17:30578321-30578343 CACCCCAGGAGGATAGGGACCGG - Intergenic
1146262711 17:31432184-31432206 CACCCCAGAGCGGGAGAGAGAGG - Intronic
1146448178 17:32949936-32949958 CACTCCAGAACTACAGGGAGAGG - Intergenic
1146791424 17:35752856-35752878 GACCCCAGCAGGGCAGGAGGTGG + Exonic
1147044366 17:37742660-37742682 GGCCCCAGCAGGGCAGGGAGAGG - Intronic
1147705687 17:42423330-42423352 CACCCCAGAAAGGGAGGGACCGG + Exonic
1148231077 17:45935397-45935419 CACCCCAGAAAGCCAGTCAGAGG + Intronic
1149224979 17:54459453-54459475 CATCTCAAAAGGGCAGGGAAAGG - Intergenic
1150848985 17:68686798-68686820 CATCCCAGCGGGGCAGGGGGTGG + Intergenic
1151310740 17:73291126-73291148 CACCCCAGAAAGACAGGGACAGG + Intronic
1151679170 17:75614755-75614777 CTCCCCTGTGGGGCAGGGAGAGG - Intergenic
1152093293 17:78258530-78258552 CTCTCAAGAAGGCCAGGGAGGGG - Intergenic
1152213778 17:79020266-79020288 CATCCCACAAGGGCAGAGATTGG - Intergenic
1152464717 17:80459267-80459289 GACCCCTGAAGGCAAGGGAGAGG + Intergenic
1152699792 17:81813183-81813205 CACCCAATAAGAGCAGGGGGAGG - Intronic
1152723320 17:81933373-81933395 CTCCCTAGAGAGGCAGGGAGAGG + Exonic
1152921286 17:83067782-83067804 CATCCCAGAGGGGACGGGAGGGG - Intergenic
1153535850 18:6100841-6100863 CACCCTAGCAGAGCTGGGAGGGG + Intronic
1154023127 18:10682713-10682735 CACCCTCCAAGGGCAGGGAAGGG - Intronic
1157517935 18:48324222-48324244 CAGCCCAGAGGGCCAGGGAATGG + Intronic
1158394881 18:57071511-57071533 CCCCCCAGAAAGGCAGAGAAGGG + Intergenic
1158877739 18:61749208-61749230 CATCCCGGTGGGGCAGGGAGGGG + Intergenic
1160742778 19:695122-695144 CCCCCCAGATGCGCTGGGAGGGG + Intronic
1161046298 19:2136627-2136649 CACCCCACATGGGCAGGGAAGGG + Intronic
1161119365 19:2516939-2516961 CACCCCAGCAGGGCTGGGGCTGG + Intronic
1161620688 19:5295433-5295455 CACCCCCGAGGGGCTGGGGGAGG + Intronic
1161658480 19:5530717-5530739 CAGCCAAGAAGTGCAGAGAGGGG - Intergenic
1162730355 19:12715007-12715029 CAGCCCAGGCGGGCAGGCAGGGG - Intronic
1162924975 19:13926391-13926413 CACCCCCGAAGGCCAGGGTGGGG + Intronic
1163010653 19:14423547-14423569 CAGGCCACAAGGCCAGGGAGGGG + Intergenic
1163128232 19:15255967-15255989 CACCCAATGAGGACAGGGAGGGG + Intronic
1163229141 19:15988172-15988194 CAGCCCATATGGGCAGGGATGGG - Intergenic
1163231116 19:16002996-16003018 CAACCCAGAAGGGCTGGGGGTGG - Intergenic
1163492222 19:17623605-17623627 CTCCCGGGAAGGCCAGGGAGGGG + Intronic
1163618063 19:18341190-18341212 CCCCCCAGGAGCGCAGGGCGCGG - Intronic
1163638802 19:18450270-18450292 CACTCCAGACAGGCAGGGAGAGG + Intronic
1163665911 19:18604078-18604100 CACTCTAGAAGGGCTGAGAGGGG - Intronic
1163775200 19:19213258-19213280 CACCCCAGACAGGCAGGGAGGGG + Intronic
1165219934 19:34307210-34307232 CACCTCTGAAGGGCAGGGGATGG + Intronic
1165383415 19:35496246-35496268 AGTCCCAGAAGGTCAGGGAGAGG - Intergenic
1165714719 19:38036877-38036899 CACAGCAGAAGGGGACGGAGAGG + Intronic
1165738759 19:38193541-38193563 CACCGCAGAAGGGCCTGCAGCGG + Exonic
1165955133 19:39497877-39497899 CACCCCAGAAGAACTGGGGGGGG - Intergenic
1166231405 19:41427405-41427427 CAGTCCAGAGGGGCGGGGAGGGG + Exonic
1166395933 19:42441174-42441196 CAGCCTAGAAGGACAGGGGGTGG + Intronic
1166771947 19:45288929-45288951 CAGAGCAGAAGAGCAGGGAGTGG - Intronic
1167272045 19:48511363-48511385 CAGCCCAGCAGGGCCCGGAGCGG - Intronic
1167494509 19:49809635-49809657 CTTCCCAGATGGGCAGGGAATGG + Intronic
1167748785 19:51367849-51367871 CGCCCCAGGCGGGCAGGCAGGGG - Intronic
1167798564 19:51726397-51726419 CACCCGAGCAGGGCGGGGTGGGG - Intergenic
1168702902 19:58452075-58452097 AACCCCCCCAGGGCAGGGAGAGG - Intronic
1168705393 19:58467597-58467619 AACCCCCCCAGGGCAGGGAGAGG - Exonic
1202675417 1_KI270711v1_random:1507-1529 AATCCCTGAAGGGCAGGTAGTGG - Intergenic
1202708304 1_KI270714v1_random:561-583 AATCCCTGAAGGGCAGGTAGTGG + Intergenic
925064790 2:921593-921615 CACAGCAGAGGGGCAGGGATGGG - Intergenic
925085217 2:1102386-1102408 AATCCCAGAAGGGCAGGGCACGG - Intronic
925174161 2:1770695-1770717 CACCTCAGGAGGCCAGGCAGAGG + Intergenic
925201040 2:1967979-1968001 CACCCCAGGAGGGGAGGAGGGGG + Intronic
925326553 2:3026549-3026571 CACCCCACAAAGACAGGCAGAGG + Intergenic
925405475 2:3603192-3603214 CAGGCCAGAAGGGCAGAGTGCGG - Intronic
925469171 2:4140455-4140477 CTCCCAGGGAGGGCAGGGAGAGG - Intergenic
926225494 2:10964288-10964310 CAACCCAGCAGAGCGGGGAGTGG - Intergenic
926271050 2:11366336-11366358 CAGACTAGAAGGGGAGGGAGGGG - Intergenic
926483525 2:13428051-13428073 CACCCAGGAAGTGCAAGGAGCGG - Intergenic
927694577 2:25231192-25231214 CACTCCAGGAGGGCTGGGGGAGG - Exonic
927967526 2:27280690-27280712 GACCTCATAAGGGGAGGGAGGGG - Exonic
928129979 2:28642401-28642423 CAAATCAGAAGGGCCGGGAGGGG - Intronic
928438038 2:31268590-31268612 CACTCCAGAGGAGCAGGGAGCGG - Exonic
930878933 2:56250019-56250041 CAGCCATGAAGGGCAGGCAGGGG + Intronic
931042477 2:58315073-58315095 CCCCCCAGAAAGGCAGAGAAGGG - Intergenic
931286683 2:60838049-60838071 CAGGGCAGAAGGGCAGGGAAGGG - Intergenic
931289737 2:60862009-60862031 CAACCCAGAGAGGAAGGGAGAGG - Intergenic
931454593 2:62398632-62398654 CACTGCAGAATGGCAGGGAAGGG - Intergenic
931538100 2:63300537-63300559 CACCCCATCAGGGCAGTCAGAGG - Intronic
932267553 2:70381375-70381397 CTCCCTAGCAGGGCAGGAAGTGG - Intergenic
932295636 2:70621535-70621557 CCCCCCAGAAAGGCAGAGAAGGG - Intronic
932500942 2:72182212-72182234 CGCTCCAGAATGGTAGGGAGAGG + Intronic
932919023 2:75888803-75888825 TATCAGAGAAGGGCAGGGAGAGG - Intergenic
933714348 2:85349349-85349371 GGACCCAGAAGGGCAGGGCGGGG + Intronic
933850076 2:86358990-86359012 CACCCCACAAGGGGAGGCAGGGG - Intergenic
934618263 2:95788791-95788813 CATCCCGGAGGGGCAGGGTGTGG + Intergenic
934642630 2:96035768-96035790 CATCCCGGAGGGGCAGGGTGTGG - Intronic
934683750 2:96305588-96305610 CGCCCCAGAAGTGCGGGGCGGGG + Intergenic
934917266 2:98310310-98310332 GACCCCAGGAGGGCATGGAGTGG + Intronic
937274290 2:120674114-120674136 CAACCAGGAAGGACAGGGAGTGG + Intergenic
937282505 2:120729899-120729921 CACTGCAAATGGGCAGGGAGTGG + Intergenic
937323211 2:120973303-120973325 CACGCCAGAAAGGCAAGGACAGG + Intronic
937327701 2:121001485-121001507 CATACAAAAAGGGCAGGGAGAGG + Intergenic
937492367 2:122383163-122383185 CACCCAAGCTAGGCAGGGAGGGG + Intergenic
938085931 2:128402092-128402114 CACTCCAGCATGGAAGGGAGGGG + Intergenic
938125107 2:128665462-128665484 GACCCAGGAAGGGCAGGGACAGG - Intergenic
938499550 2:131823261-131823283 CCCACCACAAGGGCAGGCAGTGG + Intergenic
941681170 2:168401223-168401245 CACTCCAGTGGGGCAGGGTGGGG + Intergenic
941961233 2:171255831-171255853 CTCCCCTCAAGTGCAGGGAGAGG + Intergenic
945375880 2:209078987-209079009 CCCCCCAGAAAGGCAGAGAAGGG - Intergenic
945992192 2:216405490-216405512 CCCCACAGAAGGGCAGAGTGGGG - Intergenic
947140284 2:227014050-227014072 GGCCGCAGAGGGGCAGGGAGGGG - Intronic
947992431 2:234497538-234497560 AACCCCAGAAGGGACGGGACGGG + Intergenic
948337121 2:237218210-237218232 CACTCCAGCAGGGGAGGGAATGG - Intergenic
948549656 2:238761819-238761841 CACCGCAGAAGGGTAGTCAGAGG - Intergenic
948660488 2:239503549-239503571 AACCCCAGAGGGGAAGGGACAGG + Intergenic
948862623 2:240760262-240760284 CTCCCCAGAGGGACTGGGAGAGG - Intronic
1169399803 20:5270207-5270229 CACCCTACAAGGGCAAGGTGAGG - Intergenic
1169660276 20:7971696-7971718 CAGCACAGTAGGGCAGGCAGCGG - Intergenic
1170644973 20:18189896-18189918 CACCCAAGCAGGGAATGGAGTGG - Intergenic
1170697949 20:18676889-18676911 CCCCCCAAAAGGGCAGGAAAGGG + Intronic
1170960304 20:21019866-21019888 CTCCCCAGGAGGGCAGAGAAAGG - Intergenic
1172005298 20:31815481-31815503 CATCACAGCTGGGCAGGGAGAGG + Intergenic
1172633879 20:36396210-36396232 CACCGCAGAAGTGCAGTGAGTGG + Intronic
1172854970 20:37994683-37994705 CCCTCCTGATGGGCAGGGAGGGG - Intronic
1172962207 20:38806876-38806898 CACCTCAGGAGCGGAGGGAGAGG + Intronic
1173124832 20:40326981-40327003 CATGACAGCAGGGCAGGGAGTGG + Intergenic
1174107799 20:48175360-48175382 CCCAGCAGAAGGGCAGGCAGTGG - Intergenic
1174254789 20:49246465-49246487 TGCCCAAGGAGGGCAGGGAGGGG + Exonic
1174705662 20:52653270-52653292 TACCCCAGTAGTGCAGAGAGTGG + Intergenic
1174856733 20:54052632-54052654 CACGACAGAAGGGCAGGAAAGGG - Intronic
1176264785 20:64203525-64203547 GAACCCAGACGGGAAGGGAGGGG - Intronic
1176910131 21:14555081-14555103 CAGCCCAGCAGGGCATGGAAAGG - Intronic
1178694789 21:34783427-34783449 ACCCCCAGAAGTTCAGGGAGAGG - Intergenic
1178754089 21:35331511-35331533 TACCCCAGATGGGGAGGGAATGG - Intronic
1179192707 21:39136939-39136961 CAGCCCTGGAGGGCAGGCAGAGG + Intergenic
1179247417 21:39645764-39645786 CACACCCCAAGGGCAGGCAGTGG + Intronic
1179647398 21:42784305-42784327 CAGCAGAGGAGGGCAGGGAGAGG - Intergenic
1179657514 21:42854298-42854320 CATCTCAGAAGGCCAGGCAGAGG + Intronic
1179812316 21:43879947-43879969 CACCCCAGGAGCATAGGGAGAGG - Intronic
1179929120 21:44555621-44555643 CACCACATAAGGACTGGGAGGGG - Intronic
1180003133 21:45004134-45004156 AGCCACAGAAGGGCTGGGAGCGG + Intergenic
1180152726 21:45959978-45960000 CACCCTGGAAGGGCAGGGGCTGG - Intergenic
1180597443 22:16988005-16988027 CACCCCGGAGGTGCAGGGATGGG + Exonic
1180902862 22:19387117-19387139 CACCCCAGCAGAGCACAGAGGGG + Intronic
1181048162 22:20226389-20226411 CACAGCAGCAGTGCAGGGAGTGG + Intergenic
1181618579 22:24071877-24071899 CACCCAGGGAGGGCAAGGAGTGG - Intronic
1181637831 22:24182425-24182447 CTCCCCAGAAAGGAGGGGAGCGG + Intronic
1181674887 22:24445013-24445035 AACCACAGCAGGGCAGGAAGAGG + Intergenic
1181748160 22:24970315-24970337 GATCCCAGAAGGCCAGAGAGAGG + Intronic
1181947487 22:26529464-26529486 CCTCCCAGGAGGTCAGGGAGGGG - Intronic
1182151104 22:28027792-28027814 CCCCACAGCAGGGCAGGGACAGG + Intronic
1183227650 22:36561466-36561488 CAGCCCAGAAGTACAGGGGGAGG - Intergenic
1183395197 22:37567497-37567519 CACTCCCGCAAGGCAGGGAGTGG - Intronic
1183671917 22:39278092-39278114 CACCCCTGAAAGGCAGGATGTGG + Intergenic
1183748663 22:39706597-39706619 CACCCCAGGAGTCCAGGGCGGGG - Intergenic
1184343571 22:43899487-43899509 CACCCAAGACAGGCAAGGAGAGG - Intergenic
949827219 3:8177933-8177955 CCCCCCAGAAAGGCAGAGAAGGG - Intergenic
949900704 3:8812721-8812743 CCCCACAGAAAGGCAGGGAGGGG - Intronic
950025295 3:9815990-9816012 CTGCTCAGCAGGGCAGGGAGAGG + Intronic
950216288 3:11162095-11162117 CTCCCAGGAAGGACAGGGAGGGG - Intronic
952646218 3:35662490-35662512 CCCCACAGAGGGACAGGGAGGGG + Intronic
953151599 3:40330118-40330140 CACTCCTGGAAGGCAGGGAGTGG + Intergenic
953176954 3:40561811-40561833 CCCCCCAGAAAGGCAGAGAAGGG - Intronic
953698619 3:45179265-45179287 CAGCCCAGTAAGGGAGGGAGTGG + Intergenic
954411078 3:50371442-50371464 CAGTCCAGCTGGGCAGGGAGAGG - Intronic
954535407 3:51355954-51355976 CAGCCCAGTAGGGGAGGCAGTGG - Intronic
954645138 3:52126730-52126752 CACGGCAGAAGGGCAAAGAGAGG + Intronic
954670686 3:52289916-52289938 CAGCGCAGAAGTGCAGGGGGTGG + Intronic
954807588 3:53229459-53229481 CAGCCCAAAGGGGCAGGCAGAGG + Intronic
959062221 3:101626006-101626028 CTCCCCAGGAGGTCAGGGGGTGG + Intergenic
959380227 3:105632440-105632462 CACTCCAGAACTACAGGGAGAGG - Intergenic
959612736 3:108313423-108313445 CACTCAACAAGGGCAAGGAGTGG + Intronic
959616347 3:108352410-108352432 AGCCCCAGAAGGGAAGGTAGAGG + Intronic
960806156 3:121585812-121585834 GACCCCAGAAAGGAAGGAAGCGG - Intronic
961314650 3:126026282-126026304 GACCTCAGAGGAGCAGGGAGCGG + Intronic
961459735 3:127042758-127042780 CAGGCCAGAGGGGCAGGGGGAGG - Intergenic
961817476 3:129558724-129558746 CACCCCAGCTGGCCAGGGATAGG - Intronic
962642431 3:137401082-137401104 CACCCCATAAGTGCAGGGGTTGG - Intergenic
962825921 3:139100991-139101013 TCCCACAGAAGGGCATGGAGTGG + Intronic
962908411 3:139825802-139825824 CACCCCTGAAAGGCAGGTTGAGG + Intergenic
962996807 3:140636885-140636907 CACTCCAGCAGGGCAGGGTCAGG - Intergenic
963529019 3:146450123-146450145 CTCACCAGATGGGCAGGTAGTGG + Intronic
963561289 3:146869157-146869179 GACCCCAAAAGGGGAGAGAGAGG - Intergenic
965401483 3:168218137-168218159 CACCTCCCAAAGGCAGGGAGAGG - Intergenic
965516761 3:169629964-169629986 CTCCGCAGAAGGGCTGGGAGAGG - Intronic
965626567 3:170688268-170688290 CCCCCCAGAAAGGCAGAGAAGGG + Intronic
965640275 3:170822829-170822851 CCCCCCAGAAAGGCAGAGAAGGG + Intronic
966050992 3:175617791-175617813 CTTCCCAGAAGGGCTGAGAGAGG - Intronic
966066581 3:175828450-175828472 CCCCCCAGAAAGGCAGAGAAGGG - Intergenic
967156197 3:186694807-186694829 CAGCCCACATGGGGAGGGAGTGG + Intergenic
968504525 4:965704-965726 CCCCCCAGAGGGAGAGGGAGAGG + Intronic
968613012 4:1565527-1565549 CACCCCACAAGGCCAGGGCCAGG - Intergenic
969445329 4:7241573-7241595 CACCCCAGAAGGGCAGGGAGGGG - Intronic
969452631 4:7283620-7283642 CACCCCACAAGGGCAGGCACAGG - Intronic
969495358 4:7523195-7523217 CTCCCCAGAAGGGCAGGCTCAGG + Intronic
969870056 4:10098951-10098973 CACAGCAACAGGGCAGGGAGGGG + Intronic
970525323 4:16926478-16926500 CAATCCAGATGGGCAGGAAGGGG - Intergenic
970580676 4:17471564-17471586 CCCCAGAGAGGGGCAGGGAGAGG - Intronic
972786238 4:42329113-42329135 CACCCTATAAGGGCTGGGTGTGG - Intergenic
976970369 4:91095374-91095396 CCCCCCCAAAGGGCAGGGAAAGG - Intronic
979146407 4:117253022-117253044 CCCCCCAGAAAGGCAGAGAAGGG - Intergenic
980977910 4:139628779-139628801 CAGCCAAGAAGCCCAGGGAGTGG + Intergenic
981525039 4:145700287-145700309 CCCTCCAGAAAAGCAGGGAGGGG - Intronic
982716483 4:158814159-158814181 CACCTCAGAAGGACATGCAGAGG + Intronic
984918830 4:184746361-184746383 CATCCCAGGAGGGCAGGCATGGG + Intergenic
985744604 5:1638953-1638975 CACACCAGCTGGGCGGGGAGGGG - Intergenic
985764626 5:1770296-1770318 CGCCCCAGAAGGGCAGAGCTTGG - Intergenic
985853962 5:2410698-2410720 AGCCACAGAAGGGCAGGGATGGG + Intergenic
986775325 5:11008822-11008844 CTCTCCAGAAGCCCAGGGAGTGG + Intronic
987061323 5:14246764-14246786 CACAACAGAATGGCAGGGAATGG - Intronic
987560136 5:19509282-19509304 GACTCCAAAAGGGCAGAGAGTGG + Intronic
988774906 5:34468981-34469003 CACCCCAGAAATGCAAGGAGTGG + Intergenic
988990529 5:36666071-36666093 CACCCAGGAAAGGCAGTGAGGGG - Intronic
991130890 5:63121290-63121312 GACCCCTGGAGTGCAGGGAGTGG + Intergenic
991990007 5:72328333-72328355 CACTCCAGAAAGACAGGGAGAGG - Intronic
992263425 5:74993182-74993204 AAACCCAGAAGGCCAGAGAGGGG + Intergenic
992431578 5:76715937-76715959 CCCCCCAGTAGGGCAGGGCGGGG + Intergenic
994171406 5:96662608-96662630 CGCCCCCGCGGGGCAGGGAGAGG + Intronic
994437279 5:99754222-99754244 AACTCCAGAAGGCCAGGTAGAGG - Intergenic
994775483 5:104032623-104032645 CCCCCAAGAAAGGCAGAGAGGGG - Intergenic
996595634 5:125199397-125199419 AACCACAGAAAAGCAGGGAGGGG - Intergenic
997241085 5:132308792-132308814 CCCATCAGAGGGGCAGGGAGAGG + Intronic
998130050 5:139647271-139647293 GACCCAAGCAGGGGAGGGAGAGG - Intergenic
1000062127 5:157667152-157667174 CACCCAAGAAGTGGAGGGATGGG + Intronic
1001821322 5:174712733-174712755 CAGCAGAGAAGGGAAGGGAGCGG + Intergenic
1002280413 5:178126633-178126655 CCCTCCTGAAGCGCAGGGAGGGG + Intergenic
1002329803 5:178433554-178433576 CACCCCAGAAGTGGAGGGTGGGG + Intronic
1002346900 5:178554467-178554489 CACACCAGGAGGGCTGGGCGTGG - Intronic
1002707246 5:181170144-181170166 CTCCCCAGAGGGGAAGGGTGGGG - Intergenic
1002872455 6:1179171-1179193 CCCCCAAAAAGGGCTGGGAGTGG + Intergenic
1003051616 6:2785838-2785860 CACCCCAGATGGGAAGAGTGGGG + Intronic
1003215573 6:4106397-4106419 CTTCCCACAAGTGCAGGGAGGGG - Intronic
1003275602 6:4647869-4647891 GACCCCGGATGGGCAGGAAGGGG + Intergenic
1004106019 6:12668217-12668239 CCCCCCAGAAAGGCAGAGAAGGG - Intergenic
1006079721 6:31558318-31558340 CACCCCAGAGGAGCGGGGAGGGG + Exonic
1006458774 6:34146027-34146049 CACCCCAGAGGGGGAGGGTCAGG + Exonic
1007099661 6:39237180-39237202 CACCCCACAATGGGTGGGAGAGG - Intergenic
1007767596 6:44170096-44170118 CTCCTCAGAAGGGGAGGGACAGG - Intronic
1009727936 6:67558600-67558622 CACCCAGGAAGCGCAAGGAGTGG - Intergenic
1012341843 6:98136212-98136234 AACCCCAGAAGTTCAGGGTGTGG - Intergenic
1016277532 6:142372455-142372477 CAGGCCAGAAGGGCAGGCATGGG - Intronic
1016304443 6:142669079-142669101 CACTCCAGAAGGTAAGGGTGGGG - Intergenic
1018862306 6:167720053-167720075 CAGACCAGAGGCGCAGGGAGAGG + Intergenic
1018990754 6:168671648-168671670 CTCCACAGAAGGGGAGGGACTGG - Intronic
1019367574 7:642839-642861 CACCACAGCAGGGCGTGGAGGGG + Intronic
1019704324 7:2490286-2490308 CTCCCCAGAGGGGCAGGGGGAGG + Intergenic
1020154211 7:5709103-5709125 CTCCCGAGAAGAGCAGGGAGAGG + Intronic
1021821003 7:24497402-24497424 CACTTCAGTAGGGCAGGAAGAGG + Intergenic
1022346007 7:29515314-29515336 CAGCCTAGAAGGGAAGAGAGAGG + Intergenic
1022673793 7:32479638-32479660 CACACCACAAGGGCAGGTAAAGG - Intergenic
1022785102 7:33630920-33630942 AATCCCATGAGGGCAGGGAGAGG - Intergenic
1022950143 7:35330733-35330755 CAGGCCAGCAGGGCAGGCAGTGG - Intergenic
1024051105 7:45623977-45623999 CACTCCAGGTGGTCAGGGAGGGG + Intronic
1027972601 7:85104590-85104612 CACCCCAGAAAGGAAGGGAGTGG + Intronic
1028723275 7:94058372-94058394 CACCACAGAAGAGGAAGGAGGGG + Intergenic
1029506626 7:100967016-100967038 ACCCCCACCAGGGCAGGGAGGGG + Intronic
1029709096 7:102289850-102289872 AACCCCAGAAAGGCAGGGTGGGG + Intronic
1032122650 7:129168332-129168354 AGCTCCAGAAGGGAAGGGAGTGG + Exonic
1032325439 7:130924194-130924216 CTCCCCAGCAGGGCAGGGATGGG + Intergenic
1032367500 7:131314293-131314315 GACCCCAGAAAGGGAGTGAGAGG + Intronic
1032739526 7:134724836-134724858 AACCTCAGAAGAGGAGGGAGAGG - Intergenic
1034017889 7:147607233-147607255 TCTCCCAGAAGGGCAGGGAGGGG - Intronic
1034966925 7:155397406-155397428 CACCCCAGAACCTCAGGGCGTGG + Intergenic
1035163463 7:156968327-156968349 CAGCCCGGAGGGGCAGGGCGGGG - Intronic
1035305499 7:157928891-157928913 CAGCACAGAAGGCCAGGCAGAGG + Intronic
1037603281 8:20416995-20417017 CACTCTGGAAGGGCAGGGACTGG - Intergenic
1037622201 8:20574319-20574341 ATACCCAGAAAGGCAGGGAGAGG - Intergenic
1037814664 8:22105634-22105656 CAGCCAAGAGAGGCAGGGAGGGG + Intergenic
1037865884 8:22441556-22441578 CACCCTAGGAGGGCTCGGAGGGG + Intronic
1038656533 8:29457682-29457704 CACCCCACAAGGGCAGGAGTAGG - Intergenic
1039437952 8:37573560-37573582 CTTCCCAGAAAGGCAGGCAGGGG - Intergenic
1039790906 8:40874959-40874981 CACTCCAGAATGTCAGGGAAGGG + Intronic
1040903917 8:52445403-52445425 CACACCACAATGGCAGAGAGAGG - Intronic
1041157735 8:55005411-55005433 CGCTCCAGAAGAGCAGGCAGGGG - Intergenic
1042131337 8:65589453-65589475 CTCCCCAGAGGGTCAGGGAGTGG - Intergenic
1044607277 8:94058254-94058276 CTCCCCAGAGGGGCAGGTACAGG - Intergenic
1044790143 8:95838690-95838712 TGCCTCAGAAGTGCAGGGAGGGG - Intergenic
1046132598 8:109985432-109985454 AACCCCAGCAAGTCAGGGAGGGG - Intergenic
1046984361 8:120370795-120370817 CACCAGGGAAGAGCAGGGAGGGG - Intronic
1047414801 8:124655441-124655463 CATCCCAGCAGAACAGGGAGGGG + Intronic
1047681345 8:127257559-127257581 AACTGCAGAAGGGCTGGGAGAGG + Intergenic
1049472374 8:142782258-142782280 CACCCCTGAAAGGCAGGAAACGG - Intergenic
1049591258 8:143463875-143463897 CCCCCCAAAAGGGGAAGGAGCGG + Intronic
1049591594 8:143465295-143465317 CTCCCCAGGAAGGCAGGGGGTGG - Intronic
1049640601 8:143713455-143713477 AGCCCCAGTAGGACAGGGAGAGG + Intronic
1049869037 8:144959051-144959073 CCCCCCAGAAAGGCAGAGAAGGG + Intergenic
1050343258 9:4662269-4662291 CATCCCGGAGGGGCGGGGAGAGG - Intronic
1051876690 9:21801748-21801770 TACCCCAGTAGGGAAGGGACGGG + Intergenic
1053181239 9:35972220-35972242 CACCCCAGCACTGCAGGCAGCGG - Intergenic
1053259412 9:36648979-36649001 AACCCCAGATATGCAGGGAGCGG + Intronic
1053419556 9:37968864-37968886 TTCCCCAGAAGGACAGGGAGTGG + Intronic
1054922413 9:70555323-70555345 ACCCCCAAAAGGGCAGGCAGAGG - Intronic
1055013183 9:71589476-71589498 CACCCGCGAAGGACAGGGATTGG + Intergenic
1055584680 9:77745898-77745920 GGCCCCAGAAGGGCTGGGGGTGG + Intronic
1055766963 9:79673895-79673917 CCCCCCAGGAAGGCATGGAGAGG - Intronic
1056191650 9:84190124-84190146 CACCCCAGAACAGGAGAGAGAGG - Intergenic
1056277890 9:85011188-85011210 TACCCAGGAAGGGAAGGGAGCGG + Intronic
1056498548 9:87185357-87185379 TCCCCCAGAACTGCAGGGAGTGG - Intergenic
1056667008 9:88589176-88589198 CAGCCCAGCAGGGCAGACAGAGG - Intergenic
1057075830 9:92137750-92137772 TATGCCAGAAGGGCAGGGAGGGG - Intergenic
1057209583 9:93192545-93192567 CACCCCAGGAGTGCAGGGATGGG + Intronic
1057456994 9:95223287-95223309 AGCCCCAGAAGTGTAGGGAGAGG - Intronic
1057550319 9:96047423-96047445 AACCCCACAGGGGCGGGGAGCGG + Intergenic
1058648225 9:107150615-107150637 CTCCCCACAAGGGCAGTGAATGG + Intergenic
1058707831 9:107652019-107652041 CAACGGAGAAGGGCAGGGAAGGG - Intergenic
1059433113 9:114261486-114261508 CAGCCCCACAGGGCAGGGAGAGG - Intronic
1059461027 9:114430183-114430205 CAGGCCAGGAGGGCAGTGAGGGG + Intronic
1059611248 9:115898889-115898911 CCCACCTGTAGGGCAGGGAGTGG - Intergenic
1060050550 9:120375451-120375473 CTCCTCACAAGGGCAGGGTGTGG - Intergenic
1060209649 9:121701807-121701829 CACCACATCAGAGCAGGGAGAGG - Intronic
1060893046 9:127200642-127200664 CAACCCAGATGGCCGGGGAGGGG - Intronic
1061015442 9:127978582-127978604 CACTCTAGAAGGCCAGGGGGCGG + Intronic
1061041221 9:128141883-128141905 CACTCCCCAAGGGCAGGCAGGGG - Intergenic
1061550381 9:131331196-131331218 CACCCCAGCAGTGCAGGGAGGGG + Intergenic
1061574371 9:131496887-131496909 CACCCCTGCAGGGCAGGGTATGG - Exonic
1061899544 9:133666012-133666034 CTCCCCAGAAGGGGAAGGGGTGG - Intronic
1062524732 9:136973600-136973622 CTCCCCAGGAGGGCAGGGTCTGG - Intergenic
1062736843 9:138142106-138142128 CAGCCCAGCAGGGAGGGGAGGGG - Intergenic
1186425650 X:9463373-9463395 CCCCCCAGAAGGACATGGTGGGG - Intronic
1189245124 X:39557488-39557510 AACCCCAGCAGGGCAAGGGGGGG + Intergenic
1191258088 X:58288468-58288490 CTCCCCAGGAGGACAGGGACTGG + Intergenic
1192380506 X:70611662-70611684 TACCCCAGAAGGTCAGGCTGTGG - Intronic
1194503208 X:94703638-94703660 CCCCCCAGAAAGGCAGAGAAGGG + Intergenic
1196176737 X:112646468-112646490 TACCCCAGAAGACCAGAGAGAGG + Intronic
1198599615 X:138269094-138269116 CCCCCCAGAAAGGCAGAGAAGGG + Intergenic
1198969717 X:142267565-142267587 CCCCCCCAAAGGGCAGGGAAAGG + Intergenic
1199694513 X:150334501-150334523 GACCCCAGAAGGTCAGAGCGGGG - Intergenic
1199816118 X:151397873-151397895 CACCCCAGTAGGCAAGGGAGTGG + Intronic
1200000119 X:153056052-153056074 CCCACCAGAGGGCCAGGGAGTGG - Intergenic
1200003041 X:153072017-153072039 CCCACCAGAGGGCCAGGGAGTGG - Intergenic
1200004682 X:153077992-153078014 CCCACCAGAGGGCCAGGGAGTGG + Intergenic
1200092039 X:153640503-153640525 GACACCAGGAGGGCTGGGAGTGG + Intergenic
1200141125 X:153903650-153903672 CACCCTAACAGGGCCGGGAGGGG + Intronic
1200399055 X:156008157-156008179 CAGCCCAGCAGGGAGGGGAGGGG - Intronic
1201104740 Y:10755111-10755133 CACACCAGAATGGAATGGAGTGG - Intergenic