ID: 969449392

View in Genome Browser
Species Human (GRCh38)
Location 4:7264504-7264526
Sequence TGTGATTTCCTGTGGATAGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 198}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
969449392_969449400 7 Left 969449392 4:7264504-7264526 CCGGCTATCCACAGGAAATCACA 0: 1
1: 0
2: 0
3: 18
4: 198
Right 969449400 4:7264534-7264556 ACTCAGCCCCTGGTCTGGGAAGG 0: 1
1: 0
2: 2
3: 26
4: 262
969449392_969449399 3 Left 969449392 4:7264504-7264526 CCGGCTATCCACAGGAAATCACA 0: 1
1: 0
2: 0
3: 18
4: 198
Right 969449399 4:7264530-7264552 GGGCACTCAGCCCCTGGTCTGGG 0: 1
1: 0
2: 1
3: 20
4: 225
969449392_969449404 18 Left 969449392 4:7264504-7264526 CCGGCTATCCACAGGAAATCACA 0: 1
1: 0
2: 0
3: 18
4: 198
Right 969449404 4:7264545-7264567 GGTCTGGGAAGGCTTCTCCGTGG No data
969449392_969449405 26 Left 969449392 4:7264504-7264526 CCGGCTATCCACAGGAAATCACA 0: 1
1: 0
2: 0
3: 18
4: 198
Right 969449405 4:7264553-7264575 AAGGCTTCTCCGTGGAGTGATGG 0: 1
1: 0
2: 0
3: 8
4: 143
969449392_969449398 2 Left 969449392 4:7264504-7264526 CCGGCTATCCACAGGAAATCACA 0: 1
1: 0
2: 0
3: 18
4: 198
Right 969449398 4:7264529-7264551 TGGGCACTCAGCCCCTGGTCTGG 0: 1
1: 0
2: 2
3: 26
4: 216
969449392_969449397 -3 Left 969449392 4:7264504-7264526 CCGGCTATCCACAGGAAATCACA 0: 1
1: 0
2: 0
3: 18
4: 198
Right 969449397 4:7264524-7264546 ACAGGTGGGCACTCAGCCCCTGG 0: 1
1: 0
2: 1
3: 36
4: 318

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
969449392 Original CRISPR TGTGATTTCCTGTGGATAGC CGG (reversed) Intronic
900565771 1:3331190-3331212 TTTGATCACCTGTGGATTGCAGG + Intronic
904907021 1:33905215-33905237 TGTGATTTGTTGGGGCTAGCTGG + Intronic
905991483 1:42341003-42341025 TGTAATTTCCTATTGACAGCAGG + Intergenic
907917737 1:58886266-58886288 TGTGCTGTCCTCTGGAGAGCTGG - Intergenic
911688041 1:100799921-100799943 TCTGTTTTACTGTGGCTAGCTGG - Intergenic
911940454 1:104040299-104040321 AGTGATTTCCTGAGGACAGTGGG - Intergenic
915005425 1:152630601-152630623 TCTATTTTGCTGTGGATAGCTGG - Intergenic
915035842 1:152924114-152924136 TGTGTATTCCTGTGGATAACAGG + Intergenic
918345805 1:183606186-183606208 TGTCATTTCTTGAGGGTAGCAGG + Intergenic
919209980 1:194469592-194469614 TGTGATGTCCTGTGGGATGCTGG + Intergenic
920540793 1:206776559-206776581 TGGGTTTTCCTGTTGAGAGCGGG + Intergenic
923315710 1:232778202-232778224 TGTGATTTTCTGTTGATATAAGG - Intergenic
924571550 1:245241636-245241658 TGTGTCATCCTGTGGACAGCTGG + Intronic
1064194146 10:13231911-13231933 AGTCAACTCCTGTGGATAGCAGG - Intronic
1066562612 10:36686993-36687015 ACTATTTTCCTGTGGATAGCTGG + Intergenic
1068005679 10:51390877-51390899 AGTGATTTCCTGTGCATTGTTGG - Intronic
1068291885 10:55013761-55013783 TTTTATTTCCTATGGATAACAGG - Intronic
1069412898 10:68171224-68171246 TGTGTTTTCCTGGGTATAGCGGG - Intronic
1070251746 10:74779377-74779399 TGTAGTTTCCTGTGGATATCAGG - Intergenic
1070494793 10:77011598-77011620 CGTGATTTCCAGTGGATTGGGGG - Intronic
1074957544 10:118407112-118407134 TCAGATTCCCTGTGGATATCAGG + Intergenic
1078067074 11:8085598-8085620 TGTGATTTCCTGGGTCCAGCAGG + Intronic
1078196109 11:9138403-9138425 TTTGCTTTCCTGGGGATGGCAGG - Intergenic
1078671693 11:13371370-13371392 TGGGATTTGCTGTGAATATCAGG - Intronic
1079246032 11:18753023-18753045 AGGGATTGCCTGTGGATATCTGG + Intronic
1080232354 11:30032052-30032074 TTTGATTTCCTTTAGAAAGCAGG - Intergenic
1080504528 11:32899356-32899378 TGTGATTATCTTTGGTTAGCAGG + Intronic
1081040181 11:38200723-38200745 TTTGGTTTTCTGTGGGTAGCAGG - Intergenic
1083131337 11:60625658-60625680 TGTGTTTTCCTGTTTATATCTGG - Intergenic
1083575118 11:63784688-63784710 TGTAATTTTCTCTTGATAGCTGG - Intergenic
1083729994 11:64647740-64647762 TGTTATTTCCTGCTGAGAGCAGG - Intronic
1084986294 11:72875780-72875802 TGTGATTTGCTTTGGCTAGTGGG + Intronic
1085170175 11:74443142-74443164 TGTTATTTCCTCTGGGAAGCAGG - Intergenic
1086178022 11:83915902-83915924 AGTGATTTCCTGGGGCTAGAGGG - Intronic
1087252345 11:95917093-95917115 TTTGACTTCCTGTGGAAAGCAGG + Intronic
1088265130 11:107981414-107981436 TGGGTTTTCCTGTTGAGAGCGGG - Intergenic
1088290972 11:108236768-108236790 TGTTGTTTCCTGTTTATAGCTGG + Intronic
1088998156 11:115021787-115021809 TGTGATTTTTTGTTGATAACTGG - Intergenic
1093075318 12:14752204-14752226 TAAGATTTCCTGTAAATAGCTGG + Intergenic
1093307623 12:17539614-17539636 TGTGGTTTCTTGCGGATATCGGG + Intergenic
1093547063 12:20360804-20360826 TGTAATTTCATCTTGATAGCTGG + Intergenic
1093975899 12:25421784-25421806 AGTGATGTCATGTGGATATCAGG - Intronic
1096476518 12:51912382-51912404 TGTGATTTCCTCTGGGCAGGAGG + Intronic
1097372058 12:58796315-58796337 TGTGAGTTTCTGTGGAAAGTTGG + Intronic
1097733833 12:63159209-63159231 TGTGATTACCTGTGGATACTAGG - Intergenic
1099837173 12:87921270-87921292 TGTGGTTACCTGTGGAGGGCGGG - Intergenic
1101293870 12:103400836-103400858 TGTGATTTCCTCAGTATTGCTGG + Intronic
1101491168 12:105210984-105211006 TGTCATTTGCTGAGGGTAGCAGG - Intronic
1102586903 12:113930055-113930077 TGGGATTTCCTCTGTAAAGCTGG - Intronic
1103161712 12:118734707-118734729 TGTGATTTCCTATAGAAAGATGG - Intergenic
1103264984 12:119621850-119621872 TGTGTTTTGCTTTGGCTAGCTGG - Intronic
1104626721 12:130362747-130362769 TGTGTTTTTCTCTGAATAGCTGG + Exonic
1107357925 13:39587849-39587871 TGTGATTTTCTGATGAGAGCTGG + Intronic
1108119353 13:47166459-47166481 AGTGATTGCCTGTGGGTGGCGGG + Intergenic
1110786002 13:79526844-79526866 TGTGATTTACTCAGGATGGCTGG - Intronic
1112779566 13:102883908-102883930 TGTCATTTCCTGTATATGGCAGG + Intergenic
1114881964 14:26797458-26797480 ACTGATTTCCTGTTAATAGCAGG - Intergenic
1117672883 14:58125793-58125815 TGGGTTTTCCTGTTGAGAGCGGG + Intronic
1119053048 14:71389588-71389610 TCAGATTTCCTGTAGATTGCAGG + Intronic
1119429073 14:74554060-74554082 TGTCATTTCCTCTGGAACGCTGG - Intronic
1120051591 14:79873358-79873380 TGTGGTTTCCTCTGGCAAGCAGG - Intergenic
1121218869 14:92270575-92270597 TGTAATTTTCTGTTGAAAGCTGG + Intergenic
1123785924 15:23673334-23673356 TGTAAGTACCTGAGGATAGCTGG + Intergenic
1124210005 15:27755077-27755099 TGTCTTTTCCTATGTATAGCAGG + Exonic
1124789848 15:32717738-32717760 TGTGATTTGCTGTGCATTCCAGG + Intergenic
1127719026 15:61681543-61681565 TTTCATCTCCTGTGGTTAGCTGG + Intergenic
1131657272 15:94474721-94474743 TGTGATTTCCTGTTGACAGTCGG + Intronic
1133169111 16:3969968-3969990 AGTGATTGCCTCTGGATGGCAGG - Intronic
1133638650 16:7695767-7695789 TCTGATATCCAGTAGATAGCAGG - Intronic
1133865236 16:9636045-9636067 TGTGATTTCTTATTTATAGCTGG + Intergenic
1134885050 16:17783306-17783328 TGTGCTTTCCTGTGCATTGTAGG - Intergenic
1136704511 16:32175085-32175107 TTTTATTACTTGTGGATAGCTGG + Intergenic
1136763401 16:32754321-32754343 TTTTATTACTTGTGGATAGCTGG - Intergenic
1136804699 16:33116065-33116087 TTTTATTACTTGTGGATAGCTGG + Intergenic
1138118395 16:54378713-54378735 TGTGATTTCCTTTGAATCTCTGG + Intergenic
1203065551 16_KI270728v1_random:1014642-1014664 TTTTATTACTTGTGGATAGCTGG - Intergenic
1147839098 17:43357816-43357838 TGTAGTTTCCTGGGGATATCAGG + Intergenic
1148195740 17:45711273-45711295 AGTGAGTTCATGTGGAAAGCTGG + Intergenic
1148343679 17:46889376-46889398 TCTGCTTCCCTGTGGCTAGCTGG - Intergenic
1152848345 17:82616297-82616319 TGTGATTTCCTGGGGGAAACTGG + Intronic
1155996204 18:32333668-32333690 TGTGATTTCCTGTGAAGAGGTGG + Intronic
1156239756 18:35241274-35241296 TGCGTTTTCCTTTGGAAAGCAGG - Intronic
1158709302 18:59823291-59823313 TGCGATTTTCTGTGAACAGCTGG + Intergenic
1158767532 18:60472748-60472770 AATGATTTCCTGTGAATTGCTGG + Intergenic
1161928993 19:7323546-7323568 TGAGATCTCCCGTGTATAGCTGG - Intergenic
1162856018 19:13469206-13469228 TCTGTTTTCCTGTGGATCTCAGG - Intronic
1166665473 19:44677338-44677360 TTTGTTTTCCTTTGGAGAGCCGG - Intronic
1167619905 19:50555014-50555036 TGTGATATCCTGTGCAGTGCGGG - Intronic
925339589 2:3126887-3126909 AGTGATTTCCTGTCCAAAGCTGG - Intergenic
926240299 2:11080288-11080310 TGAGATTTGCAGTGGAAAGCAGG + Intergenic
926321885 2:11754187-11754209 TGTAATTTCCTGCTGATAACAGG + Intronic
926816425 2:16802300-16802322 TGGGTTTTCCTGTTGAGAGCGGG - Intergenic
928867365 2:35933162-35933184 TGTGCTTTCTTGTAGTTAGCTGG - Intergenic
929566207 2:42986958-42986980 AGTGATTTCCTGGGGATGGGGGG - Intergenic
930912333 2:56644143-56644165 TGTGTTGTCCTCTGGATAGCTGG + Intergenic
935761370 2:106323743-106323765 TGTGATTTCCTTTCGGTTGCCGG + Intergenic
936369357 2:111890655-111890677 TGTCATTTCCTGGGAATGGCTGG - Intergenic
937018113 2:118624738-118624760 TGTGATTTTCTTTGGAAAGAGGG - Intergenic
942496528 2:176545979-176546001 TGTGATTTCTTGTGGAATGTAGG + Intergenic
942666747 2:178327787-178327809 TGTTATTCCCTGTTAATAGCAGG + Intronic
942798187 2:179845905-179845927 TGTCATGTCATGTGGCTAGCAGG + Intronic
943712148 2:191109124-191109146 ACTGATTTCCTGTGGGTCGCAGG + Intronic
944863152 2:203834630-203834652 TGTTATTTGCTGAGGATAACGGG - Intergenic
946034198 2:216728798-216728820 TGTGATTTACTCTGGACAACAGG - Intergenic
947102534 2:226636778-226636800 TGTGATTTGCTTTGGCTAGTGGG - Intergenic
947839197 2:233196854-233196876 TGAGAATTCCTGTGTACAGCGGG - Intronic
948711397 2:239827756-239827778 TTTGATTCCTTGTGGAAAGCTGG - Intergenic
1169435325 20:5582468-5582490 TGTTCTTTCCTGTGCTTAGCAGG + Intronic
1169947515 20:11005032-11005054 TGTGGTTTCCAGTGGATACTAGG - Intergenic
1170208935 20:13828716-13828738 TGTGAGTTCCTGAGGAAAACAGG + Intergenic
1171028373 20:21653637-21653659 TGTAGTTTCCTATGGATATCAGG - Intergenic
1171453883 20:25255644-25255666 TGTGCTTTCCTGGGGACAGGAGG + Intronic
1174336906 20:49868905-49868927 TTTGATTTGCTGTGGATACCAGG - Intronic
1174846661 20:53949475-53949497 TCTCATTTCCTGTGGGTAACAGG + Intronic
1176789219 21:13299150-13299172 TATGCTTTCCTGTGAAAAGCAGG + Intergenic
1177154259 21:17485597-17485619 TGTGGTTTGCTGTGGTTACCAGG - Intergenic
1177954817 21:27584624-27584646 GGTTATTTCCAGTGGAGAGCAGG + Intergenic
1183335042 22:37241565-37241587 TGTGAGTTCCTGGGGATATGTGG - Exonic
950378429 3:12591032-12591054 TGTGCTTTCCCGTGGACAGTGGG + Intronic
953553250 3:43921487-43921509 TCTCATTTCCTGTGGATGGTGGG + Intergenic
954096208 3:48330854-48330876 TGGGTTTTCCTGTTGAGAGCGGG - Intergenic
958800462 3:98749395-98749417 TTTCATTTGCTGTGGAGAGCAGG + Intronic
959374834 3:105576347-105576369 TGTGATTTATTGTGGAGAGCAGG - Exonic
959733415 3:109629928-109629950 TCTGATTTGCTATTGATAGCAGG - Intergenic
959928963 3:111957770-111957792 GGTTATTTCCTGTGGCTAGGTGG + Intronic
962146795 3:132848093-132848115 TTTGATTTCCTGGGGACAGGTGG - Intergenic
964043113 3:152287741-152287763 TCTGATTTGCTGTGGAAAGCTGG + Intronic
964513542 3:157479717-157479739 AGTGATTGCCTGTGAAGAGCTGG - Intronic
966499617 3:180625020-180625042 TGTATTTTCCTGGGGATTGCTGG + Intronic
967428341 3:189353140-189353162 TGTGAGCTCCAGTGGACAGCTGG - Intergenic
969018983 4:4126349-4126371 TGTGATTTCACCTGGATGGCAGG + Intergenic
969449392 4:7264504-7264526 TGTGATTTCCTGTGGATAGCCGG - Intronic
970173584 4:13313677-13313699 AGTGATTTCCTATTGAAAGCTGG - Intergenic
971412752 4:26392643-26392665 AGTGGTTTCCTGGGGATAGGGGG + Intronic
971485926 4:27160128-27160150 TGTGTTTGCCGGTGGATTGCTGG + Intergenic
972366661 4:38382150-38382172 AGTGATTTTCTGTGAATAGCTGG + Intergenic
973580164 4:52335983-52336005 TGTGGCTTCCTGTGGACTGCTGG + Intergenic
974400578 4:61400517-61400539 TGGGATTCCCTGTGAATAACTGG + Intronic
976902364 4:90194679-90194701 TGTCAATCCCTGTGGATAGCTGG + Intronic
980140691 4:128912969-128912991 TGTGATTTGCTGAGCATATCTGG + Intronic
980210250 4:129778353-129778375 TCTGATTTGCTTTGGAGAGCTGG + Intergenic
980768262 4:137336376-137336398 AGTGATTTCTTGGAGATAGCTGG + Intergenic
981535977 4:145800332-145800354 TATCATTTCATCTGGATAGCTGG + Intronic
981873199 4:149510839-149510861 AGTGATGTTGTGTGGATAGCAGG - Intergenic
982189730 4:152841981-152842003 TGGGTTTTCCTGTTGAGAGCGGG + Intronic
983174831 4:164576345-164576367 TGTGATTTCAAGGGGATGGCAGG - Intergenic
983994243 4:174161547-174161569 TGTCATTTCCTGAGGAAGGCTGG + Intergenic
984360281 4:178721124-178721146 TGTGACTTCCAGGTGATAGCAGG - Intergenic
987302120 5:16606365-16606387 TGAAATTTCCTGGGGAGAGCTGG - Intronic
988779520 5:34507374-34507396 TGTGATTTGCAGAGGATAGCAGG - Intergenic
991078539 5:62569119-62569141 TGTGATTTATTGTGGGTGGCGGG + Intronic
992404820 5:76447128-76447150 TGGGTTTTCCTGTTGAGAGCAGG + Intronic
993040331 5:82807156-82807178 TGTGGATAGCTGTGGATAGCTGG - Intergenic
993080321 5:83289327-83289349 TGTAATTTTCTGTTGAAAGCTGG + Intronic
993505318 5:88701791-88701813 AGATATTTCCTGTGGAGAGCAGG + Intergenic
994115249 5:96054571-96054593 AGTGATTTCCTGTGGAAATTTGG + Intergenic
994171874 5:96666843-96666865 TGAGATTCCATGTGGATAGGTGG + Intronic
995074341 5:107964239-107964261 TGTGCTTTCATGTGGTGAGCTGG + Intronic
996470253 5:123852306-123852328 TGGGATCTCCTGTGGGTAGGAGG + Intergenic
996989921 5:129616546-129616568 TGTGATATCCTGCGGAAAGCTGG - Intronic
997034894 5:130178081-130178103 TGTGATTATGTGTGGATAGATGG + Intronic
998501672 5:142638093-142638115 AGTCATTTCCTGAGGACAGCTGG + Intronic
999821386 5:155232424-155232446 TGTGCCTTCCTGTGCAGAGCAGG + Intergenic
1001538236 5:172514843-172514865 TGTAATTTCCTGTTGAAAGGTGG - Intergenic
1004255378 6:14058573-14058595 AGTGATTTCCAGTGGCTAGGAGG + Intergenic
1005581253 6:27237500-27237522 TGTTATTTCCGATGTATAGCTGG + Intergenic
1005586803 6:27284863-27284885 TGTGATGTGCTGTGGAGAGTTGG - Intergenic
1005679804 6:28195170-28195192 TCTGCTTTCCTGTGGGTAACTGG + Intergenic
1007240186 6:40419274-40419296 TGTAACTTGCTGTGGCTAGCGGG + Intronic
1008421970 6:51311512-51311534 TGACAATTCCTGTGGATATCTGG + Intergenic
1009545251 6:65011616-65011638 TGGGATTTCCTGTTGAGAGGGGG + Intronic
1011177073 6:84575520-84575542 AGAGATTTCCTGTGGTTAACTGG + Intergenic
1011749787 6:90443517-90443539 TGTGATTTTGTGTGGGTAGAGGG + Intergenic
1013130998 6:107232636-107232658 TGTGATTTCTTGTTTATAGTTGG + Intronic
1015388298 6:132651375-132651397 GGTGATATCCTGTGGGAAGCAGG - Intergenic
1018126912 6:160690944-160690966 GGTGAGTTCCTGAGGAGAGCGGG - Intergenic
1018149634 6:160926131-160926153 GGTGAGTTCCTGAGGAGAGCAGG + Intergenic
1018863001 6:167725184-167725206 TGTGACTTCCTTTGACTAGCAGG - Intergenic
1021676471 7:23085213-23085235 TGCAGTTTCCTGTGGATATCAGG + Intergenic
1026453926 7:70554535-70554557 TGTGTTTTCCCCTGGATGGCAGG - Intronic
1026518899 7:71097941-71097963 TGTGATTTGCTGTTGAGTGCAGG + Intergenic
1030943095 7:115680103-115680125 AGTGATTTCCTGATGACAGCAGG - Intergenic
1031700814 7:124923674-124923696 TGTATTTTCCTGGGGATAGCTGG - Intronic
1032949835 7:136894807-136894829 TGTGAATTCCTGGGGATGGATGG - Intronic
1034090501 7:148359798-148359820 TGTGATTTCCTATGTATCCCAGG - Intronic
1035391499 7:158507622-158507644 TGTGATTTCCTGCCCAGAGCAGG - Intronic
1035391584 7:158508087-158508109 TGTGATTTCCTGCCCAGAGCAGG - Intronic
1036198948 8:6750050-6750072 GGTGGTTTCCTGTGGAAAGCAGG - Intronic
1040848320 8:51870247-51870269 TGTGTTTTCCTTTGGATCACTGG - Exonic
1041612574 8:59869313-59869335 TGTAATTTCTTGTTGAAAGCTGG - Intergenic
1043412753 8:80015627-80015649 TGTAATTTCTTTTTGATAGCTGG - Intronic
1043764108 8:84107264-84107286 TGTGAATTCCTGTGCATGACCGG + Intergenic
1044838972 8:96322125-96322147 TGTGATTTGCTGTGGTGAGGAGG - Intronic
1048011317 8:130458511-130458533 TTTGATTTCCTGGGGATCACAGG - Intergenic
1049705891 8:144041839-144041861 TGTGTTTATCTGTGGATTGCAGG + Intronic
1050123783 9:2335419-2335441 CCTGATTTCCAGTGGATATCTGG + Intergenic
1050303335 9:4281845-4281867 TGTGATATCCTTTGGACACCAGG - Intronic
1050362051 9:4839501-4839523 TGTGCTTTCCTGGGGACAGTGGG + Intronic
1050734546 9:8748171-8748193 TGGGTTTTCCTGTTGAGAGCGGG + Intronic
1055769834 9:79705191-79705213 TTGGATTTTCTGTGGTTAGCTGG + Intronic
1057419240 9:94896540-94896562 AGTGATGTCATGTTGATAGCAGG + Intronic
1058398619 9:104586943-104586965 AGTGAGTTCCTGTGGATAATTGG + Intergenic
1058771798 9:108241171-108241193 TATGATTTTCTGTGCAGAGCTGG - Intergenic
1058774527 9:108270553-108270575 TGTGACTTCCTTTGGACAGGTGG - Intergenic
1059509437 9:114830318-114830340 GTTGATTTCCTGAGGCTAGCTGG + Intergenic
1060332394 9:122684892-122684914 TGTTTTTTCCTGGGGATAGCTGG - Intergenic
1062588964 9:137264422-137264444 TGTGTTTTGCCGTGGGTAGCAGG + Intronic
1189124926 X:38436142-38436164 TGTTTTTTGCTGTGGATGGCAGG - Intronic
1189321688 X:40091008-40091030 TGTGATTTCATGTGGGGAGGGGG - Intronic
1192418390 X:71005357-71005379 TGTGATTTGCTTTGGACAACAGG + Intergenic
1193202605 X:78709655-78709677 AGTGATTGCCTCTGGAAAGCAGG - Intergenic
1194416941 X:93625743-93625765 TATTCTTTCCTGTGGATACCAGG + Intergenic
1198517218 X:137421688-137421710 TGTGTTTTCCTTTGCACAGCTGG - Intergenic
1199986298 X:152954257-152954279 TGTGTTTCCCTGTGGTCAGCCGG + Intronic
1199988544 X:152970129-152970151 TGTGTTTCCCTGTGGTCAGCCGG - Intronic
1201758133 Y:17512136-17512158 TGTGGTTTCCAGGGGATAGGGGG + Intergenic
1201843422 Y:18393854-18393876 TGTGGTTTCCAGGGGATAGGGGG - Intergenic