ID: 969449088

View in Genome Browser
Species Human (GRCh38)
Location 4:7262838-7262860
Sequence CTGTGTCTGGTGAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 1, 2: 4, 3: 43, 4: 415}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969449082_969449088 7 Left 969449082 4:7262808-7262830 CCAGGATTTAGGCACTGCTTTTT 0: 1
1: 0
2: 1
3: 18
4: 250
Right 969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG 0: 1
1: 1
2: 4
3: 43
4: 415
969449077_969449088 30 Left 969449077 4:7262785-7262807 CCTGGGTCTTGTGTGCCTTCCAG 0: 1
1: 0
2: 1
3: 24
4: 252
Right 969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG 0: 1
1: 1
2: 4
3: 43
4: 415
969449081_969449088 11 Left 969449081 4:7262804-7262826 CCAGCCAGGATTTAGGCACTGCT 0: 1
1: 0
2: 2
3: 11
4: 152
Right 969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG 0: 1
1: 1
2: 4
3: 43
4: 415
969449080_969449088 15 Left 969449080 4:7262800-7262822 CCTTCCAGCCAGGATTTAGGCAC 0: 1
1: 0
2: 0
3: 13
4: 121
Right 969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG 0: 1
1: 1
2: 4
3: 43
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969449088 Original CRISPR CTGTGTCTGGTGAAGGTGGA GGG Intronic
900241726 1:1620527-1620549 GTGGATCTGGTGGAGGTGGACGG + Intronic
900768359 1:4520525-4520547 CTGTGTGTGGTGGAGGTGGAAGG - Intergenic
900768374 1:4520621-4520643 CTGTGTGTGGTAGAAGTGGAAGG - Intergenic
900768383 1:4520669-4520691 CTGTGTGTGGTGGAGATGGTGGG - Intergenic
900768404 1:4520765-4520787 CCGTGTATGGTGGAGGTGGAGGG - Intergenic
900768411 1:4520789-4520811 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900768421 1:4520837-4520859 CTATGTGTGGTGGAGATGGAGGG - Intergenic
900768442 1:4520933-4520955 CTGTCTGTGGTGGAGGTGGAGGG - Intergenic
900768452 1:4520981-4521003 CTGCGTGTGGTGGAGATGGAGGG - Intergenic
900894587 1:5474343-5474365 CTGTGGCTGGTGATGATGGCAGG + Intergenic
900982778 1:6056006-6056028 CTGTAGCTGATGGAGGTGGACGG + Intronic
900986994 1:6078883-6078905 CTTTGCCTGGGGAAGGTGCAGGG + Intronic
901295971 1:8161169-8161191 CTGGGTCTGGTGAAGAAGGAAGG - Intergenic
901516353 1:9749409-9749431 CTGGCTTTGGTGAAGGTGGGAGG - Intronic
902602764 1:17551326-17551348 CGGTGCCTGATGCAGGTGGAGGG + Intronic
902735130 1:18395537-18395559 CTGTGTCTGGTGAGGGTCTCAGG - Intergenic
902979690 1:20113907-20113929 CTGTGTCCTCTGAGGGTGGATGG - Exonic
903813777 1:26049767-26049789 CTGAGTCTGGAGATGGTGGGAGG - Intergenic
903929860 1:26855963-26855985 CTGAGGCAGGGGAAGGTGGAGGG - Exonic
904227304 1:29033263-29033285 CTGTGTCTGGTTTGGGAGGAAGG - Intronic
905142823 1:35861934-35861956 CTGTGGCTGGAGAAGGAAGAAGG + Intergenic
905887912 1:41501673-41501695 CTGGGTCTGGTGCACGTGCACGG + Intergenic
907200588 1:52723352-52723374 CTGTGTCTAGTGATGTTGGTAGG + Intergenic
908799871 1:67868504-67868526 CTGTGCCTGCTGAAGTTGAAGGG + Intergenic
908813964 1:68012633-68012655 CTGTGCCTGCTGCAGGTGGAAGG - Intergenic
910434630 1:87192806-87192828 ATGTGTGTGGTGAAGGTTGATGG + Intergenic
910546522 1:88425025-88425047 ATGTGTCTGTTGTAGGGGGATGG - Intergenic
910716338 1:90235696-90235718 CTATGTCTGTGGAAAGTGGAGGG - Intergenic
911522090 1:98941414-98941436 GTGTGTGTTGTGGAGGTGGAAGG + Intronic
913106155 1:115615912-115615934 CTGTGTATGGTGGGGGTGGATGG + Intergenic
913486663 1:119337826-119337848 CTGTGTTGGTTGAAGGTGGGTGG + Intergenic
914049424 1:144119302-144119324 GTGTTTCTGGTAAAGCTGGAAGG + Intergenic
914129760 1:144846138-144846160 GTGTTTCTGGTAAAGCTGGAAGG - Intergenic
915046176 1:153018749-153018771 CCCTGTCTGGTGAAGGGGGATGG - Intergenic
917564489 1:176198424-176198446 CTGTGTTTGGTAAGGGTTGAAGG - Intronic
917979280 1:180259424-180259446 CTGTGTCTGGTGGAGGTGCATGG + Intronic
918082960 1:181221576-181221598 CAGTGTCTGGGGGAGGCGGAGGG + Intergenic
918092516 1:181309771-181309793 CTCAGTGTGGTGAAGGAGGAAGG + Intergenic
918851209 1:189693002-189693024 CTGGTGCTGGTGAAGGAGGAAGG - Intergenic
918922041 1:190725148-190725170 CTGTGTCCTCAGAAGGTGGAAGG + Intergenic
919742541 1:200989603-200989625 TTGAGTCTGCTGGAGGTGGAGGG - Intronic
919815406 1:201435027-201435049 CTTTGTGTGGTCAAGGTGGGAGG - Intergenic
919972793 1:202591708-202591730 CTGTGGGTGGTGATGGAGGAGGG - Exonic
919981749 1:202646218-202646240 CAGTGCCAGGTGAAGCTGGAAGG - Intronic
920378410 1:205521899-205521921 CTGTGCCTGGTGCTGGTGCATGG + Intronic
920692316 1:208156014-208156036 ATGTGGCTGGTGAGGGAGGATGG + Intronic
920998186 1:211015165-211015187 CGGGGTCTGGTGGAGGTAGATGG - Intronic
921682304 1:218049020-218049042 GTGCTTCTGGTGAATGTGGAGGG + Intergenic
922462339 1:225823472-225823494 CTGAGTCTGGGGAAGCTTGATGG - Intronic
922612834 1:226942620-226942642 CTGTGTCTTGTGATGTGGGAGGG + Intronic
923453035 1:234137599-234137621 ATTTGTCAGGTAAAGGTGGAAGG + Intronic
923668168 1:236017043-236017065 ATGAGTCTGGTCAAGTTGGAAGG - Intronic
924152216 1:241141000-241141022 CTGTTTGGGGTGAAGGTGGTGGG - Intronic
924384809 1:243490824-243490846 CTGGGTCTGGTGGAGGATGAGGG - Intronic
924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG + Exonic
1062790517 10:301395-301417 TGGGGTCTGGGGAAGGTGGAGGG + Intronic
1063297111 10:4817832-4817854 CAGTCCCTGCTGAAGGTGGATGG + Intronic
1063350813 10:5352937-5352959 CTGTGTGTGGGGAGGATGGAGGG - Intergenic
1063458082 10:6199065-6199087 CTTTGGCTGGTGATGATGGAAGG + Intronic
1064203377 10:13302421-13302443 CTGGGGCGGGTGCAGGTGGAGGG + Intergenic
1064706674 10:18079535-18079557 CTCTTTCTGGCGAGGGTGGAGGG + Intergenic
1065256137 10:23870449-23870471 GTGTGTTTGGTGAAAGTAGAAGG - Intronic
1065431396 10:25660998-25661020 CTCTGTCTGGGGAAAGGGGAGGG - Intergenic
1066244272 10:33567200-33567222 CTGAGTTTGCTGAAGGTGCATGG - Intergenic
1066491959 10:35902484-35902506 CTGTGTCTGGGGAAGTTTGATGG + Intergenic
1068502846 10:57861988-57862010 CAGTGTCTGGAGAAGGGAGACGG - Intergenic
1070241508 10:74686492-74686514 TGGTGTCTTGTGAGGGTGGAAGG - Intronic
1070754943 10:78986086-78986108 CTCAGAATGGTGAAGGTGGAGGG + Intergenic
1071411242 10:85399143-85399165 CTGTGTCTGGGGGAGGTAGTTGG - Intergenic
1071502088 10:86211426-86211448 CTGTGTCCTGGGAAAGTGGAGGG + Intronic
1071601189 10:86959455-86959477 CTGTGTCTGGAAGAAGTGGATGG - Intronic
1071805928 10:89120878-89120900 CTGAGTCTGGAGAAGCAGGAAGG + Intergenic
1072576277 10:96703461-96703483 TTGTGTGTGTTGAGGGTGGAGGG - Intronic
1073003420 10:100302451-100302473 CTGTGGGTGGTGGAGGTGGGCGG + Intronic
1073048154 10:100652080-100652102 GTGAGACTGGTGAAGGTGGTGGG - Intergenic
1073082545 10:100869055-100869077 TGGTGCCTGGTGGAGGTGGAGGG - Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1074502613 10:114040574-114040596 CGGTGTGGGGTGAAGGTGGGGGG + Intergenic
1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG + Intergenic
1076601471 10:131659377-131659399 CTGTGTCTGGAGAAGGGGCCAGG + Intergenic
1076805931 10:132858724-132858746 CTGTGGCTGGTGGGGGTGGGTGG + Intronic
1078770884 11:14350482-14350504 CTGCTTCTGGTGAGGGTGTAAGG - Intronic
1081297223 11:41406693-41406715 GTGTGTGTGGTGAATGTGTAGGG - Intronic
1081597047 11:44466625-44466647 ATGTGGCTGGTGAAGGTGTGAGG + Intergenic
1081875128 11:46403365-46403387 TTTTGTCTGGTGAAGATGGTCGG - Intronic
1081917044 11:46738976-46738998 CTGTGTCTCGTGAAGGGGCGTGG + Intronic
1083389233 11:62335959-62335981 CTGAGGCTGGGGAAGGTGGCTGG - Intergenic
1083564968 11:63706441-63706463 CTGTGGATGGCTAAGGTGGAAGG - Intronic
1083655867 11:64229369-64229391 CTGGGTCTTGGGAAGGTGGGTGG + Intronic
1083796855 11:65021891-65021913 TAGTGTTTGGTGAAGGTTGAGGG - Exonic
1084289852 11:68155622-68155644 CTGTGTCTGGAGGTGCTGGAGGG - Exonic
1084635330 11:70388362-70388384 TGGTGACTGTTGAAGGTGGATGG + Intergenic
1084690984 11:70726457-70726479 CTGAGTCTGGTGTGGGTGGGTGG + Intronic
1085048288 11:73365925-73365947 CTGTGTCTGGGGGAGGTGGTGGG - Exonic
1085122158 11:73974162-73974184 CTGTGGCTGTGGAGGGTGGAAGG + Intergenic
1087692249 11:101334903-101334925 CTGCTTCTGGTCAAGATGGAGGG - Intergenic
1087869475 11:103274249-103274271 CTTTGCATGGTCAAGGTGGAAGG + Intronic
1088105629 11:106203846-106203868 CTGTGTCTGCTCATGGTTGAAGG - Intergenic
1089118102 11:116112494-116112516 CTGTGGGTGATGAGGGTGGAGGG + Intergenic
1090034231 11:123234528-123234550 CTGTGTGTGGTTATGGGGGATGG - Intergenic
1090125953 11:124084307-124084329 CTGGGGATGGGGAAGGTGGATGG + Intergenic
1090385231 11:126354656-126354678 CTGCTTCTGCTGAAGCTGGAGGG - Intergenic
1090909225 11:131104066-131104088 CTGTGTCTGTGCAAGGTGGGTGG - Intergenic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1092797260 12:12124632-12124654 CTGTGGCTGGGGATGGTGGAGGG + Exonic
1094043383 12:26141263-26141285 CTGTGTTTGGGGATGGAGGAAGG + Intronic
1094256995 12:28443058-28443080 CTGTATCTGTTAAAGTTGGAAGG + Intronic
1094511653 12:31100886-31100908 GTGTGACTGGTGATGGTGGGCGG + Intronic
1095580007 12:43786951-43786973 CTGTGTTTGGTGATGCTTGAAGG - Exonic
1095759248 12:45809803-45809825 TTGTGTCTTGTAAAGCTGGAAGG + Intronic
1096099597 12:48961632-48961654 GTGTGTCTGATGAAGGAAGAGGG + Intergenic
1097717450 12:62981845-62981867 CTGTGTCTGGTGAGGGTCTCAGG + Intergenic
1098371418 12:69764311-69764333 TTGTATATGGTGAAGGGGGATGG + Intronic
1099096490 12:78380292-78380314 TTGTGTTTGGGGAAGGAGGAAGG - Intergenic
1099198222 12:79645023-79645045 GTGTGTGTGGTGGGGGTGGAGGG - Intronic
1099725897 12:86427497-86427519 CTGTGTGTGTGTAAGGTGGATGG - Intronic
1102877966 12:116462400-116462422 ATGTGTCTTCTGATGGTGGAAGG + Intergenic
1104920899 12:132290238-132290260 CTGTGTGTGGTGAGGGCAGACGG - Intronic
1107096620 13:36544535-36544557 GTGTGTATGGTGAATGTGCATGG + Intergenic
1107425690 13:40290360-40290382 TTGTGTCTGCACAAGGTGGAGGG - Intergenic
1108267723 13:48729263-48729285 AGGTGTCTGATGGAGGTGGAGGG - Intergenic
1111165763 13:84455524-84455546 CTGTGGCTGGTGTAGGTGATGGG + Intergenic
1112053744 13:95670978-95671000 CTCTGCCTGGTGAAAGAGGAGGG - Intergenic
1113507351 13:110826373-110826395 CTGTGTCCAGTGATGCTGGATGG + Intergenic
1113507415 13:110826794-110826816 CAGTGTCTGATGAGGGTGTATGG + Intergenic
1113507641 13:110828143-110828165 CAGTGTCTGCTGAGGGTGTATGG + Intergenic
1113632965 13:111900369-111900391 ATGGGTCTTGTGAGGGTGGAGGG + Intergenic
1114673493 14:24427215-24427237 CTGTGGCTGGTGAGGAAGGAAGG - Exonic
1118657453 14:67967762-67967784 CTGTGGCTTTTCAAGGTGGAAGG + Intronic
1118800391 14:69184352-69184374 CTGGGCCTGCTGGAGGTGGAGGG - Intergenic
1119826518 14:77661255-77661277 TAGTGTCTGGTGAAGGGGGCTGG + Intergenic
1120854891 14:89203683-89203705 CTGGGGCTGGACAAGGTGGAGGG + Intronic
1120863420 14:89275272-89275294 CTGTGTCTGCTGCGGGTGCAAGG - Intronic
1121567759 14:94923508-94923530 CTGTGGGCAGTGAAGGTGGAGGG - Intergenic
1121664099 14:95658809-95658831 CAGTGTATGGTAAAGGTGAAGGG - Intergenic
1122175819 14:99918076-99918098 GTGTGTCTAGTGGAGGTAGAGGG - Intronic
1122352386 14:101103601-101103623 CTGTGTGTGGGGCATGTGGAAGG + Intergenic
1122967900 14:105139787-105139809 GTGTGGCTGTTGGAGGTGGAGGG - Intergenic
1202884460 14_KI270722v1_random:91366-91388 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1123419302 15:20118538-20118560 GTGTTTCTGGTAAAGCTGGAAGG + Intergenic
1123446564 15:20334965-20334987 GTGTTTCTGGTAAAGCTGGAAGG - Intergenic
1123528524 15:21125080-21125102 GTGTTTCTGGTAAAGCTGGAAGG + Intergenic
1123798180 15:23794658-23794680 CTGTATCTGGTTAAGGTGTGAGG + Intergenic
1124160219 15:27261428-27261450 CTGTCTCTGCTCAAGATGGAGGG + Intronic
1125457982 15:39880063-39880085 CTGAGTCTTGAGAAGGTTGAAGG - Intronic
1126440603 15:48683902-48683924 CTCTGCCTGGGGAAAGTGGAGGG + Intergenic
1126808110 15:52373629-52373651 CTGTGACTGGACAGGGTGGAAGG - Intronic
1128582359 15:68818826-68818848 CTGGGTGTGGTGATGGGGGAGGG - Intronic
1130845267 15:87738186-87738208 CTATGTCTGGTAAAGGTGGAAGG + Intergenic
1131385241 15:92000904-92000926 CTGAGTCTGGGGTAGTTGGAGGG + Intronic
1132616379 16:842924-842946 CCCTGTCTGGTGGAGGTGGATGG - Intergenic
1133119202 16:3595937-3595959 CTGTCTTTGGTTAAAGTGGAAGG + Intronic
1133255365 16:4513103-4513125 CTTTGTCTGGTGCAGGTGGCAGG - Intronic
1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG + Intergenic
1133467003 16:6036990-6037012 CTGTGTGTGTTGGAGGTGGGGGG + Intronic
1134083160 16:11338425-11338447 CTGTGTCTTCACAAGGTGGAAGG + Intronic
1134323085 16:13181504-13181526 ATGTGTCTGGAGAAGTTGGTAGG + Intronic
1134661042 16:15984857-15984879 CTTTGGCAGGTGAAGGTGGGAGG + Intronic
1135737140 16:24940758-24940780 ATGTGGCTGGAGAGGGTGGAAGG + Intronic
1137270398 16:46899340-46899362 CTGTGTGTGGTTAAGGTTCATGG + Intronic
1137798451 16:51241187-51241209 CTGTTTCTGCTCATGGTGGAAGG + Intergenic
1139650459 16:68359647-68359669 CTTTGCCTGGTGAGGCTGGAGGG - Exonic
1141802657 16:86321684-86321706 CTGCGTGTGGTGAAGGGGGCTGG - Intergenic
1142488291 17:260819-260841 CTGTGCCTGGTGATGGGGGTGGG - Intronic
1142669378 17:1480698-1480720 CTGTACCTGGTGAAGGTGAGTGG - Exonic
1143513557 17:7408271-7408293 CTGTGTCTGGTGGGGCTGGCGGG + Exonic
1143703950 17:8683602-8683624 GTGTGTGTGGTGATGGTGGTGGG - Intergenic
1144117072 17:12106250-12106272 CTGTGTCTGTTTTGGGTGGAGGG + Intronic
1144125842 17:12202333-12202355 CTGTGGCATGTGATGGTGGAGGG + Intergenic
1144518866 17:15941124-15941146 CTTTCACTGGTGAAAGTGGAAGG - Intergenic
1146677068 17:34780957-34780979 CTGTGTCTGGAAAACCTGGAAGG - Intergenic
1146913946 17:36666100-36666122 CTGAGGCTGGTGAAGGTTGTGGG + Intergenic
1147429233 17:40361607-40361629 CACTGGCTGGTGAAGGGGGAGGG + Intronic
1148020490 17:44549969-44549991 CTGTGACGGGGGAAGGTGAAAGG + Intergenic
1148344100 17:46891833-46891855 CTGTTTCTAGTGAAGGTTAATGG + Intergenic
1148458989 17:47826980-47827002 CTGAGTCTGGTGGGGGTGGGGGG + Intronic
1148805132 17:50260066-50260088 CTGAGACTGGAGAAGCTGGAGGG - Intergenic
1148935951 17:51164967-51164989 ATGTGTGTAGTGAAGCTGGAGGG + Intronic
1149141815 17:53440274-53440296 CTGTGTATGGTGAGGGGGGATGG - Intergenic
1149397586 17:56260723-56260745 CTGTGCCTGGTGAGGCTGGCAGG - Intronic
1152036153 17:77874368-77874390 CTGTGTTTGGTGATGGTGCAGGG - Intergenic
1152269580 17:79316163-79316185 GGGTGGCTGGTGATGGTGGAGGG + Intronic
1152473169 17:80501463-80501485 GGGTGTCTGGTGAAGGTGCCAGG - Intergenic
1152607656 17:81301068-81301090 ATGTGTGTGGTGTGGGTGGATGG + Intergenic
1152799286 17:82323481-82323503 CCGGGTGTGGTGAAGGTGGGAGG + Intronic
1152920699 17:83065121-83065143 CTGGTTCTGCTGAAGCTGGAGGG - Intergenic
1154143902 18:11850188-11850210 CTTTGACTGGCGGAGGTGGAGGG + Intronic
1154177074 18:12092764-12092786 GGGTGTCTGGTGCAGGTGGTTGG + Intergenic
1156541317 18:37913738-37913760 CTGTGGCTGAAGGAGGTGGATGG - Intergenic
1156641362 18:39104167-39104189 CTGAGGCTGTTGAAAGTGGAGGG + Intergenic
1157471127 18:47989758-47989780 GTGTGGCTGGTGGAGGTGGCGGG + Intergenic
1158424170 18:57324078-57324100 TTGTGTGTGGTGATGGTGGGAGG - Intergenic
1158568764 18:58578912-58578934 CTGAGTCTGTTGAAGTTTGAAGG + Exonic
1159001935 18:62982081-62982103 CTGTGTCTGCTGCAGGAGAAAGG + Intergenic
1159828515 18:73244232-73244254 CTGTCTCTGTTGCAGGGGGAAGG - Intronic
1159904977 18:74081686-74081708 CTGAGTATGGTGGAGTTGGAGGG - Intronic
1160334676 18:78028139-78028161 TTGTGTTTGTTGGAGGTGGAGGG + Intergenic
1160665328 19:325487-325509 CTGTGGCTGGAGGAGGTGGGAGG - Intronic
1161155484 19:2730345-2730367 CTGTGATGGGCGAAGGTGGATGG + Intronic
1162312865 19:9917523-9917545 CTGTGTCTGCTTGGGGTGGAGGG + Intronic
1163528230 19:17834460-17834482 GTGTGTCTGGTGAGGTTGGAGGG - Intronic
1163862612 19:19750116-19750138 CTGTGTAGGGTGGATGTGGAAGG - Intergenic
1164871424 19:31647506-31647528 CTGCTTCTGGGGAAGGTGCAGGG + Intergenic
1164879301 19:31717622-31717644 GTGTGTTTGGTAAAGGTGAAAGG - Intergenic
1165846200 19:38819290-38819312 CTGTGGCTGTTGAAGAGGGAGGG - Intronic
1166175292 19:41064300-41064322 ATGTGTGTGGTGATGGTGGTTGG + Intergenic
1166496361 19:43305788-43305810 CTGTCTCTCGTGAAGCTGGGAGG - Intergenic
1166758665 19:45211352-45211374 CTGGGTATGGTGGTGGTGGAGGG + Intronic
1167116750 19:47493013-47493035 AAGTGTCTGCTGAAGGTGGCTGG - Exonic
1168422280 19:56212417-56212439 CTGTGTCTGGAGAAGGATGTTGG - Intergenic
1168591001 19:57634102-57634124 ATCTGTCTGGGGAGGGTGGAGGG - Intronic
1202633613 1_KI270706v1_random:22741-22763 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1202652273 1_KI270707v1_random:17318-17340 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1202659868 1_KI270708v1_random:58412-58434 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1202688814 1_KI270712v1_random:71870-71892 GTGTTTCTGGTAAAGCTGGAAGG + Intergenic
924989974 2:305817-305839 CTGTGTGTGGTGGAAGTTGAGGG - Intergenic
924999312 2:392429-392451 CTGTGGCTGGTGGAGGTGGGAGG + Intergenic
925071855 2:975612-975634 CTGTATGTGGTGTAGGCGGATGG - Intronic
925076128 2:1017774-1017796 CTGTGTCAGGTGAATGTTAAAGG + Intronic
926047977 2:9724246-9724268 CTGTGTCTTGGGAAGGAGCATGG - Intergenic
926726712 2:16004371-16004393 CTGTGTGTGGTGAGGATGGGAGG + Intergenic
927177672 2:20421963-20421985 CTGGGCCTGGGGATGGTGGAGGG - Intergenic
927669910 2:25060510-25060532 CTGTGTTTTGTGAAAGTGGCTGG + Intronic
928275682 2:29898149-29898171 CTGGGGCTGGGGAAGGTGGCAGG - Intronic
928990459 2:37227915-37227937 TTGTGTCTGGTGAAGTAGAAAGG - Exonic
933957623 2:87384229-87384251 GTGTTTCTGGTAAAGCTGGAAGG - Intergenic
934241743 2:90276124-90276146 GTGTTTCTGGTAAAGCTGGAAGG - Intergenic
934271429 2:91540561-91540583 GTGTTTCTGGTAAAGCTGGAAGG + Intergenic
934579626 2:95427736-95427758 CTCTGCCTGCTGAAGGTGGGAGG - Intergenic
934599819 2:95648989-95649011 CTCTGCCTGCTGAAGGTGGGAGG + Intergenic
936533164 2:113290994-113291016 CTCTGCCTGCTGAAGGTGGGAGG + Intergenic
936770843 2:115911250-115911272 CTGTGAGTGGGGAAGGTGAAAGG + Intergenic
937356160 2:121199405-121199427 TTGTGACTGGTGGAGGTGGGGGG + Intergenic
937983504 2:127628318-127628340 CTGGATCAGGGGAAGGTGGAGGG + Intronic
939997550 2:148933989-148934011 ATGTGTCTGATGTATGTGGAAGG - Intronic
939998062 2:148938660-148938682 CTGTGGCTGGGGAGGGTGAAGGG + Intronic
940210431 2:151251219-151251241 CTGAGTCAGGAGAAAGTGGATGG - Exonic
941302815 2:163825427-163825449 CTTCCTCTAGTGAAGGTGGAAGG + Intergenic
941807263 2:169722057-169722079 CTGTGTCCTCTCAAGGTGGAAGG - Intronic
942917037 2:181323331-181323353 CTAGGTCTGGTGGAGGAGGATGG - Intergenic
944868846 2:203889550-203889572 CTGTGTCCTGTCATGGTGGAAGG + Intergenic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947543117 2:230991912-230991934 CTGTGTGACGTGAAGGTGAAGGG + Intergenic
948789514 2:240370086-240370108 CTGTGTCTGGGGGAGGAGGGTGG + Intergenic
948856121 2:240731516-240731538 CGCTGTCTGGTGGAGGTGGTGGG - Intronic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1170446550 20:16433954-16433976 CTGTGTCTGGAGTTGGGGGAGGG - Intronic
1171190107 20:23152716-23152738 CTGTGCTTGGAGAAGGTGGCTGG - Intergenic
1171232495 20:23498855-23498877 CTGTGTCTGGGGTAGAGGGACGG - Intergenic
1172702276 20:36861067-36861089 CTCACTCTGGTGAAGGGGGATGG - Intronic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173736265 20:45363625-45363647 CTGTGGCTGGCGCTGGTGGACGG + Exonic
1174061172 20:47834035-47834057 CTGTGTCCGTTGAAGTTTGAGGG - Intergenic
1174153446 20:48501938-48501960 CTGTGTCAGTTGAAGTTTGAGGG - Intergenic
1175146195 20:56898006-56898028 CTCTTTCTGGTGATGGTGGAGGG + Intergenic
1176599878 21:8782337-8782359 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1176645827 21:9348598-9348620 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1177099731 21:16885430-16885452 CTGTTTCAGCTGAAGCTGGATGG + Intergenic
1178071321 21:28970668-28970690 CTGTGATTCGTGAAGGTGGTCGG - Exonic
1178969396 21:37158445-37158467 ATGTTTGGGGTGAAGGTGGAAGG - Intronic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179409888 21:41154286-41154308 CAGTTTCTGGTAAAGGTCGAAGG + Intergenic
1179934376 21:44592882-44592904 CTGTGTCCGGTGATGGGGGAAGG - Intronic
1180033170 21:45226020-45226042 CAGGGACTGGTGGAGGTGGATGG + Exonic
1180327343 22:11441974-11441996 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1180367101 22:11950555-11950577 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1180604384 22:17046072-17046094 TCGTGTCTGGTGAAGCTGCATGG + Intergenic
1181351421 22:22261305-22261327 GTGTTTCTGGTAAAGCTGGAAGG + Intergenic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183122514 22:35741042-35741064 CTGTGGCTGTTGAAGGATGATGG + Intronic
1183446206 22:37857116-37857138 CTTTGGGAGGTGAAGGTGGACGG + Intronic
1184259966 22:43309120-43309142 CTGGAGCTGGTGAAGGTGCAGGG - Intronic
1185020176 22:48369890-48369912 CTGCCTCTTGGGAAGGTGGAGGG + Intergenic
1185086155 22:48742159-48742181 CTGTGCCTGGTGAAGGATGAGGG - Intronic
1185086170 22:48742202-48742224 CTGTGCCTGGTGAAGGATGAGGG - Intronic
1185086185 22:48742245-48742267 CTGTGCCTGGTGAAGGATGAGGG - Intronic
1185088165 22:48751975-48751997 CTGTGGCTGGTGAGGCTGGTGGG + Intronic
1185243103 22:49756861-49756883 CACTGTGGGGTGAAGGTGGAGGG - Intergenic
949437111 3:4041417-4041439 TTGTGTCAGGTGAACGTGAAAGG - Intronic
949495750 3:4630236-4630258 CTGTGACTGGTGTAGGTATATGG + Intronic
950230242 3:11269921-11269943 CTTTGTGAGGTGAAGGTGGGAGG + Intergenic
950418928 3:12885383-12885405 TGCTGTCTGGTGACGGTGGATGG - Intergenic
951827969 3:26889577-26889599 GTGTGTGTGGTGAGGGTTGAGGG - Intergenic
952645294 3:35650000-35650022 CTGTGTGTGTTTAAAGTGGATGG - Intronic
953582896 3:44173180-44173202 CAGTGAATGGTGAAGCTGGATGG - Intergenic
954761390 3:52877261-52877283 CTGAGGCATGTGAAGGTGGAGGG - Intronic
955047988 3:55377705-55377727 CAGGGTCTGATGAAGATGGATGG + Intergenic
955989633 3:64612580-64612602 CTGTGGCTGGTCAGGGTGAAGGG + Intronic
958744208 3:98113471-98113493 ATGTGTCTTGGGAAGGTGGAGGG - Intergenic
960438289 3:117654445-117654467 TTGTGTGTGCAGAAGGTGGAGGG - Intergenic
960623595 3:119659610-119659632 ATGTGTGTGGTGATGGTAGAGGG + Intronic
960644234 3:119860951-119860973 GTGGGTCTGGTGAAGGGTGAGGG - Intronic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961460160 3:127045119-127045141 CTGGCTCAGGTGCAGGTGGAGGG + Intergenic
961746095 3:129064312-129064334 CTGTGGGTGGAGAGGGTGGAGGG + Intergenic
961810845 3:129520928-129520950 GTGGGGCTGGGGAAGGTGGATGG - Intergenic
962292383 3:134147404-134147426 CACTGTCTGGTGAGGGTGGCGGG - Intronic
963810154 3:149768546-149768568 CTCTGTCTGGGGAGGGGGGATGG - Intronic
964417553 3:156463452-156463474 CTTTGCCTGGAGGAGGTGGAGGG - Intronic
964807535 3:160627919-160627941 CTGTGTCCTGTCATGGTGGAGGG + Intergenic
1202741058 3_GL000221v1_random:56465-56487 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
969449088 4:7262838-7262860 CTGTGTCTGGTGAAGGTGGAGGG + Intronic
970254382 4:14152254-14152276 GTGTGTTTGGTGATGGTTGAGGG + Intergenic
970996143 4:22269225-22269247 CCTGTTCTGGTGAAGGTGGAAGG - Intergenic
971114655 4:23630749-23630771 GTGTGTGTGGTGGTGGTGGACGG - Intergenic
971448238 4:26775590-26775612 CTGTGTCATCTGATGGTGGAAGG - Intergenic
972495167 4:39627819-39627841 CTGTGCCTGGTCAAGGTCCAGGG + Intronic
973759917 4:54106126-54106148 CTGTGTTTGGAGAAGATGGGAGG - Intronic
974217230 4:58865555-58865577 CAATGTCAGGTGAAGATGGAAGG - Intergenic
975355886 4:73403430-73403452 CTATGCCTGGTGAAGGTCAAGGG + Intronic
976314254 4:83642636-83642658 ATCTGACTGGTGAATGTGGAAGG + Intergenic
978546153 4:109874618-109874640 CTCTGTCCTGTGAAGATGGAAGG - Intergenic
978970707 4:114801382-114801404 CTATGTCTGGTTAAGTTTGATGG + Intergenic
979551993 4:122001880-122001902 CTGTGTGTGATGCTGGTGGATGG + Intergenic
979785504 4:124712185-124712207 GTGTGTCTTTTGAAGGGGGAGGG + Intronic
983929410 4:173436563-173436585 CAGTGTTTGGTGAATGTTGATGG - Intergenic
984204726 4:176772788-176772810 CTGTGTCTTCTCATGGTGGAAGG - Intronic
985624184 5:976468-976490 CAGGGTCTGGGGGAGGTGGATGG + Intergenic
985708459 5:1414895-1414917 CTGTGTCTGGGGAAGGGGGCGGG + Intronic
985771140 5:1812143-1812165 CTGTGTCTGGTGAGGGTGGAAGG + Intronic
985792195 5:1935331-1935353 CTGGGTCTGGTGTAGGAGGATGG - Intergenic
986333497 5:6735405-6735427 TAGTGACTGGTGAAGGTGAAGGG + Intronic
986725742 5:10595098-10595120 CTGTGACTGTGGAGGGTGGAGGG + Intronic
986806350 5:11312014-11312036 GTGTGTGGGGTGAAGGTGTATGG - Intronic
988700213 5:33666199-33666221 CTGTGTATGTTAACGGTGGAGGG - Intronic
989651735 5:43697712-43697734 ATGTGGATGGTGATGGTGGAAGG + Intronic
989736221 5:44710134-44710156 TTTTGTGTGGGGAAGGTGGAAGG - Intergenic
990821408 5:59844767-59844789 TTATGTATGGAGAAGGTGGAGGG + Intronic
991588982 5:68229448-68229470 CTAAGTCAGGTGGAGGTGGAGGG - Intronic
991974006 5:72168208-72168230 CTGTTGCTGGAGAAGCTGGAAGG - Intronic
992112563 5:73509883-73509905 CTTTGTCTGGTCATCGTGGAGGG - Intergenic
992477974 5:77122214-77122236 CCATGACTGGTGATGGTGGATGG - Intergenic
994155807 5:96503324-96503346 CTATGTAAGGTGAAGGTGAAAGG + Intergenic
994964167 5:106645084-106645106 CTGTCTCTGGTGAAGATTTAGGG + Intergenic
995368344 5:111389176-111389198 CTGTGTCTGCACATGGTGGAAGG + Intronic
995403417 5:111766771-111766793 CTGGTTCTGGTGAAGGAGAAGGG + Intronic
997665241 5:135625298-135625320 CTGTGTGCTGTGAAGATGGAGGG + Intergenic
997952563 5:138253652-138253674 CTCTGTTTGGTGGAGATGGATGG + Intronic
998210099 5:140189395-140189417 CTGTGTCTGGTGAAGCTCTCAGG - Intronic
998501506 5:142636835-142636857 CTGTGGCTGGGGAAGCTGGCAGG + Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999499881 5:152136234-152136256 CTGTGTTTGGGGAATGTGGGTGG - Intergenic
1000289919 5:159860712-159860734 CTGTGTCTGTAGATAGTGGAAGG - Intergenic
1000511565 5:162189910-162189932 CCTTTTCTGGTGAAGGTGGCAGG + Intergenic
1000900608 5:166907523-166907545 CTATGTCAGGGTAAGGTGGAGGG + Intergenic
1002172948 5:177385571-177385593 GTGTGTGTGGTGAGGATGGAGGG + Intronic
1002300643 5:178255703-178255725 CTGTGACTGGGGACGGGGGAGGG - Intronic
1002534184 5:179867258-179867280 CCGTGTCTGCTGTAGGTGGGCGG - Intronic
1002599361 5:180345550-180345572 ATGTGGCTGGAGAAGGTGGTGGG - Intronic
1002805684 6:571996-572018 GTGTGACTGCAGAAGGTGGACGG + Intronic
1003353151 6:5339676-5339698 CTGTGGCAGGTCAAGGTGGGTGG - Intronic
1003644519 6:7903749-7903771 CTGTTTCTGAAGGAGGTGGAGGG - Intronic
1003651447 6:7964517-7964539 CTCTGTAGGGTGAAGGTGAATGG + Intronic
1003891293 6:10565977-10565999 CTGTGTTTGGTGAAGGTGCTGGG - Intronic
1004466275 6:15888179-15888201 ATATGTCTGGTTAAGGTGGGTGG + Intergenic
1005192294 6:23238673-23238695 GTTTGTTGGGTGAAGGTGGATGG + Intergenic
1006957896 6:37892540-37892562 CTTTTTCTAGTGAAGGTAGAAGG - Intronic
1006964026 6:37963643-37963665 CTGTTGCTGGTGAAGCAGGATGG - Intronic
1006984039 6:38166157-38166179 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984047 6:38166185-38166207 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984135 6:38166462-38166484 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1007693672 6:43718460-43718482 CTGTGTGTGGTGTAGGGAGATGG + Intergenic
1009312245 6:62169892-62169914 CTTTGTCTGGTGAGGGTGGATGG - Intronic
1010196230 6:73242318-73242340 ATGTGACTGATGAAGGTGGGAGG + Intronic
1010524887 6:76888683-76888705 CTGTTTCTGGTGAGGGTGTCAGG + Intergenic
1011381312 6:86744768-86744790 CTGTTTCTGCTCATGGTGGAAGG - Intergenic
1011524224 6:88245906-88245928 CTGTCTTTGATAAAGGTGGAAGG + Intergenic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013428516 6:110035758-110035780 CTGTGGGAGGTCAAGGTGGAAGG + Intergenic
1013589172 6:111605842-111605864 CTGGGCCCGGAGAAGGTGGAGGG - Exonic
1015037208 6:128670132-128670154 CTGAGGGTGGTGATGGTGGATGG + Intergenic
1015627488 6:135195731-135195753 CTGTGTCTAAGGAAGGGGGAAGG - Exonic
1016709828 6:147156826-147156848 TTGGGTTTGGTGAACGTGGATGG - Intergenic
1016808313 6:148235208-148235230 ATGTGTATGGTGGAGGTGGATGG + Intergenic
1017931792 6:158961827-158961849 GTGTGTGTTGTGGAGGTGGAGGG + Intergenic
1017988214 6:159463201-159463223 CTGTGGCTGGCGAAGGTAGACGG - Intergenic
1018060605 6:160086879-160086901 GTGTGTGTGGTCAGGGTGGAAGG + Intronic
1018487470 6:164256537-164256559 CTGTGGCTAGTCAAGGGGGAGGG - Intergenic
1019221339 6:170475172-170475194 CTGTGACTGGTGCAGGGGGCCGG + Intergenic
1019351631 7:556762-556784 GTGTGTTTGGAGAAGGTGAAAGG - Intronic
1019442745 7:1055693-1055715 CTCTGTGGGGTGAAGGTGGCCGG + Intronic
1019468932 7:1207537-1207559 TTGTGTCTGGTTCAGGAGGAGGG - Intergenic
1019665276 7:2249145-2249167 CTGTGCCTGGAGGAGGTGTAAGG - Intronic
1022095012 7:27134184-27134206 TTGTGTCTAGTGTAGGTGGTGGG - Intronic
1022109130 7:27217285-27217307 GTGTGTGTGGGGAAGGTGGTGGG + Intergenic
1022186189 7:27971757-27971779 ATGTGTATGGTGGGGGTGGAAGG + Intronic
1022419493 7:30207096-30207118 CTGTGCCTGGGGAATGTGAAAGG - Intergenic
1022800310 7:33770399-33770421 CTGTGCCTTGTGAAGCTTGAGGG + Intergenic
1023238968 7:38121867-38121889 CTGTGTCTGGTTTAGCTTGAGGG - Intergenic
1023491617 7:40748915-40748937 CGGTGACTGCTGGAGGTGGAAGG - Intronic
1024114290 7:46177755-46177777 CTGTGTCCTGACAAGGTGGAAGG - Intergenic
1024158741 7:46652527-46652549 ATGTGTCTGGTGAGGGCAGATGG - Intergenic
1028506621 7:91578655-91578677 CTGTGTCAGATGAAGCTGGAGGG - Intergenic
1029099236 7:98114634-98114656 CTGCATCTGGTGAAGGGAGACGG + Intronic
1029969996 7:104779547-104779569 CTGTGCCTGGTGCAGGGAGAGGG - Intronic
1031174332 7:118330411-118330433 CTGTCTCTGGTGAAGGGGCAGGG + Intergenic
1032398611 7:131608326-131608348 CTCTGTCTGTTGAAGGGGGATGG + Intergenic
1032435702 7:131898598-131898620 CTGTGTGTGGTAAATGTGGGAGG + Intergenic
1032904204 7:136345744-136345766 CTGTGTCTCTTGAAGGGGAAAGG - Intergenic
1033052234 7:138015880-138015902 CAGTGACTTGTGAAGGTGGGAGG + Intronic
1033789400 7:144773447-144773469 CTGTGGGTGGTCAAGGTAGAAGG + Intronic
1034930975 7:155163933-155163955 CTGGCTCTGGTGGAGGTGGAAGG - Intergenic
1035520324 8:271012-271034 CTCTGTGTGGTGAGGCTGGAGGG - Intergenic
1036062781 8:5342744-5342766 CTGTGTCTGCAGAATATGGAGGG + Intergenic
1036567541 8:9950338-9950360 CTGAGTCTGGTGAGGATGGAGGG + Intergenic
1037232767 8:16679369-16679391 CTGCCTCTGGTGCAGCTGGATGG - Intergenic
1039285637 8:36037641-36037663 CTGTATGGGGTGAAAGTGGAAGG + Intergenic
1040552703 8:48450748-48450770 CTGTGTCTGGATGAGGGGGAAGG + Intergenic
1041439037 8:57874263-57874285 CTGTAATTGGTGAAGGTGGGAGG - Intergenic
1042878058 8:73457892-73457914 CTGGGTCTTGTGGAGGTGAATGG + Intronic
1043942863 8:86215442-86215464 CTTTGTGAGGTCAAGGTGGATGG + Intronic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1045116239 8:98984240-98984262 CTTTGGGTGGTCAAGGTGGAAGG + Intergenic
1045282130 8:100758366-100758388 CTGTGTCTGGTGATGGAGCAAGG - Intergenic
1046066669 8:109205450-109205472 CTGCCTATGGTGAAAGTGGAGGG - Intergenic
1046670219 8:117048632-117048654 CTGTGTCTGGTTTAGTAGGATGG + Intronic
1046705405 8:117444456-117444478 TTGTGTTTGGAGAAGGTGGAAGG + Intergenic
1046830943 8:118745248-118745270 CTATGTTTGTTGAAGGTTGAGGG + Intergenic
1046974465 8:120258468-120258490 CTGTATCTGGTGGTGGTGGCTGG + Intronic
1048833919 8:138500384-138500406 CTGGTTCTGCTGCAGGTGGAAGG + Intergenic
1049211970 8:141391143-141391165 CTCTGGCTGCTGAGGGTGGATGG + Intergenic
1049264736 8:141661555-141661577 CTGTGACTGGTGGTGGTGCAGGG + Intergenic
1049474006 8:142788521-142788543 CTGGGTCTGGTGGAGCTGGAGGG + Intergenic
1050931340 9:11330886-11330908 ATGTGTCTGGTGGGGATGGAGGG - Intergenic
1051416850 9:16850624-16850646 CTGTGGAAGGTGAAGGTGGAAGG + Intronic
1051475795 9:17507823-17507845 CTGTGTCTGCTGAAGAAAGAAGG - Intergenic
1052619251 9:30884014-30884036 CAGTGTCTGGTGATGGAGCATGG - Intergenic
1052915955 9:33924496-33924518 CTCTGCCTGGTGAAGCTGCAGGG - Intronic
1053730270 9:41047756-41047778 CTCTGCCTGGTGGAGGAGGATGG - Intergenic
1055425238 9:76188598-76188620 CTGTCTCCTGTGAAGATGGACGG + Exonic
1055704704 9:78985021-78985043 CTGTGACTGTTCAAAGTGGAAGG + Intergenic
1055953938 9:81756572-81756594 GTGGGTTTGGTGAAGGTGGCAGG + Intergenic
1056340876 9:85630721-85630743 CTTTGTCAGGCCAAGGTGGATGG - Intronic
1057425916 9:94949545-94949567 CTGTGTCTGCTGCAGGCTGATGG + Intronic
1058747204 9:108003298-108003320 ATGGGTCTGGTGAAGGATGAAGG - Intergenic
1059699406 9:116760655-116760677 TTGTGCCTGGGGAAGGGGGAGGG + Intronic
1059734589 9:117088510-117088532 CTGTGTGTGTTGGAGGTGGGAGG + Intronic
1060009022 9:120027102-120027124 CTGTGTCTGCTGTAGTTTGATGG - Intergenic
1060066937 9:120510534-120510556 GTGTGTTTGGTGAAGGGTGAGGG - Intronic
1061550356 9:131331101-131331123 ATGTGGCTGGTGAAGGTGGCTGG - Intergenic
1061864507 9:133485422-133485444 CCGTGTCTTGGGAAGGTGGGAGG + Intergenic
1203709697 Un_KI270742v1:86395-86417 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1185877472 X:3712805-3712827 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185894024 X:3843052-3843074 CTGTGTGTGCTGGGGGTGGAGGG + Intronic
1185899142 X:3881476-3881498 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1185904259 X:3919905-3919927 CTGTGTGTGCTGGGGGTGGAGGG + Intergenic
1186567198 X:10676346-10676368 CTCTGTCTGGTGTATGAGGACGG - Intronic
1186844580 X:13517962-13517984 CTGGGTATGGAGAAAGTGGAAGG - Intergenic
1187274784 X:17807683-17807705 CCGTGGCTGGTGAAGGTGAGTGG - Intronic
1188461754 X:30435250-30435272 CTGAATCTGGTCAAGGTGAATGG - Intergenic
1190929196 X:54933957-54933979 GTGTGGCTGGTGATGGGGGAGGG - Intronic
1192240460 X:69323985-69324007 CTGTCTCTGGGGACGGAGGATGG + Intergenic
1193525686 X:82585581-82585603 TTGTGTGTGGTGGAGGTGGGAGG + Intergenic
1194024534 X:88735640-88735662 CTGTGTCTGGGGAGGGTGGGTGG + Intergenic
1196745836 X:119071011-119071033 TAGTGTCTGGTGAGGGTGGTGGG + Intergenic
1197173723 X:123462590-123462612 CTTTGCCAGGTGAAGGTGGGAGG + Intronic
1197572105 X:128162862-128162884 CTGTCTCTGGTGAAAGTGGCAGG + Intergenic
1197773813 X:130107354-130107376 CTGTGTGTGGGGAGGGTGGGAGG + Intronic
1197842970 X:130769699-130769721 GTGTGTCAGGTGATGTTGGATGG - Intronic
1198244819 X:134820064-134820086 CTGTGGCTGCTGAAGATGGTAGG - Intronic
1199490688 X:148397223-148397245 CTTTGTCTGTTCAAGGTGGGAGG - Intergenic
1199874784 X:151921177-151921199 TTCTGCCTGGTGAGGGTGGAGGG - Intronic
1200254536 X:154572948-154572970 CTGTTTCTGGTGATGCTGGGTGG + Intergenic
1200263233 X:154631460-154631482 CTGTTTCTGGTGATGCTGGGTGG - Intergenic